Full text of "Mycotaxon"

See other formats

Cad

~ CORNELL University

CORNELL UNIVERSITY LIBRARY

WAIVE

1924 097 732 105

oY ; ak ‘

Ba Fe datos wy en ui AG: Py

i wat eae se a i 7 4

i, ae cvs sare t
Nee : Pahl r

ates as
ay Ve be A j 5 7 nie fi Re A ee (]
ree Nea le i an a ey no. a
; tha BATT leh a erg ce
| Manakin if Hes bo
Lbs i i A id i } sere he

Aes J -
3 ay Whe r A :
ay

we a
2

Ag hd
a8 Gite? Skea :

re he a a ek baal snd, = *
ws eg y

st “! J a rele

THE IN TERNATIONAL JOURNAL OF F UNGAL TAXONOM Yr & NOMENCLATURE

- Volume 94° Het ase $ October-December 2005 (2006)

CONTENTS

: Tuber umbilicatum, a new species from China, with a key to the spinose-reticulate
‘ 4 spored Tuber species _ Chen, Juan, Pei-Gui Liu & Yun Wang
Blumenavia toribiotalpaensis: a new species of Clathraceae from Jalisco, Mexico

! oes Luisa eee Reggae? & J. Antonio Vazquez-Garcia

ris Giege Tufan, Hiiseym Siimbiil & Aysen Ozdemur Tiirk

ul gic lan ealecuiee characterization of the yi eieeposs of —

eae hs ae . . Rosario Medel
a new w record of Lepiota o occurring in ‘the Gulf of Mexico area
Jota ha anes yom: Letiaa Montoya & Victor M. Bandala
rection of] Dothidotthia aspera “ane adenageaucla toa a byphomycetous

phic fungus, Thyrostoma negundinis _ Annette W. Ramaley

“Alan w. enrages & John A. Elix

sof Pertusaria nerore Western Australia

. iii Huang, Chunru Li,
Smear A. Hiiaben Kathie T. Hodge: Meizhen Fan & Zengzhi Li

et SP nov, a bambusicolous, synnematous fungus from
tad Gawas & Darbhe Jayarama Bhat

De ies es of / Anthracoidea ( ae from China . = Guo

. SPyle tte VWs ache esa a Y Jiang & ¥-J. Yao

ber paid and I. Suen poe ste Mirco ett, Mauro Marchetti,

‘Sl

ate 1

89
,
103
111

127
133

137

149

[Content continued from front cover]
Two new species of Hypogymnia (Lecanorales, Ascomycota) with pruinose
lobe tips from China Xinli Wei & Jiangchun Wei
Discovery and description of a teleomorph for Leptographium koreanum
H. Masuya, J.-J. Kim, M. J. Wingfield,
Y. Yamaoka, S. Kaneko, C. Breuil & G.-H. Kim
Two parasitic fungi on a new host, Syringa (Oleaceae)
Ovidiu Constantinescu, Vadim A. Melnik & Gerard J.M. Verkley
Further notes on the molecular taxonomy of Metarhizium
Bo Huang, Richard A. Humber, Shigui Li, Zengzhi Li & Kathie T. Hodge
The genus Hymenochaete (Basidiomycota, Hymenomycetes) in the Hawaiian
Islands Erast Parmasto & Robert L. Gilbertson
A new predatory fungus from China Dongshen Yang, Weimin Chen,
Ying Huang, Minghe Mo & Keqin Zhang
New species of sterile crustose lichens from Australasia John A. Elix
Some interesting pyrenomycetous fungi on bark of Quercus spp. from Spain
Julia Checa & M.N. Blanco
Biogeography and hosts of poroid wood decay fungi in North Carolina:
species of Fomes, Fomitopsis, Fomitella and Ganoderma
L.F. Grand & C.S. Vernia
Two new species of Ramaria from southwestern China
Ping Zhang, Zhu-Liang Yang & Zai-Wei Ge
The world’s second record of Neoheteroceras flageoletii reported from Turkey
Elsad Hiiseyin, Faruk Selcuk & Ahmet Sahin
Lewia chlamidosporiformans sp. nov. from Euphorbia heterophylla
Bruno S. Vieira & Robert W. Barreto
Weddellomyces turcicus, a new species on a grey Acarospora from Turkey
M. Gokhan Halici, Alan Orange & Ahmet Aksoy
Cordyceps spegazzinii sp. nov., a new species of the C. militaris group
Monica S. Torres, James F. White, Jr. & Joseph F. Bischoff
A phylogeny of Ramariopsis and allied taxa Ricardo Garcia-Sandoval,
Joagin Cifuentes,Efrain De Luna, Arturo Estrada-Torres & Margarita Villegas
A dichotomous key to Scutellospora species (Gigasporaceae, Glomeromycota)
using morphological characters
Gladstone A. Silva, Leonor C. Maia & Sidney L. Stiirmer
New species and phylogenetic relationships of Hypoxylon species found in
Thailand inferred from the internal transcribed spacer regions of ribosomal
DNA sequences _N. Suwannasai, S. Rodtong, S. Thienhirun & A.J.S. Whalley
Tricholoma equestre, the correct name for T: flavovirens (Agaricales)
H. Deng & Y. -J. Yao
A new species of Lecanicillium isolated from the white pine weevil,
Pissodes strobi Harry H. Kope & Isabel Leal
Two new species of Hymenochaetaceae from eastern China
Yu-Cheng Dai & Bao-Kai Cui
Some entomogenous fungi from Wuyishan and Zhangjiajie nature reserves
2. Three new species of the genus Hirsutella
Zongqi Liang, Yanfeng Han, Aiying Liu & Jianzhong Huang

[Content continued on inside back cover]

159
7
181
189

2
“19

pip as

zk
2a9
241
245
249
2a
265
295

303
BPs
331

341

349

MYCOTAXON

THE INTERNATIONAL JOURNAL OF FUNGAL TAXONOMY & NOMENCLATURE

Volume 94, 2005 (2006)

COMPLETE IN ONE VOLUME
CONSISTING OF VI + 412 PAGES INCLUDING FIGURES

EDITOR-IN-CHIEF

LORELEI L. NORVELL
editor@mycotaxon.com
Pacific Northwest Mycology Service
oe 6720 NW Skyline Boulevard
RARE ARM “portland, Oregon 97229-1309 USA
© Yaa ASSOCIATE EDITORS

3
8

NOMENCLATURE error BOOK REVIEW EDITOR
.SHAUN,RgPENN¥COOK Davip L. HAWKSwoRTH
PennycookS@LandcareResearch.co.nz MycoNova, Calle Aguila 12
Manaaki Whenua Landcare Research Colonia La Maliciosa, Mataelpino
Auckland, New Zealand ES-28411 Madrid, Spain
FRENCH LANGUAGE EDITOR INDEX EDITOR
GREGOIRE HENNEBERT KAREN D. GETTELMAN
32 Rue de l Elevage 510 Lake Blvd., Apt. 166
B-1340 Ottignies - LLN, Belgium Davis, CA 95616 U.S.A.

EDITORIAL ADVISORY BOARD

Gary J. SAMUELS, Beltsville, Maryland, USA (1997-2006), Chair
SEPPO HUHTINEN, Turku, Finland (2000-2005), Past Chair
DONALD H. PFisTER, Cambridge, Massachusetts, USA (1997-2007)
WEN-YING ZHUANG, Beijing, China (2003-2008)

CAROL A. SHEARER, Urbana, Illinois, USA (1998-2009)

SEAN Ross PENNYCOOK, Auckland, New Zealand (2005-2010)

Published by
MYCOTAXON, LTD, P. O. BOX 264
Ithaca, NY 14581-0264, USA

www.iycotaxon.com
Printed in the United States of America
© Mycotaxon, Ltd, 2005

MYCOTAXON

VOLUME NINETY-FOUR TABLE OF CONTENTS

Tuber umbilicatum, a new species from China, with a key to the spinose-
reticulate spored Tuber species Chen, Juan, Pei-Gui Liu & Yun Wang
Blumenavia toribiotalpaensis: a new species of Clathraceae from Jalisco,
Mexico Yalma Luisa Vargas-Rodriguez & J. Antonio Vazquez-Garcia
Studies on Basidiomycetes in Greece 1: The genus Crepidotus .
Z. Gonou-Zagou & P. Delivorias
The lichen flora of the Termessos National Park in Southwestern Turkey
Ozge Tufan, Hiiseym Siimbiil & Aysen Ozdemir Tiirk
Two new species of Anthracoidea (Ustilaginales) from China Lin Guo
A new species of Lepiota (Agaricaceae, Basidiomycetes) from China
Han-Chen Wang & Zhu-Liang Yang
ITS sequence analysis and ascomatal development of Pseudogymnoascus
roseus Y. Jiang & Y.-J. Yao
Morphological and molecular characterization of the mycorrhizas of
Inocybe rufuloides and I. splendens Mirco Iotti, Mauro Marchetti,
Enrico Bonuso & Alessandra Zambonelli
Russula in Himalaya 1: A new species of subgenus Amoenula
K. Das, S.L. Miller, J.R. Sharma, P. Sharma, & R.P. Bhatt
Streptopodium passiflorae comb. nov. on Passiflora rubra
J.R. Liberato & R.W. Barreto
Type revision of three Termitomyces species from India
B.-H. Tang, T.-Z. Wei & Y.-J. Yao
A review of the genus Gyromitra (Ascomycota, Pezizales, Discinaceae) in
Mexico Rosario Medel
A new species and a new record of Lepiota occurring in the Gulf of Mexico
area Leticia Montoya & Victor M. Bandala
The connection of Dothidotthia aspera (Botryosphaeriaceae) to a hypho-
mycetous anamorphic fungus, Thyrostoma negundinis Annette W. Ramaley
A new species of Pertusaria from Western Australia
Alan W. Archer & John A. Elix
Molecular evidence for the taxonomic status of Metarhizium taii and its
teleomorph, Cordyceps taii (Hypocreales, Clavicipitaceae) Bo Huang, Chunru
Li, Richard A. Humber, Kathie T. Hodge, Meizhen Fan & Zengzhi Li
Vamsaprija indica gen. et sp. nov., a bambusicolous, synnematous fungus from
India Puja Gawas & Darbhe Jayarama Bhat
Two new species of Hypogymnia (Lecanorales, Ascomycota) with pruinose
lobe tips from China Xinli Wei & Jiangchun Wei
Discovery and description of a teleomorph for Leptographium koreanum
H. Masuya, J.-J. Kim, M. J. Wingfield,
Y. Yamaoka, S. Kaneko, C. Breuil & G.-H. Kim

ili

103

War

135

137

149

I e}s)

159

Two parasitic fungi on a new host, Syringa (Oleaceae)
Ovidiu Constantinescu, Vadim A. Melnik & Gerard J.M. Verkley
Further notes on the molecular taxonomy of Metarhizium
Bo Huang, Richard A. Humber, Shigui Li, Zengzhi Li & Kathie T. Hodge
The genus Hymenochaete (Basidiomycota, Hymenomycetes) in the Hawaiian
Islands Erast Parmasto & Robert L. Gilbertson
A new predatory fungus from China Dongshen Yang, Weimin Chen,
Ying Huang, Minghe Mo & Keqin Zhang
New species of sterile crustose lichens from Australasia John A. Elix

Some interesting pyrenomycetous fungi on bark of Quercus spp. from Spain
Julia Checa & M.N. Blanco
Biogeography and hosts of poroid wood decay fungi in North Carolina:
species of Fomes, Fomitopsis, Fomitella and Ganoderma
L.E Grand & C.S. Vernia
Two new species of Ramaria from southwestern China
Ping Zhang, Zhu-Liang Yang & Zai-Wei Ge
The world’s second record of Neoheteroceras flageoletii reported from Turkey
Elsad Hiiseyin, Faruk Selcuk & Ahmet Sahin
Lewia chlamidosporiformans sp. nov. from Euphorbia heterophylla
Bruno S. Vieira & Robert W. Barreto
Weddellomyces turcicus, a new species on a grey Acarospora from Turkey
M. Gokhan Halici, Alan Orange & Ahmet Aksoy
Cordyceps spegazzinii sp. nov., a new species of the C. militaris group
Monica S. Torres, James F. White, Jr. & Joseph F. Bischoff
A phylogeny of Ramariopsis and allied taxa
Ricardo Garcia-Sandoval, Joaqin Cifuentes,
Efrain De Luna, Arturo Estrada-Torres & Margarita Villegas
A dichotomous key to Scutellospora species (Gigasporaceae, Glomeromycota)
using morphological characters
Gladstone A. Silva, Leonor C. Maia & Sidney L. Stiirmer
New species and phylogenetic relationships of Hypoxylon species found in
Thailand inferred from the internal transcribed spacer regions of ribosomal
DNA sequences N. Suwannasai, S. Rodtong,
S. Thienhirun & A.J.S. Whalley
Tricholoma equestre, the correct name for T: flavovirens (Agaricales)
H. Deng & Y. -J. Yao
A new species of Lecanicillium isolated from the white pine weevil,
Pissodes strobi Harry H. Kope & Isabel Leal
Two new species of Hymenochaetaceae from eastern China
Yu-Cheng Dai & Bao-Kai Cui
Some entomogenous fungi from Wuyishan and Zhangjiajie nature reserves
2. Three new species of the genus Hirsutella Zongqi Liang, Yanfeng Han,
Aiying Liu & Jianzhong Huang

|W a7
181
189

215
Z19

MapAs,

Jel
20
241
245
249

Pape,

265

293

303

220

eel

341

349

Paecilomyces parvosporus, a new species with its relatives from Yunnan

Province, China Yanfeng Han, Zongqi Liang, Huali Chu & Jichuan Kang
Notes on Otidea from Xinjiang, China Wen-Ying Zhuang
Book reviews and notices David L. Hawksworth

Indices & Information

Nomenclatural novelties proposed in volume 94

Author index for volume 94

Reviewers for volume 94

MycoTaxon online resources—Index to Fungous and Lichen Taxa, cumulative
indices, distributional checklists, past volumes online, information for authors
e reviewers, search features

Errata

MycoTaxon Instructions to authors

Recent books from MycoTAxon

PUBLICATION DATE FOR VOLUME NINETY-THREE

MYCOTAXON for JuLY-SEPTEMBER, VOLUME 93 (1-426 + I-VI)

was issued on November 11, 2005

MYCOTAXON

Volume 94, pp. 1-6 October-December 2005

Tuber umbilicatum, a new species from China, with a key to the
spinose-reticulate spored Tuber species

JUAN CHEN *”, PEI-Gu1 Liu * & YUN WANG?

pgliu@mail.kib.ac.cn
1 Kunming Institute of Botany, Chinese Academy of Sciences
Kunming 650204, P. R. China

2 Graduate School of Chinese Academy of Sciences
Beijing 100039, P. R. China

3 Institute of Applied Ecology, Chinese Academy of Sciences
Shenyang 110015, P. R. China

Abstract—Tuber umbilicatum, a truffle associated with Pinus yunnanensis in
southwestern China, is described and illustrated as a new species. It is characterized
by inconspicuously papillate ascomata with an umbilicate basal cavity and ellipsoid
ascospores ornamented with spines connected by low ridges to form an alveolate
reticulum 6-8 meshes across the spore width. A key to seven Tuber species bearing
spinose-reticulate spores is presented.

Key words—Tuberaceae, truffle, spore ornamentation, hypogeous fungus

Introduction

Since Liu (1985) reported the genus Tuber from Shanxi province, China, several
additional papers on Chinese truffles have been published. The export of Chinese
Tuber spp. to Europe has stimulated further interest in members of this genus in China.
Currently, up to 20 species, including 10 new species, have been reported in this country
(Liu 1985, Tao & Liu 1989, Wang & Li 1991, Hu 1992, Wang et al. 1998, Zhuang 1998, Xu
1999, Wang & He 2002, He et al. 2004, Zhang et al. 2005, Song et al. 2005). During study
of truffles associated with Pinus yunnanensis, a dominant tree in southwestern China,
we found a new truffle, characterized by inconspicuously papillate ascomata with an
umbilicate basal cavity and ellipsoid, spinose-reticulate ascospores. To distinguish this
new species from others with spinose-reticulate spores, a world-wide key to the seven
Tuber species with such spores is provided.

Materials and Methods

Macroscopic characters are described from fresh specimen. Microscopic methods of
Yang & Zhang (2003) were followed. For scanning electron microscopy (SEM), spores
were scraped from the dried gleba onto doubled-sided tape, which mounted directly

*corresponding author

on an SEM stub, coated with gold-palladium, and examined and photographed with
a JEOL JMS-5600LV SEM. Herbaria that provided specimens are abbreviated and
cited according to Holmgren et al. (1990), except HKAS (Herbarium of Cryptogams,
Kunming Institute of Botany, Chinese Academy of Sciences) and IFS (Herbarium of
Institute of Applied Ecology, Chinese Academy of Sciences), two not yet listed in the
Index Herbariorum.

Taxonomy

Tuber umbilicatum Juan Chen & P. G. Liu, sp. nov. Figs. 1-5
Ascomata ochracea, glabra vel subglabrabasi umbilicata. Peridium bistratum, 320-500 um
crassum: stratum exterius pseudoparenchymaticum, stratum interius hyphi intertextis.
Gleba solida, purpureobruneola vel griseobruneola, venis albis. Asci sporis 1-4 (6).
Ascosporae ellipsoideae, ochraceae, 21-40 x 14-32 um, spinulis 3-5 um altis, reticulato
alveolato < 1um alto connexis ornatae. Holotypus hic designatus: HKAS 44316.

Etymology: Latin, umbilicatum, in reference to the umbilicate depression of the
ascomata.

Ascomata (Fig. 1) 1.2-1.9 cm broad, globose, with an umbilicate depression at the
base, surface smooth or with minute papillae up to 50 um high, pale yellow, becoming
yellow-brown or brown when dried. Peridium (Fig. 2) brittle, peeling easily from the
gleba, mostly 320-500 um thick, composed of two layers: outer layer 90-250 um thick,
pseudoparenchymatous, composed of subglobose to subangular, yellow-brown cells
7-16 x 5-11 um, the walls 1-3 um thick; inner layer 150-400 um thick, of intricately
interwoven, hyaline hyphae 2-5 um in diam, the walls thin to somewhat thickened.
Gleba purple-brown or grey-brown with pink tint at maturity, marbled with numerous,
narrow, branching, white veins radiating from the basal cavity.

Asci (Fig. 3) 50-83 x 37-67 um excluding the stalk, globose to subglobose, ellipsoid or
irregular, sessile or sometimes with a short stalk, 1-4 (-6) spored. Ascospores (Fig. 4, 5)
ellipsoid, yellow-brown at maturity, the walls up to 2 um thick, in 1-spored asci (28-)
33-40 x 20-32 um excluding ornamentation, 2-spored asci (23-) 25-37 x 17-26 um, 3-
spored asci (21-) 23-33 (-36) x 17-23 um, 4-spored asci 21-30 (-32) x 15-22 (-25) um,
5-spored asci 21-26 x 14-20 um; Q = (1-) 1.2-1.6 (-1.8), Q = 1.4 + 0.13; ornamentation of .
spines 3-5 (-6) um tall connected by an alveolate reticulum < 1 um tall, the alveolae 3-6
(-7) x 2.5-5 um, 6-8 across the spore width and (6-) 7-10 along the spore length.

Habitat: Hypogeous under Pinus yunnanensis.

Specimen examined—CHINA: Yunnan province, Chengjiang county, Tigu Village,
elev. 1900-2000 m, 31 Oct. 2003, Juan Chen 145 (HKAS 44316 — holotype).

Discussion— The surface of the ascomata of T: umbilicatum is glabrous to subglabrous
to the naked eye, but very fine papillae can be seen with a stereomicroscope. These
papillae give the peridium a wavy outer edge under the compound microscope. The
combination of umbilicate, nearly smooth ascomata and spinose-reticulate spores is
distinctive.

Species of Tuber can be divided on the basis of spore ornamentation into three groups:
1) spiny (representative species: T. melanosporum Vittad.), 2) reticulate (representative
species: T. borchii Vittad.) and 3) spinose-reticulate (representative species:

x3,300 ~ Sim

Pa APORMED, 20,4 Uae

SS K | Wee fi NS
Woe in ANKLES KX RANI? Nie LS ai

Figs. 1-5 Tuber umbilicatum (HKAS 44316, Holotype)
1. Fresh ascomata; 2. Vertical section of the peridium; 3. Asci;
4. SEM of spore, showing the detail of ornamentation; 5. Ascospores.

T. spinoreticulatum Uecker & Burds.). T: umbilicatum belongs to the T: spinoreticulatum
group, which includes T. taiyuanense B. Liu, T. pseudoexcavatum Y. Wang et al. and
T. huidongense Y. Wang, known only from China; T. lyonii Butters (=T. texense Heimsch)
and T. spinoreticulatum from North America; and T. malacodermum E. Fisch. from

Germany and Switzerland (Fischer 1923, Heimsch 1958, Uecker & Burdsall 1977, Liu
1985, Wang et al. 1998, Wang & He 2002, Trappe et al. 1996). These species can be
difficult to distinguish because of their morphological similarity. Accordingly, to clarify
differences among these species we re-examined the holotypes of T. huidongense (IFS
89923) and T. texense (OSC 42353), isotype of T’ spinoreticulatum (OSC 38860), a
neotype of T: taiyuanense (HMAS 75888) and two specimens of T. pseudoexcavatum
(HKAS 47617, 41313). Ascomata and SEM photomicrographs of spores are illustrated
in Figs. 6-11. Although we did not obtain specimens of T: malacodermum, Fischer's
(1923) description as confirmed by study of the type collection by J. M. Trappe (personal
communication) showed it to have a pseudoparenchymatous peridium composed of
cells inflated up to 20-70 um broad. A key to the spinose-reticulate species is presented
here, based on these studies.

Key to species with spinose-reticulate spores

1. Peridium with rounded cells inflated to 20-70 um. . . . . . . I: malacodermum
1. Peridium of interwoven hyphae or with rounded cells mostly < 20 um broad . . 2
2. Ascomata With'a. basal cavity ea tet ee a © ee rane
2. Ascomata without a basal cavity ..-.. ....... OP ES os 6 ee)
3. Peridium smooth or with Waa oes’ ieee 10-50 um high; spores ellipsoid,

Oslin : . . . To umbilicatum
3. Peridium with conspicuous warts 100- 150 um. Bent spores ae: broadly ellipsoid,

QOS Sue 25 Aare Gg ee UR ee AL ee ed ee eee 4
4. Cavity conspicuous; asci 1-8 spored, sessile. . . . . . . . . IT. pseudoexcavatum
4. Cavity inconspicuous; asci 1-4 spored, stipitate. . . . . . . T. spinoreticulatum

5. Ascomata smooth; ascospores Pra dial O.<i73; apa 1-1.25.
T. taiyuanense
Ds Recon emis minute veanvTiy: up to ag! lum. REDE ascospores ellipsoid, Q > 1.3,
MOStly L371 65.) Mea oman. so cette Tere CMe 5 o> i ee 6

6. Spores with longer spines mostly > 3 um long, reticulum complete and regular, meshes °
size bigger 4-8 x 4-6um .. . . ... . . DT huidongense

6. Spores with shorter spines 2-3 um fone Feelin Aa to complete, meshes size
smialleri326002-4 (irate ae LT oni(— i texense)

Acknowledgments

Prof. James Trappe and Dr. Michael Castellano reviewed the manuscript and offered invaluable
comments and suggestions. Specimens were generously lent to us by the herbaria of the Department
of Botany & Plant Pathology, Oregon State University, Royal Botanic Gardens, Kew, and Institute of
Microbiology, Chinese Academy of Sciences. Sincere gratitude is offered to Prof. M. Zang, Dr. Zhu
L. Yang and Mrs. X. H. Wang, Kunming Institute of Botany, for their valuable suggestions on earlier
version of the manuscript. Many thanks to my colleagues, F Q. Yu, H. D. Zheng and J. Y. Chen for
providing morphological photos. The study was supported in part by National Science Foundation
of China (No. 30470011), the Knowledge Innovation Program of Chinese Academy of Sciences (No.
KSCXZ-1-09-06 & KSCXZ-SW-101C) and the Nature Science Foundation of Yunnan province (No.
2004C0050M).

Figs. 6-11. T. taiyuanense (HMAS 75888, neotype): 6. Ascomata; 7. SEM micrograph of ascospore.
T. pseudoexcavatum (HKAS 47617): 8. Ascomata. T: huidongense (IFS 89923, holotype): 9. Ascospore.

T. spinoreticulatum (OSC 38860, isotype): 10. Ascospore. T. texense (OSC 42353, holotype):
11. Ascospore.

Literature cited

Fischer E. 1923. Zur Systematik der Schweizerischen Triiffeln aus den Gruppen von Tuber
excavatum und rufum. Verhandlungen Naturforschenden Gesellschaft Basel 35: 34-50.

He XY, Li HM, Wang Y. 2004. Tuber zhongdianense sp. nov. from China. Mycotaxon 90: 213-216.

Heimsch C. 1958. The first recorded truffle from Texas. Mycologia 50: 657-660.

Holmgren PK, Holmgren NH, Barnett LC. 1990. Index Herbariorum: part I: herbaria of the world.
8th edition, New York Botanical Garden: New York. 693 pp.

Hu HT. 1992. Tuber formosanum sp. nov. and its mycorrhizal associations. Quarterly Journal of the
Experimental Forest, National Taiwan University 6: 79-86.

Liu B.1985. New species and new records of hypogeous fungi from China (I). Acta Mycologica
Sinica 4; 84-89.

Song MS, Cao JZ, Yao YJ. 2005. Occurrence of Tuber aestivum in China. Mycotaxon 91: 75-80.

Tao K, Liu B. 1989. A new species of the genus Tuber from China. Journal of Shanxi University
(Natural Science Edition) 12: 215-218.

Trappe JM, Jumpponen AM, Cazares E. 1996. NATS truffle and truffle-like fungi 5: Tuber lyonii
(=T. texense), with a key to the spiny-spored Tuber species groups. Mycotaxon 60: 365-372.
Uecker FA, Burdsall HH. 1977. Tuber spinoreticulatum, a new truffle from Maryland. Mycologia

69: 626-630.

Wang Y, He XY. 2002. Tuber huidongense sp. nov. from China. Mycotaxon 83: 191-194.

Wang Y, Li ZP. 1991. A new species of the genus Tuber from China. Acta Mycologica Sinica 10:
263-265. (in Chinese).

Wang Y, Moreno G, Riousset LJ, Manjon JL, Riousset G, Fourré G, Massimo GD, Garcia Montero
LG, Diez J. 1998. Tuber pseudoexcavatum sp. nov., a new species from China commercialized in
Spain, France and Italy with additional comments on Chinese truffles. Cryptogamie Mycologie
O71 ES-120!

Xu AS. 1999. Notes on the genus of Tuber from Tibet. Mycosystema 18: 361-365. (in Chinese).

Yang ZL, Zhang LF. 2003. Type studies on Clitocybe macrospora and Xerula furfuracea var. bispora.
Mycotaxon 88: 447-454.

Zhang LF, Yang ZL. Song DS. 2005. A phylogenetic study of commercial Chinese truffle and their
allies: Taxonomic implications. FEMS Microbiology Letters 245: 85-92.

Zhuang WY. 1998. A list of discomycetes in China. Mycotaxon 67: 365-390.

MYCOTAXON

Volume 94, pp. 7-14 October-December 2005

Blumenavia toribiotalpaensis: a new species of Clathraceae
from Jalisco, Mexico

"YALMA L. VARGAS-RODRIGUEZ & 7J. ANTONIO VAZQUEZ-GARCIA

yvargal@lsu.edu
'107 Life Sciences Building, Dept. of Biological Sciences, Louisiana State University
Baton Rouge 70803, Louisiana, U.S.

*Depto. de Botanica y Zoologia, CUCBA, Universidad de Guadalajara
km 15 carr. Guadalajara-Nogales, Las Agujas
Nextipac, 45110, Zapopan, Jalisco, Mexico

Abstract—A new stink horn species, Blumenavia toribiotalpaensis sp. nov. (Clathraceae)
from Mexico, is described and illustrated. Blumenavia toribiotalpaensis differs from
previously described species of the genus by its larger receptacle and basidiospores,
distribution of the gleba over the upper half of the columns and presence of no more
than four columns.

Key words—Basidiomycota, phalloid, systematics, Talpa de Allende

Introduction

During the course of studies of the distribution and demography ofa recently discovered
Acer saccharum subsp. skutchii (cloud forest sugar maple) population in Jalisco, Mexico
(Vargas-Rodriguez 2005), we collected fungal specimens with novel features. A survey
of the literature revealed that the specimens are an undescribed species of Blumenavia
(Clathraceae).

The genus Blumenavia was established to accommodate B. rhacodes Moller (Méller
1895). Currently, two species, B. rhacodes and B. angolensis (Welw. & Curr.) Dring, are
included in the genus (Dring 1980). The genus is characterized primarily by the small
number of columns that lack transverse arms. In addition, the columns are free at the
base and united at their apices with glebifers consisting of membranes attached by one
side to each of the two inner angles of the column (Dring 1980, Saenz 1980).

The new Blumenavia species occurs in a pine-cloud forest transition considered
a Tertiary refuge (Vargas-Rodriguez 2005). The subtropical montane cloud forest is
unique in having high plant species richness and includes a number of endangered and
relict plants, comparable only to certain Asian forests (Graham 1999, Vargas-Rodriguez
2005). The forest contains temperate disjunct tree genera with East Asia and East North
America, such as Acer, Magnolia, Carpinus, Cornus, Fraxinus, Juglans, Tilia, and Ostrya
(Graham 1999, Vazquez-Garcia et al. 2000). This exceptional community is proposed
for protection as a biosphere reserve with 3,000 inhabitants supporting the movement

(Vargas-Rodriguez 2005). The discovery of the novel Blumenavia species increases our
knowledge and relevance of the biota of this unique region.

Materials and Methods

We collected fruiting bodies at different stages of development in a pine-montane
cloud forest transition (1,800 m a.s.l.), near Talpa de Allende, Jalisco, Mexico, among
fallen leaves under the canopy of adult Pinus spp. and Carpinus caroliniana trees. A
second collection was made a year later in the same area and a third one in 2005. Five
fruiting bodies were fixed in FAA solution (five parts 40% formaldehyde: five parts
glacial acetic acid: 90 parts 95% ethyl alcohol) and seven were dried. A free hand cross
section was made to one egg. Spores were mounted on slides in lactophenol and in 3%
KOH and examined with a NIKON Microphot compound microscope using differential
interference contrast and bright field optical systems. Hand-cut sections of the columns
were made from a sample that had been fixed in FAA for nine months. Sections were
dehydrated with ethanol, critical point dried, mounted, and coated with gold:palladium
60:40 in an Edwards S-150 sputter coater. We used a Cambridge S-260 scanning electron
microscopy (SEM) for observation.

Taxonomic Description

Blumenavia toribiotalpaensis Vargas-Rodriguez sp. nov. FIGS. 1-14

Ovum fulvum, superficies interdum findens aquamis fulvis angularibus, elipsoidale 2.2-
3.8 cm longum x 2.1-3.9 cm altum; adhaesae albae rhizomorphae 1-1.5 cm diametro.
Receptaculum expansum 12.1-15.3 cm altum, 3.8-5.6 cm longum, colore vario ab albulo
ad dilutum bombax, cylindrale (or cylindratum) ex 3 vel 4 columnis robustis constans;
columnis 0.9-1.1 cm diametro ex parte gracillima, 1.9-2.1 cm ex parte latissima, conjunctis
superne, inferne liberis, cum sulco in superfacie; semicirculares sectione, constantes ex 9
tubis compositis in 3 ordinibus ab canali abaxiali; proximi canali sunt 5 tubuli circulares
sectione in material nova; medius ordo constat ex 3 latioribus tubis, polygonalibus sectione;
atque ex singulari magna polygonali tuba constat ordo extremus ab canali abaxiali.
Columnae tela glebifera incrassata in facie interna informante cristam per anterior-
laterales angulos columnae, glebifera incrassata marginibus unita, crista blebam ferente.
Gleba coercita intra laceratam glebiferam cristam, sita in superior parte columnarum,
atro-brunnescenti-olivacea, aroma simili piscibus mortuis et nauseosa. Basidiosporae 3.8-
4,2 x 1.7-1.9 um. Associati basidiocarpis siti Scarabaei (Staphilinidae et Leiodidae) intra
brachia et muscae (Tephritidae) in gleba maturorum basidiocarporum.

Egg pale brown, outer surface sometimes cracking into angular brown scales, ellipsoidal,
2.2-3.8 cm wide, 2.1-3.9 cm high, gelatinous layer 5-7 mm thick, traversed by peridial
sutures corresponding to each of the four columns, immature glebal mass about 4 mm
diameter among columns, glebiferous tissue separated by a cavity opened in one extreme
and joined to the column only by the opposite extreme, medullar zone rectangular-like
in shape; attached white rhizomorphs 1-1.5 mm in diameter. Expanded receptacle 12.1-
15.3 cm high and 3.8-5.6 cm wide, whitish to pale beige, cylindrical, with 3 to 4 robust
columns; columns 0.9-1.1 cm diameter at the thinnest part to 1.9-2.1 cm at the widest
part, united above, free below with a groove in the outer surface, semicircular in section,

Figure 1-11. Blumenavia toribiotalpaensis, IBUG 422a. 1, Habitat photograph showing receptacle
and volva. 2, Receptacle, volva, and rhizomorphs from specimen preserved in FAA. IBUG 456,
3, Receptacle and volva. IBUG 422a. 4, 5, 9, 10, Detail of gleba, showing its distribution over the
upper half of the receptacle. IBUG 456, 6 & 11, Detail of gleba. Yalma L. Vargas-Rodriguez 455, 7
& 8. Freehand cross section of an egg. IBUG 422a, 9, Detail of the volva from specimen preserved
in FAA.

Figure 12-14. Blumenavia toribiotalpaensis, LSUM 422b. 12, Basidiospores. 13, Sections of the arm
showing number and arrangement of tubes and associated staphylinid beetle. 14, Inner (upper
side) and outer (bottom) arm surfaces.

comprised of 9 tubes arranged in three ranks from the abaxial groove; nearest to the
groove are five small tubes, circular in section in fresh material; the middle rank consists
of three wider tubes, polygonal in section; and a single, large polygonal tube comprises
the outermost rank from the abaxial groove (Fig. 13). Columns with a thickened
glebiferous tissue on the inner surface forming a crest along the anterior-lateral angles
of the column, glebiferous tissue united to the arms by the edges, crest bearing the
gleba. Gleba restricted to the lacerate glebiferous crest, situated on the upper half of
the columns, dark olive-brownish, odor of dead fish, nauseous. Basidiospores 3.8-4.2 x
1.7-1.9 um, cylindrical, hyaline in KOH. Beetles [Staphilinidae (Fig. 13), Leiodidae] and
flies (Tephritidae) associated with basidiocarps, beetles located inside the arms reach
the interior through holes in basidiocarps, holes appear in decaying basidiocarps; flies
located in gleba of mature basidiocarps.

Specimen examined — HOLOTYPE here designated. MEXICO, JALISCO: Talpa
de Allende municipality, pine-cloud forest (Acer-Podocarpus-Abies) transition, “Ojo
de Agua del Cuervo” (“Crow spring”) locality, west of Cumbre de Los Arrastrados
(20°11”N; 105°16"W), 1800 m a.s.l., on Pinus spp. fallen trunk and debris, 10 Sep
2002, Yalma L. Vargas-Rodriguez 240, with Javier Curiel, J. Antonio Vazquez-Garcia and
Toribio Quintero Moro, dry specimen (BPI); 10 Sep 2002, Yalma L. Vargas-Rodriguez
240a, with Javier Curiel, J. Antonio Vazquez-Garcia and Toribio Quintero Moro, dry
specimen (IBUG) (Holmgren et al. 1990).

PARATYPE here designated. MEXICO, JALISCO: Talpa de Allende municipality,
pine-cloud forest (Acer-Podocarpus-Abies) transition, “Ojo de Agua del Cuervo” (“Crow
spring”) locality, west of Cumbre de Los Arrastrados (20°11”N; 105°16”W), 1800 m
a.s.l., on fallen leaves of Pinus spp. and Carpinus caroliniana, 14 Sep 2003, Yalma L.
Vargas-Rodriguez 422b, 423a, 423b, 424a and J. Antonio Vazquez-Garcia, FAA preserved
material (LSUM); 14 Sep 2003, Yalma L. Vargas-Rodriguez 422a and J. Antonio Vazquez-
Garcia, FAA preserved material (IBUG); 13 Sep 2005, Yalma L. Vargas-Rodriguez 454,
456, 462 and J. Antonio Vazquez-Garcia, dry specimen (IBUG); 13 Sep 2005, Yalma L.
Vargas-Rodriguez 459, 463 and J. Antonio Vazquez-Garcia, dry specimen (LSUM).

Etymology—From the Latin talpaensis, referring to the municipality where the fungus
was collected and toribio, referring to Toribio Quintero Moro, a remarkable forest
conservationist. He has promoted the protection of the Talpa de Allende forests by
collecting 3,000 signatures from Talpa de Allende habitants and petitioning state and
federal Mexican authorities for the creation of a new biosphere reserve in the area.

Known distribution—Jalisco: Only known from the type locality. The species is not
common in the area; individuals are patchy distributed along 100 m. The species was
not previously known by local people. Only three other species (Clathrus crispus, C.
cancellatus, and C. ruber) of the Clathraceae family are known for the Jalisco state and
these do not co-occur with Blumenavia toribiotalpaensis. This is the first record of the
genus for western Mexico and the second one for the country.

Habit and habitat—Occasionally gregarious. Among plant leaves and debris, under
Pinus spp., Carpinus caroliniana and Acer saccharum subsp. skutchii canopy, in
transitional pine forest to montane cloud forest.

Discussion

Blumenavia differs from similar stink horn genera in the glebifer form. Especially
notable is the unique gleba borne on lateral flaps of tissue that is lacking in Clathrus,
Laternea, and Ligiella.

The differences between Blumenavia toribiotalpaensis and the two previously
described species include the distribution of the gleba and the size of the receptacle and
basidiospores (Table 1). The gleba is distributed along half the length of the column in B.
toribiotalpaensis; in B. rhacodes the gleba is present over the entire length of the column
and in B. angolensis restricted to the upper quarter or one third of the receptacle. The
receptacle and basidiospores are larger in B. toribiotalpaensis than in the other two
species (Table 1).

Table 1. Differences among species of Blumenavia

' Blumenavia
Blumenavia rhacodes Blumenavia angolensis Lia
toribiotalpaensis
Expanded 8.5-13x8 cm 10x3 cm 12.1-15.3x3.8-5.6 cm
receptacle
Receptacle Clear orange to yellow White Whitish to pale beige
color
Sections of Triangular and trapezoidal; Subtriangular or Semicircular; 9 tubes
columns; about 10 tubes quadrangular; about 6
number of tubes
tubes
Number of 3-6 3-5 3-4
columns
Groove along Present Lacking Present
outer side of
column
Basidiospores 3-4x1-1.5 um 3-3.5x1.5 um 3.8-4.2 X 1.7-1.9 pm
Gleba Entire length of the column Upper quarter or one Upper half
distribution third of the receptacle
Habitat and In coffee plantations in Habitat not noted. Africa: Pine-montane cloud
distribution cloud forest in Mexico. Angola, Tanzania, South forest transition.
Mexico: Veracruz; The Africa; US: Texas; The Mexico: Jalisco.

Caribbean: Trinidad; South Caribbean: Puerto Rico;
America: Brazil. South America: Brazil.

Mature specimens of B. toribiotalpaensis usually have four columns but one
immature specimen has only three. The white columns in fresh specimens separate B.
toribiotalpaensis from B. rhacodes with orange-yellow columns; B. angolensis however,
also has white columns. The spongy texture of the columns of B. toribiotalpaensis
distinguishes this species from the more rigid, less spongy texture of B. angolensis.
Number, shape and arrangement of tubes in transverse sections of columns differ, being
more numerous in B. toribiotalpaensis than in B. angolensis, with a semicircular shape,
and arranged differently from B. rhacodes (Table 1).

Habitat and known geographical distribution differ among the three Blumenavia
species. Although both B. toribiotalpaensis and B. rhacodes are known from Mexico,
B. rhacodes has been found in coffee plantations established under the canopy of cloud
forest trees at 1300 m a.s.l. in Teocelo, Veracruz, Mexico (Lopez et al. 1981), while B.
toribiotalpaensis occurs at higher elevations (1800 m a.s.l.) in the transition of pine and
cloud forest. In Mexico, B. rhacodes is also known from Xalapa, Veracruz (Calonge et al.
2004). This is the first record of the genus for western Mexico and is the second for the
country, which was previously found in eastern Mexico (Veracruz state). Individuals of
Blumenavia species have low density in Mexico. Blumenavia angolensis is known from
Angola, Tanzania, South Africa and Brazil, although the habitats were not reported
(Dring 1980) (Table 1).

Acknowledgments

The authors are grateful to Meredith Blackwell for her helpful comments to the manuscript and for
her technical support. Margaret C. Henk kindly helped with the photomicrographs. Diane Ferguson
and Vesna Karaman helped with the photographs. Richard Warga wrote the Latin description. We
acknowledge the assistance of David Farr (USDA National Fungus Collection, BPI), who made
material of B. rhacodes available for comparison. Erick Soto-Cantu, Heather Passmore and Angeles
Vargas acquired literature needed in the study. We especially appreciate the helpful suggestions of
Laura Guzman-Davalos, Silvia Cappello Garcia and Joaquin Cifuentes throughout the study and
the peer reviews of Peter Roberts and Kentaro Hosaka.

Literature Cited

Calonge FD, Guzman G, Ramirez-Guillén F. 2004. Observaciones sobre los Gasteromycetes de
México depositados en los herbarios XAL y XALU. Boletin de la Sociedad Micoldgica de
Madrid 28: 337-371.

Dring DM. 1980. Contributions towards a rational arrangement of the Clathraceae. Kew Bulletin
eiep Ie Ieh

Graham A. 1999. Late Cretaceous and Cenozoic history of North American vegetation. Oxford
University Press, New York, New York, USA.

Holmgren PK, Holmgren NH, Barnett LC. 1990. Index herbariorum. Part I. Ed. 8. Regnum
Vegetation 120: 1-693.

Lopez A, Martinez D, Garcia J. 1981. Adiciones al conocimiento de los Phallales del estado de
Veracruz. Boletin de la Sociedad Mexicana de Micologia 16: 109-116.

Moller A. 1895. Botanische Mittheilungen aus den Tropen. Heft 7. Jena: G. Fisher, 152 pp.
Saenz JA. 1980. Ligiella, a new genus for the Clathraceae. Mycologia 72: 338-349.

Vargas-Rodriguez YL. 2005. Ecology of disjunct cloud forest sugar maple populations (Acer
saccharum subsp. skutchii) in North and Central America. Master of Science Thesis, Louisiana
State University, Baton Rouge, Louisiana, USA.

Vazquez-Garcia JA, Vargas-Rodriguez YL, Aragon F. 2000. Descubrimiento de un bosque de Acer-
Podocarpus-Abies en el municipio de Talpa de Allende, Jalisco, Mexico. Boletin del Instituto de
Botanica, Universidad de Guadalajara 7: 159-183.

MY COTAXON

Volume 94, pp. 15-42 October-December 2005

Studies on Basidiomycetes in Greece 1:
The genus Crepidotus

Z. GONOU-ZAGOU & P. DELIVORIAS

zgonou@biol.uoa.gr panadeli@biol.uoa.gr
University of Athens, Faculty of Biology, Department of Ecology & Systematics
Panepistimioupoli, GR-157 84 Athens, Greece

Abstract—The diversity of Crepidotus in the Eastern Mediterranean region is poorly
known, and data from Greece are scarce. The present work aims at the record and study
of the diversity of the genus in Greece and at the contribution to the knowledge of
the distribution of the genus in Europe. Forty-four collections have been examined
and ten taxa have been identified. Crepidotus autochthonus, C. lundellii, C luteolus, C.
subverrucisporus and C. applanatus var. subglobiger are newly recorded from Greece
and most taxa are recorded on new substrates for both Greece and Europe. Detailed
descriptions, ecological notes and taxonomical comments on all studied taxa are
given.

Key words—lignicolous fungi, mycodiversity, biodiversity, taxonomy, Crepidotaceae

Introduction

Crepidotus is a distinct and well-defined genus, and although most species remain
not yet completely documented and clarified, several monographic works, as well as
critical revisions and regional studies based mainly on morphological studies, provide
comprehensive systematic treatment of many species (Singer 1947; Pilat 1948; Hesler &
Smith 1965; Singer 1973; Watling & Gregory 1989; Nordstein 1990; Stangl et al. 1991;
Senn-Irlet 1995; Senn-Irlet & De Meijer 1998; Aime 2001; Krisai-Greilhuber et al. 2002;
Bandala & Montoya 2002a, 2002b, 2004). The systematic position of Crepidotus was
until very recently debatable, as it was placed either in family Crepidotaceae (Moser
1978; Jiilich 1981; Singer 1986; Hawksworth et al. 1995), Strophariaceae (Kihner 1980)
or Cortinariaceae (Bas 1988; Kirk et al. 2001). Recent phylogenetic analyses (Aime 1999;
Moncalvo et al. 2002; Aime et al. 2005) allow to redefine the Crepidotaceae within a
broader phylogenetic framework of the agarics, and the genera Crepidotus and Simocybe
are better supported in family Crepidotaceae s.s., which represents a separate lineage of
dark-spored euagarics.

In the Mediterranean region some studies on Crepidotus exist, mainly concerning
N. Africa (Malencon & Bertault 1975), Spain (Ortega & Buendia 1989) and Italy
(Lonati 2000). However, the knowledge of the diversity of Crepidotus in the Eastern
Mediterranean region is poor, as few papers have been published and most of these are
not easily accessible. The data from Greece are scarce. To date, only seven taxa were

recorded from Greece, usually without descriptions, and most collected very few times
(Diapoulis 1939; Maire & Politis 1940; Avtzis & Diamandis 1988; Minter 1988; Diamandis
& Perlerou 1990; Pantidou 1991; Diamandis 1992; Zervakis et al. 1998; Dimou et al.
2002a; Dimou et al. 2002b; Konstantinidis 2002; Polemis et al. 2002). Few papers from
neighboring countries have been recently published, such as Croatia (Tkaléec & Meéi¢
2003) and Turkey (Oztiirk et al. 2003; Ersel & Solak 2004; Sesli & Denchev 2005). Most
of the above mentioned papers are floristic studies, lacking detailed descriptions or
exsiccata.

The aim of the present study is to provide a better understanding of the biodiversity of
the genus in Greece, concerning its morphology (including the range and importance of
its variability), ecology and chorology. Collections have been made from various regions
of central and southern continental Greece, mainly from coniferous and deciduous
forests, as well as riparian and maquis vegetation.

The following ten taxa are identified and described in this work: C. applanatus var.
subglobiger, C. autochthonus, C. calolepis, C. cesatii var. cesatii, C. epibryus, C. lundellii,
C. luteolus, C. mollis, C. subverrucisporus and C. variabilis.

Materials and methods

Microscopical observations were made in bright field or phase contrast using a standard
light transmission microscope. Sections of dried material were mounted in 3% KOH,
with or without the addition of Phloxine. All measurements were made under 1000x
magnification. At least 20 spores and 10 basidia and cheilocystidia were measured
per specimen. The spores were measured from the surface of the pilei or from a spore
deposit (when available). The spore sizes are given in approximation to 0.5 um, with
extreme values given in parentheses, followed by the length-width ratio of the spores
(Q). Habitat references in the descriptions refer exclusively to the collected material.
Greek localities are transcribed into latin according to ISO 843: 1997 (E). Authorities’
abbreviations are in accordance to Authors of Fungal Names by Kirk & Ansell (1992). We
have adopted the infrageneric classification proposed by Senn-Irlet (1995).

Material from other collectors or researchers (published or unpublished), was
examined when available. The specimens collected from the authors are deposited in’
the Mycological Herbarium of the University of Athens (ATHU-M).

Taxonomic descriptions

Crepidotus (Fr.: Fr.) Staude 1857
Crepidotus subgenus Crepidotus

Crepidotus calolepis (Fr.) P. Karst. Figs la—b; 9b, d; 11g
Crepidotus calolepis (Fr.) P. Karst., Bidr. Kann. Finl. Nat. Folk 32: 414 (1879); Crepidotus
mollis var. calolepis (Fr.) Pilat, Ann. Hist. -Nat. Mus. Natl. Hung., n.s. 2B: 74 (1940);
Crepidotus mollis ssp. calolepis (Fr.) Nordstein, Synopsis Fungorum (Oslo) 2: 67
(1990).

Pileus 10-70 mm, semicircular to flabelliform, convex to plano-convex, laterally or
almost laterally attached to the substrate, with incurved and later even margin, surface
viscid-sticky to dry, densely minutely tomentose-scaly with yellowish brown to brown

fibrillose scales on a dirty whitish, cream to ochre-yellowish background, consistency
tough, elastic. Lamellae whitish in young specimens, then spotted brownish and finally
uniformly ochre-brown to cinnamon, moderately crowded, emarginately adnate,
margin minutely fimbriate, remaining whitish. Stipe absent or rudimentary. Spore print
yellowish brown.

Basidiospores 7.5-11.0 x 5.5-7.0 um, Q = 1.21-1.69, ellipsoid, amygdaliform in
side view, smooth, yellowish brown in KOH, thick-walled, apex obtuse, depressed or
occasionally mucronate; in some spores inner wall curving inwards at apex, resembling
a callus or an indistinct germ pore when accompanied by a small apical depression (Figs
la, 9b). Basidia 25-32 x 7-9 um, cylindrical-clavate, 4-spored. Cheilocystidia 25-65 x
4-14 um, clavate, cylindrical, irregularly cylindrical, somewhat fusiform to narrowly
lageniform, sometimes branched, apex obtuse, often subcapitate (Fig. 1b), frequently
embedded in gelatinous material entirely covering the lamellar edge. Pleurocystidia
absent but pleurocystidioid-like bodies present in some specimens, clavate, with a
short, apical or rarely lateral, finger-like protuberance (Fig. 11g). Lamellar trama
often gelatinized. Pileipellis with an underlying layer of parallel hyphae, 3-5 um wide,
hyaline, not encrusted, and an upper layer of parallel to somewhat ascending hyphae,
4-12 um wide, hyaline to pale ochraceous, with encrusting zebra-like pigment, amongst
which ascending scale-forming hyphae, 4-15 um wide, brown to dark brown, thin- to
somewhat thick-walled, short-celled, with strongly encrusting, zebra-like pigment (Fig.
9d), in some specimens with markedly large, plate-like encrustations. Pileal trama
partly gelatinized, gelatinous layer underlying the pileipellis usually distinct, up to 200
um thick, but occasionally thin, rudimentary, and hence difficultly observed. Secretory
hyphae occasionally present in pileipellis, pileal trama and lamellar trama, hyaline to
golden yellow in KOH. Clamp connections absent in all tissues.

Habitat: Solitary to gregarious on standing or fallen trunks and branches of coniferous
or deciduous trees.

Specimens examined — Mt. Taygetos, Messinia, on wood of Platanus orientalis, 29
Nov. 1968, Pantidou, ATHU-M 1071 (as C. mollis); Mt. Kandilio, Pagontas-Prokopi,
Evvoia, forest of Pinus sp., on fallen branches of Pinus sp., 13 Dec. 1986, Gonou, ATHU-
M 3781; Mt. Taygetos, Messinia, forest of Pinus nigra & Abies cephalonica, on fallen
branches, 17 Nov. 1997, Gonou, ATHU-M 3782; Mt. Aroania, Zarouchla, Achaia, forest
of A. cephalonica, on stump of A. cephalonica, 27 Nov. 1997, Delivorias, ATHU-M 3970;
Mt. Parnitha, Attiki, forest of A. cephalonica, on fallen branches of A. cephalonica, 4
Dec. 1997, Gonou, ATHU-M 3783; Mt. Vardousia, Artotina, Fokida, forest of P. nigra &
Abies sp., on fallen branches, 26 Sep. 1999, Gonou, ATHU-M 5107; Mt. Parnonas, Agios
Petros, Arkadia, forest of Castanea sativa & Quercus sp., on fallen branches, 21 Nov.
1999, Gonou, ATHU-M 5105; river Agrafiotis, Epiniana, Evrytania, riparian vegetation,
on living trunk and branches of Pl. orientalis, 15 Oct. 2000, Delivorias, ATHU-M 5122;
Gardiki, Fthiotida, forest of Alnus glutinosa, 15 Oct. 2000, Dimou, 731; Ano Chora,
Nafpaktia, Aitoloakarnania, dead trunk of Pl. orientalis, 22 Nov. 2001, Dimou, 988; Mt.
Tymfristos, Agios Nikolaos, Evrytania, forest of Pl. orientalis, Quercus sp. & C. sativa,
on trunk base of Pl. orientalis, 8 Nov. 2003, Gonou, ATHU-M 5108; Aetos, Messinia,
on branches of PI. orientalis, 6 Dec. 2003, Kapsanaki, ATHU-M 5111; Mt. Liakoura,
Granitsa, Evrytania, forest of Abies borisii-regis, on fallen twigs of A. borisii-regis, 27 Sep.
2004, Delivorias, ATHU-M 5161; Mt. Liakoura, Limeri, Evrytania, forest of P. nigra, on

fallen branches of P. nigra, 13 Oct. 2004, Delivorias, ATHU-M 5174; Mt. Tymfristos,
Agios Nikolaos, Evrytania, mixed forest of Pl. orientalis, Quercus frainetto, C. sativa
and A. borisii-regis, on branches of PI. orientalis, 23 Oct. 2004, Gonou, ATHU-M 5169;
Mt. Liakoura, Granitsa, Evrytania, forest road, on living branches of Pl. orientalis, 11
Noy. 2004, Delivorias, ATHU-M 5175; Mt. Liakoura, Granitsa, Evrytania, forest of A.
borisii-regis and PI. orientalis, on fallen trunk of PI. orientalis, 11 Nov. 2004, Delivorias,
ATHU-M 5178.

Remarks: C. calolepis is very closely related to C. mollis and is considered by some
authors as a variety or subspecies of the latter (Pilat 1948; Nordstein 1990). Others
(Singer 1973; Watling & Gregory 1989; Senn-Irlet 1995, Bandala & Montoya 2004)
consider the two taxa distinct at a specific level. Both species are characterized by the
presence of a gelatinous layer in the pileal trama, considered to be more developed
in C. mollis and less developed or absent in C. calolepis. This, however, has not been
considered a reliable distinguishing feature (Nordstein 1990, Senn-Irlet 1995). We have
accepted the species-concept of C. calolepis as portrayed by Senn-Irlet (1995), who has
performed the most detailed work on the European species of the genus. According
to this concept, C. calolepis is distinguished from C. mollis by the somewhat broader
basidiospores and the presence of yellowish brown, fibrillose scales on the pileal surface
formed by brownish hyphae with encrusting pigment. The pileal surface of C. mollis
is glabrous or with scattered innate fibrils that may form indistinct pale scales, but the
hyphae of the pileipellis are not pigmented and never heavily encrusted.

Our collections include specimens with strongly fibrillose-scaly pilei and specimens
with almost or completely glabrous pilei, as well as many transitional forms. We
cross-examined the morphology of the pileal surface, the structure of the pileipellis
and the spore dimensions and concluded that two distinct forms exist amongst our
collections. The first form is characterized by whitish pilei, glabrous throughout or
with few fibrillose scales at the centre, in which the pileipellis consists of hyaline to pale
yellowish hyphae with minute encrustations and the spores are consistently narrower
(only exceptionally exceeding 6 tm in width and never more than 6.5 um). The second
form is characterized by yellowish to yellowish-brown, minutely to strongly fibrillose-
scaly pilei, often throughout, in which the scale-forming hyphae of the pileipellis are
consistently more or less strongly pigmented (yellowish brown to dark reddish brown —
in KOH) and in all cases heavily encrusted, and the spores are broader (most exceeding
6 um and frequently reaching 7 um in width). We identified the former as C. mollis and
the latter as C. calolepis.

The Mediterranean variety C. calolepis var. squamulosus (Cout.) Senn-Irlet is not
clear to us. It is reported by Senn-Irlet (1995) to have slightly larger basidiospores than
var. calolepis (8.5-12 x 6-7.5 um versus 7.5-10 x 5-7 um) and broader scale-forming
hyphae (up to 22 um wide, instead of 14 um wide). The spore-size in our specimens
holds an intermediate position between the two varieties, as, in most collections, a
significant portion of the spores exceed 10 um in length, but we have not measured any
spores larger than 11 um in length or 7 um in width. Also, we have not encountered
any scale-forming hyphae broader than 15 um. Although the spores in our specimens
are slightly larger than those reported by Senn-Irlet, this has been reported by other
authors as well (Bandala & Montoya 2004) and cannot be considered a significant
enough deviance to justify a distinction at a variety level. We have therefore concluded

that all of our specimens must belong to a single taxon, i.e. var. calolepis. Lonati (1993)
reports C. mollis var. squamulosus Cout. with a spore size of 7-10 x 5-6 (-6.5) um and
scale-forming hyphae 3-8 tum wide. Judging on his description, Lonati’s C. mollis var.
squamulosus must in fact be C. calolepis var. calolepis. Malencon & Bertault (1975) also
report having found C. mollis var. squamulosus, but they distinguish it from C. calolepis
on the grounds that the latter represents a small-sized species with a non-gelatinized or
little-gelatinized pileipellis, features that are not considered diagnostic (Nordstein 1990).
They make no reference to the spore-size or the structure of the pileipellis. It is unclear
to us whether their C. mollis var. squamulosus represents C. calolepis var. calolepis or var.
squamulosus.

An interesting deviant feature in our examined collections is that many basidiospores
present a curving of the inner wall at the spore apex, with the outer wall either remaining
obtuse and thus giving the impression of a callus-like formation, or having a small
depression, resembling an indistinct germ pore (Figs la, c; 9a—b). This was constantly
observed in all examined specimens of both C. mollis and C. calolepis and should
be considered characteristic for the two species. Singer (1973) also reports similar
characteristics. Senn-Irlet (1995) refers that in SEM analyses, spores of C. calolepis and
C. mollis reveal a small apical depression, which may be interpreted as an apical thinning
of the wall, yet neither a truncate spore apex or an apical thinning was visible under the
light microscope. When describing in general the spores of the genus, Singer (1986)
reports that the spores may occasionally have an indistinct callus or rarely an indistinct
germ pore.

In some specimens of C. calolepis, as well as C. mollis, the lamellar trama and margin
are distinctly gelatinous, the gelatinous material often covering the lamellar edge entirely.
The presence of this material is possibly related to environmental humidity.

Differentiatied pleurocystidioid-like bodies were observed in the hymenium of some
C. calolepis specimens, being more frequent near the margin. Singer (1986) reports that
cystidioles may often be present on the sides of the lamellae in Crepidotus species and
Hesler & Smith (1965) go as far as to acknowledge these elements as pleurocystidia. Senn-
Irlet (1995) observed such bodies in C. cesatii and interpreted them as abnormalities
induced by drought and therefore of no taxonomic significance. Apart from C. calolepis,
we have also encountered such bodies in specimens of C. subverrucisporus. It is doubtful
that these elements are of taxonomical significance in either case, as their presence is not
constant and could not be correlated with any other deviant feature.

C. calolepis seems to be by far the most common representative of the genus in
Greece, as we have collected it on several substrates from various locations. However,
it was formerly recorded only by Maire & Politis (1940) on a stump of Pinus halepensis
and dead trunks of Platanus sp., collections dating back to 1904 and 1906. On the
other hand, the closely related C. mollis is recorded a number of times in the literature
(Diapoulis 1939; Maire & Politis 1940; Pantidou 1991; Zervakis et al. 1998; Dimou et
al. 2002a). We examined a collection of Pantidou (ATHU-M 1071), identified as C.
mollis. It consists of a single, well-preserved specimen. The pileus is covered almost
throughout with minute fibrillose scales and the scale-forming hyphae are yellowish
brown to brown with strongly encrusting pigment. The spore dimensions fit accurately
to our measurements of other specimens of C. calolepis. We have therefore concluded
that this specimen formerly attributed to C. mollis in fact belongs to C. calolepis as here

satan naPeEree reo :

Fig. 1. a-b. C. calolepis: a. basidiospores, b. cheilocystidia, c-d. C. mollis: c. basidiospores, d.
cheilocystidia. Scale bars = 10 um.

interpreted. We also examined three specimens collected by Dimou (pers. com.), two
of which he had identified as C. mollis var. calolepis (731, 988, unpubl.), and one as C,
mollis var. mollis (961, unpubl.), and we concur with his judgement. Typical forms of
C. mollis and C. calolepis are easily distinguished from one another in the field, but we
have encountered many non-typical specimens, transitional in appearance, that could
easily be misidentified if not carefully examined under the microscope. The presence
of fibrillose scales on the pileal surface can be variable in abundance, and specimens
collected in wet weather often have apparently glabrous pilei, to the naked eye, as
stressed by Bandala & Montoya (2004). It is our conviction that C. calolepis may have
occasionally been mistaken for C. mollis in the past and is in fact much more common
in Greece than the latter. Pilat (1948) states that C. calolepis is more common in dry
areas or drier inland climates. This may explain the frequent occurrence of C. calolepis
in Greece, a country with a drier climate in comparison to most European countries.
Most authors (Malencon & Bertault 1975, Ortega & Buendia 1989, Watling &
Gregory 1989, Nordstein 1990, Senn-Irlet 1995, Breitenbach & Kranzlin 2000, Krisai-
Greilhuber et al. 2002) report either or both C. mollis and C. calolepis solely on wood of
broad-leaved trees. Scarce reports exist from wood of coniferous trees (Maire & Politis

1940, Bandala & Montoya 2004). In Greece, C. calolepis has been reported on a stump of
Pinus halepensis (Maire & Politis 1940), now it is newly recorded on branches of Abies
cephalonica, Abies borisii-regis and Pinus nigra. Of the material collected in this work,
seven collections of C. calolepis, as well as two collections of C. mollis, were found on
wood of coniferous trees (Abies and Pinus), which have not been recorded as substrates
of either species in Europe. It has also been recently collected on branches of Alnus
glutinosa (Dimou, pers. com.). Furthermore, eight collections of C. calolepis were found
on wood of Platanus orientalis, a host also not included in the substrates of this species
for Europe (Senn-Irlet 1995).

Crepidotus mollis (Schaeff.: Fr.) Staude Figs 1c-d; 9a, c; 11b, d, k
Crepidotus mollis (Schaeff.: Fr.) Staude, Schwamme Mitteldeutschl. 25: 71 (1857)

Pileus 10-50 mm, semicircular to flabelliform, convex to plano-convex, laterally or
almost laterally attached to the substrate, with incurved and later even margin, surface
viscid-sticky to dry, white to cream, glabrous to minutely fibrillose, forming scattered,
indistinct fibrillose scales, more evident in dried specimens, consistency tough, elastic.
Lamellae whitish in young specimens, then spotted brownish and finally uniformly
ochre-brown to cinnamon, moderately crowded, emarginately adnate, margin minutely
fimbriate, remaining whitish. Stipe absent or rudimentary.

Basidiospores 7.0-10.0 x 5.0-6.0 (-6.5) um, Q = 1.42-1.82, ellipsoid, amygdaliform
in side view, smooth, yellowish brown in KOH, thick-walled, usually with one and less
often two large oil drops as well as few small ones, apex often mucronate and thin-walled,
in some spores inner wall folding inwards resembling a callus or an indistinct germ pore
(Figs 1c, 9a). Basidia 12-30 x 6-9 um, cylindrical-clavate, 4-spored. Cheilocystidia
32-55 x 6-10 um, irregularly cylindrical, lageniform to slightly fusiform, apex obtuse,
sometimes subcapitate, rarely branched or septate, frequently embedded in gelatinous
material entirely covering the lamellar edge (Fig. 1d, 11b). Basidioles, basidia and
cheilocystidia rarely with golden-yellow, smooth content (Fig. 11d). Lamellar trama
seldom gelatinized. Pileipellis with an underlying layer of parallel hyphae, 3-5 um wide,
hyaline, not encrusted, and an upper layer of hyaline to pale yellowish hyphae, 4-12
um wide, with granular or minutely encrusting pigment but never heavily encrusted or
strongly pigmented (Fig. 9c). Pileal trama partly gelatinized, gelatinous layer underlying
the pileipellis, usually well-developed. Secretory hyphae occasionally present in
pileipellis, pileal trama and lamellar trama (Fig. 11k), scarce to abundant, hyaline to
golden yellow in KOH. Clamp connections absent in all tissues.

Habitat: Gregarious on living or dead trunks and branches of Abies borisii-regis and
Platanus orientalis.

Specimens examined — Mt. Zygourolivado, Pefkofyto, Karditsa, forest of Abies borisii-
regis, on a fallen trunk of A. borisii-regis, 19 Sep. 1999, Delivorias, ATHU-M 5117; Mt.
Zygourolivado, Pefkofyto, Karditsa, forest of A. borisii-regis, on a fallen trunk of A.
borisii-regis, 17 Nov. 2001, Delivorias, ATHU-M 5123; Tatoi, Attiki, on fallen twigs of a
deciduous tree, Dimou, 961; Mt. Tymfristos, Agios Nikolaos, Evrytania, mixed forest of
Platanus orientalis, Quercus frainetto, Castanea sativa and A. borisii-regis, on branches
of P. orientalis, 23 Oct. 2004, Gonou, ATHU-M 5170; Mt. Liakoura, Granitsa, Evrytania,
forest of A. borisii-regis and P. orientalis, on living trunk and branches of P. orientalis, 11
Nov. 2004, Delivorias, ATHU-M 5177; Mt. Liakoura, Granitsa, Evrytania, forest of A.

borisii-regis and P. orientalis, on dead branches of P. orientalis, 11 Nov. 2004, Delivorias,
ATHU-M 5180.

Remarks: The aforementioned collections are those we have encountered to fit C. mollis.
For further notes on C. mollis and comparison with C. calolepis see remarks under C.
calolepis.

Secretory hyphae were observed in abundance in the lamellar trama of basidiocarps
from collection ATHU-M 5123. However, in basidiocarps of ATHU-M 5117, collected
two years earlier from the same trunk, these hyphae were scarce, and in specimen 961
collected by Dimou, no secretory hyphae were found. The presence of these hyphae is
most likely due to environmental conditions or the stage of maturity of the basidiocarps,
and is of little or no taxonomical merit. Similar secretory hyphae were also observed in
some specimens of C. calolepis.

C. mollis is newly recorded for Greece on Abies borisii-regis. According to the
substrate’s list of the species in Europe (Senn-Irlet 1995), there is only one reference of
the species from Platanus and none from conifers.

Crepidotus subgenus Dochmiopus (Pat.) Pilat, 1948
Section Dochmiopus

Crepidotus applanatus var. subglobiger Singer Figs 2a-d; 10h; 11h-j
Crepidotus applanatus var. subglobiger Singer, Nova Hedwigia Beih. 44: 478 (1973)

Pileus 5-30 mm, semicircular, flabelliform to petaloid, convex to plano-convex, laterally
attached to the substrate, margin incurved to even, hygrophanous, translucently striate
at margin when wet, surface smooth, somewhat felty at point of attachment, pure white
to pale cream, becoming yellowish brown in dried specimens. Lamellae whitish in young
specimens, then buff to snuff brown, moderately distant, adnate to decurrent, margin
minutely fimbriate, remaining whitish (observed under lens). Stipe rudimentary, with
white tomentum on the substrate.

Basidiospores (5.0-) 5.5-6.5 (-7.0) x (5.0—) 5.5-6.0 (7.0) um, Q = 1.00-1.20, globose
to subglobose, yellowish brown in KOH, with pinkish content, finely verrucose, with a
perispore (Figs 2a, 10h). Basidia 18-26 x 6-8 tm, cylindrical-clavate, 4-spored, with.
basal clamp, content with numerous small oil drops. Cheilocystidia 45-110 x 5-12
tum, variable, typically cylindrical to narrowly lageniform, rather often subcapitate or
curved at apex, some branched, some septate, in some cases with two septa on the same
cystidium, hyaline, thin-walled but rather often thick-walled at the medial part, in some
cystidia markedly so, up to 3 um thick (Fig. 2b, d; 11h-j). Pleurocystidia absent but
abundant pleurocystidioid-like bodies present, 14-22 x 5-6 um, irregularly cylindrical
to clavate, often curved, twisted or constricted, frequently with an apical to lateral,
finger-like protuberance (Fig. 2c). Pileipellis a cutis, hyphae 4-8 um wide, hyaline or
with pale yellowish, diffuse to somewhat granular intracellular pigment, occasional
hyphal ends exerting as pileocystidia, 30-70 x 6-9 um, narrowly lageniform, cylindrical
to subcapitate, hyaline. Secretory hyphae present in pileipellis, pileal trama and lamellar
trama. Clamp connections present in all tissues.

Habitat: Scattered on a rotten fallen trunk of Picea abies.

OOO
OO ©

js28

- oy
re
Ce ee

ee Sey,

Fig. 2. C. applanatus var. subglobiger: a. basidiopores, b, d. cheilocystidia, c. pleurocystidoid
bodies. Scale bars = 10 um.
Specimens examined — W. Rodopi Mts., Elatia, Drama, alt. 1550 m, on a fallen trunk
of Picea abies, 5 Oct. 2005, Gonou & Floudas, ATHU-M 5332.

Remarks: C. applanatus var. subglobiger is distinguished from the typical variety by the
shape of the cheilocystidia which are longer, narrowly lageniform to cylindrical instead
of clavate to capitate. Furthermore, var. applanatus prefers hardwoods, whereas var.
subglobiger seems to be restricted to coniferous wood.

We have collected this taxon only once, from a Picea forest in Northern Greece.
Microscopic examination revealed a few deviant features, such as the presence of septa on
many cystidia, and even, in many occasions, two septa on the same cystidium. This was
not a constant feature however, as showed by examination of different lamellar margins
from the same basidiocarp. In one lamella the cheilocystidia were almost predominately
septate, whereas in a nearby lamella the septate cystidia were scarce to almost absent.
Also, many cystidia with a markedly thick-walled medial part were encountered, with
the remaining cystidium being thin- to slightly thick-walled. Finally, we observed many
branched cystidia at the apices, either forked or laterally branched, in most cases with

two, rarely three, branches. It was suprisingly difficult to find basidia, although most
specimens were fully mature, with abundant basidiospores in all preparations. We
encountered instead many basidioles and pleurocystidioid bodies, these most probably
being abnormally developed basidia. All the above mentioned abnormalities, if they be
such, might be induced by environmental conditions.

Hesler & Smith (1965) described two varieties of C. applanatus based on the
morphology of the cheilocystidia: var. phragmocystidiosus with septate cystidia and var.
diversus with branched or knobbed cystidia. These varieties are considered conspecific
by Aime (2001) with C. applanatus s. Joss. She concludes, after detailed examination,
that cheilocystidia in this taxon are, under the influence of environmental conditions,
capable of secondary growth that can alter their shape and size as well as the number of
septa per cystidium. This, however, does not seem to be the case in our specimens, as
the septate and non-septate cystidia are morphologically similar. We agree, nevertheless,
with Aime’s deduction that taxonomic delineation in Crepidotus cannot be based on
cystidial morphology alone, as the form of the cheilocystidia may vary greatly within a
single taxon and, as observed in this case, even within individual collections.

C. applanatus has been reported twice from Greece, from a fallen trunk of Abies
borisii-regis (Diamandis & Perlerou 1990) and from dead branches of Fagus (Diamandis
1992). The latter collection is accompanied by a description, but with no reference to the
morphology of the cheilocystidia. Judging by the habitat, the first collection might be var.
subglobiger and the second var. applanatus but the authors make no such distinction.

C. applanatus var. subglobiger is newly recorded for Greece.

Crepidotus cesatii var. cesatii (Rabenh.) Sacc. Figs 3a—-b; 9e
Crepidotus cesatii (Rabenh.) Sacc., Michelia 1: 2 (1877); Dochmiopus sphaerosporus (Pat.)
Pat., Hyménomyc. Eur.: 113 (1887); Crepidotus sphaerosporus (Pat.) J.E. Lange, Dansk
Bot. Ark. 9 (6): 52 (1938); Crepidotus cesatii var. sphaerosporus (Pat.) A. Ortega &
Buendia, Int. J. Myc. Lich. 4 (1-2): 96 (1989)

Pileus 3-22 mm, circular to semicircular or roundedly flabelliform, rarely somewhat
lobed, convex to plano-convex, centrally to eccentrically or almost laterally attached
to the substrate, margin incurved, becoming even only in fully mature specimens,
surface dry, felty, pure white, remaining so in dried specimens or becoming pale cream.
Lamellae whitish in young specimens, often with a pinkish tint, later cream, pinkish’
buff to pale cinnamon, never significantly darker, distant to subdistant, adnate, margin
minutely fimbriate, remaining whitish. Stipe absent or rudimentary.

Basidiospores (5.5-) 6.5-8.0 (-9.0) x 4.5-7.0 um, Q = (1.00-) 1.10-1.33 (-1.46),
globose, subglobose to broadly ellipsoid, pale yellowish in KOH, finely echinulate (Figs
3a, 9e). Basidia 20-37 x 6-9 um, cylindrical-clavate, 4-spored. Cheilocystidia 28-80 x
4~11 um, diverticulate, clavate, cylindrical, irregularly cylindrical, fusiform, lageniform,
usually branched, frequently multiply so, apices obtuse, hyaline, thin-walled (Fig. 3b).
Pileipellis a trichodermium of loosely interwoven hyphae with transitions to a loose
cutis, hyphae often coiled, 3-6 um wide, hyaline, thin-walled. Clamp connections
present in all tissues.

Habitat: Solitary or in small groups on dead or living branches of Platanus orientalis
and, in one case, Pinus nigra.

Fig. 3. C. cesatii var. cesatii: a. basidiopores, b. cheilocystidia. Scale bars = 10 um.

Specimens examined — Mt. Zygourolivado, Anthochori, Karditsa, riparian vegetation,
on a living branch of Platanus orientalis, 19 Sep. 1999, Delivorias, ATHU-M 5116; Mt.
Katachloro, Kedros, Karditsa, riparian vegetation, on branches of Pl. orientalis, 13 Nov.
1999, Delivorias, ATHU-M 5118; Mt. Tymfristos, Raches Tymfristou, Evrytania, forest
of Pinus nigra and Abies borisii-regis, on branches of P. nigra, 25 Oct. 2003, Delivorias,
ATHU-M 5125; Mt. Tymfristos, Agios Nikolaos, Evrytania, forest of Pl. orientalis,
Quercus sp. & Castanea sativa, on fallen twigs and branches of Pl. orientalis, 8 Nov.
2003, Gonou, ATHU-M 5109; Mt. Liakoura, Granitsa, Evrytania, forest of A. borisii-
regis and Pl. orientalis, on dead twigs and branches of PI. orientalis, 27 Sep. 2004,
Delivorias, ATHU-M 5162; Mt. Tymfristos, Agios Nikolaos, Evrytania, mixed forest of
Pl. orientalis, Quercus frainetto, C. sativa and A. borisii-regis, on branches of PI. orientalis,
23 Oct. 2004, Gonou, ATHU-M 5173; Mt. Liakoura, Granitsa, Evrytania, forest road, on
living branches of PI. orientalis, 11 Nov. 2004, Delivorias, ATHU-M 5176; Mt. Liakoura,
Granitsa, Evrytania, forest of A. borisii-regis and Pl. orientalis, on dead branches of PI.
orientalis, 11 Nov. 2004, Delivorias, ATHU-M 5179.

Remarks: The typical variety of C. cesatii is characterized by the distant lamellae, the
globose to subglobose, finely echinulate basidiospores, the diverticulate cheilocystidia
and the coiled hyphae of the pileipellis. The only other variety recognized by Senn-
Irlet (1995), C. cesatii var. subsphaerosporus (J.E. Lange) Senn-Irlet, is reported to have
broadly ellipsoid basidiospores, mostly straight hyphae on the pileipellis and to grow
on branches of coniferous trees. Also, Watling & Gregory (1989), report that the latter
variety lacks the characteristic pink tinge on the lamellae and has a darker spore print,
although Senn-Irlet does not make such a reference. In all specimens examined in this
work, at least a portion of the basidiospores were found to be broadly ellipsoid, and, in
some specimens, these spores predominate. However, in all specimens the hyphae of the
pileipellis were clearly coiled and the only collection made from coniferous trees does
not seem to deviate microscopically from the remaining collections. As we have been
unable to determine a correlation between the variation in shape of the basidiospores
and either the structure of the pileipellis, the colour of the lamellae or the habitat, we
have concluded that our findings consist of a single taxon, C. cesatii var. cesatii, in which

the basidiospores may range from perfectly globose to broadly ellipsoid in their extreme
variation, with a Q ratio reaching up to 1.46.

C. cesatii var. cesatii is newly recorded for Greece on twigs and branches of Pinus
nigra and Platanus orientalis, the latter seeming a rather common substrate for the
species in Greece, in contrast to the references for the distribution of the species in
Europe (Senn-Irlet 1995).

Crepidotus variabilis (Pers.: Fr.) P. Kumm. Figs 4a-b, 10g
Crepidotus variabilis (Pers.: Fr.) P. Kumm., Fuhr. Pilzk.: 74 (1871)

Pileus 5-15 mm, circular to semicircular or roundedly flabelliform, often lobed, convex
to plano-convex, centrally to eccentrically or almost laterally attached to the substrate,
with incurved and later even margin, surface dry, felty to smooth, pure white to dirty
white, remaining so in dried specimens. Lamellae whitish in young specimens, often
with a pale pinkish tint, later clay buff and finally cinnamon brown, moderately crowded
to crowded, emarginately adnate, margin minutely fimbriate, remaining whitish. Stipe
absent or rudimentary.

Basidiospores (5.0-) 5.5-7.0 (-7.5) x (2.5-) 3.0-3.5 (-4.0) um, Q = 1.57-2.17,
short cylindric to elongate, oblong, pale yellowish in KOH, minutely but distinctly
punctate-warty (Figs 4a, 10g). Basidia 20-25 x 5-7 um, cylindrical-clavate, 4-spored.
Cheilocystidia 22-53 x 6-11 um, diverticulate, clavate, cylindrical, irregularly
cylindrical, fusiform, mostly branched, often multiply branched, hyaline, thin-walled
(Fig. 4b). Pileipellis a trichodermium of loosely interwoven hyphae, 2-5 um wide,
hyaline, thin-walled. Clamp connections present in all tissues.

Habitat: Solitary to gregarious on branches of Quercus frainetto, Quercus coccifera and
Cistus sp.
Specimens examined — lake Plastira, Agios Athanasios, Karditsa, forest of Quercus
frainetto, on fallen branches of Q. frainetto, 1 Nov. 1998, Delivorias, ATHU-M 5112;
lake Plastira, Agios Athanasios, Karditsa, forest of Q. frainetto, on fallen branches of
Q. frainetto, 1 Nov. 1998, Delivorias, ATHU-M 5113; lake Plastira, Agios Athanasios,
Karditsa, forest of Q. frainetto, on fallen branches of Q. frainetto, 18 Sep. 1999,
Delivorias, ATHU-M 5114, Domokos, Fthiotida, maquis vegetation, on branches of
Quercus coccifera, 13 Nov. 1999, Delivorias, ATHU-M 5115; Mt. Ymittos, Attiki, maquis
vegetation, on twigs of Cistus sp., 7 Dec. 2002, Dimitriadis, ATHU-M 4648.

Remarks: C. variabilis is characterized by the lobed pileal margin (not always
distinct, however), the small-sized, cylindrical, punctate-warty basidiospores and the
diverticulate cheilocystidia. The lobed pileal margin may be a good distinctive feature
for macroscopical identification when clearly formed, but, as in all white species of
Crepidotus, careful microscopical examination is essential for identification. The
characteristic small-sizéd, cylindrical basidiospores provide a reliable distinguishing
feature. C. variabilis var. trichocystis Hesler & A.H. Sm. is reported to have larger
basidiospores and longer, narrowly cylindrical to narrowly lageniform cheilocystidia
(Senn-Irlet 1995).

C. variabilis seems to be common in Greece, as it is reported a number of times in
the literature (Maire & Politis 1940, as Dochmiopus variabilis; Minter 1988; Avtzis &
Diamandis 1988; Konstantinidis 2002) and we have collected it a few times ourselves.

O8 JOU a
an (SCPE IF
a |

Fig. 4. C. variabilis: a. basidiospores, b. cheilocystidia. Scale bars = 10 um.

It has also been recently collected on branches of Alnus glutinosa and Quercus coccifera
(Dimou pers. com.). It is newly recorded for Greece on branches of Quercus frainetto, Q.
coccifera and twigs of Cistus sp., the last two being representative plants of the maquis
vegetation.

Section Crepidotellae Hesler & A.H. Sm., 1965
Subsection Autochthoni Senn-Irlet, 1995

Crepidotus autochthonus J.E. Lange Figs 5a-b, 9f, 11c, e
Crepidotus autochthonus J.E. Lange, Dansk bot. Ark. 4 (6): 51 (1938)

Pileus 10-40 mm, semicircular to flabelliform, convex to plano-convex, laterally
or almost laterally attached to the substrate, with incurved, later even to undulating
margin, surface dry, glabrous to minutely fibrillose-tomentose, dirty whitish, cream to
yellowish buff. Lamellae whitish in young specimens, then spotted brownish and finally
uniformly cinnamon brown to fulvous, crowded, emarginately adnate, margin even.
Stipe absent or rudimentary. Spore print yellowish brown to umber.

Basidiospores 7.0-9.0 x 5.0-6.0 um, Q = 1.27-1.64, ellipsoid, amygdaliform or
lemoniform in side view, with a more or less acute apex, smooth, thick-walled,
occasionally wall thinning at acute apex, yellowish to yellowish brown in KOH, usually
with a large oil drop (Figs 5a, 9f). Basidia 25-30 x 7-9 um, cylindrical-clavate, with
4 sterigmata. Cheilocystidia 17-32 x 7-13 um, cylindrical, clavate, some subcapitate,
short lageniform, not branched, rarely septate, thin to thick-walled (Figs 5b, 11c).
Basidioles and cheilocystidia sometimes with yellow-golden, smooth content (Fig.
lle). Pileipellis a cutis of hyaline hyphae, 3-5 um wide, some ascending. Pileal trama
without gelatinous layer. Lamellar trama with few secretory hyphae, usually hyaline,
seldom golden-yellow. Clamp connections present in all tissues.

Habitat: Gregarious or in small groups on ground, in forest of Quercus frainetto or
mixed Q. frainetto and Abies borisii-regis.

Fig. 5. C. autochthonus: a. basidiospores, b. cheilocystidia. Scale bars = 10 um.

Specimens examined — Lake Plastira, Kryoneri, Karditsa, clearing of forest of Quercus
frainetto, on ground, 14 Oct. 2000, Delivorias, ATHU-M 5121; lake Plastira, Kastania,
Karditsa, mixed forest of Q. frainetto and Abies borisii-regis, on ground, 7 Sep. 2002,
Delivorias, ATHU-M 5124.

Remarks: C. autochthonus is rather similar-looking macroscopically to C. mollis and
has practically identical basidiospores, which nevertheless can be distinguished by their
acute apex, without the characteristic wall curving or apical depression of C. mollis
spores. It is also easily identifiable by the terrestrial habit, the lack of a gelatinous layer in
the pileal trama, the shape of the cheilocystidia and the presence of clamp-connections.
According to Senn-Irlet (1995), it is the only terrestrial species of Crepidotus in Europe.

C. autochthonus is newly recorded from Greece and is reported for the first time in
Europe in forests of Quercus spp.

Subsection Pleurotellus (Fayod) Senn-Irlet, 1995

Crepidotus epibryus (Fr.: Fr.) Quél. Figs 6a-b; 10i; 11f
Crepidotus epibryus (Fr.: Fr.) Quél., Mém. Soc. Emul. Montbéliard, sér. 2, 5: 138 (1872);
misdet.: Crepidotus perpusillus (Lumn.: Fr.) Maire, Fungi Catal. I: 102 (1937)

Pileus up to 10 mm, rounded flabelliform or campanulate when young, circular with
age, spreading out on the substrate, becoming almost resupinate, with white tomentum
around the margin where attached, sessile, surface tomentose, white, even when dried.
Lamellae rather distant to moderately crowded, adnexed, whitish to pale ochraceous
in fresh specimens, remaining so or darkening to fulvous in dried ones, margin
concolorous, even to slightly uneven, often browning at places, especially when dried.
Flesh very thin, white. Stipe absent.

Basidiospores 6.0-9.0 x 2.5-3.0 um, cylindrical, somewhat fusoid to narrowly
amygdaliform or pip-shaped, some slightly curved, smooth, hyaline or pale yellow in
KOH, yellow in the commonly formed masses (of two, four or more) (Figs 6a, 10i). Basidia
15-20 x 5-6 um, clavate, 4-spored, usually hyaline; some disintegrating basidioles and

£9

basidia with granular, golden brown content, larger in size (Fig. 11f). Cheilocystidia
up to 50 x 7 um, cylindrical to narrowly lageniform, flexuous, sometimes with strongly
curved or whirled apex, rarely branched, often difficult to be observed (Fig. 6b). Parts
of the hymenium covered with golden-brown granular material. Pileipellis a transition
between a cutis of interwoven hyphae and a trichodermium of erect, straight, filiform,
hyaline hyphae. Clamp connections absent in all tissues.

Habitat: Solitary on stalks and laminas of fallen leaves of Castanea sativa.

Specimens examined: Mt. Tymfristos, Agios Nikolaos, Evrytania, mixed forest of
Castanea sativa, Abies borisii-regis, Quercus sp. and Corylus avelana, on fallen leaves of
C. sativa, 14 Nov. 1998, Gonou, ATHU-M 5106.

Remarks: Distinctive microscopical characters of C. epibryus are the size and shape
of the basidiospores as well as the narrowly lageniform, flexuous and/or curled at the
apex cheilocystidia. The cheilocystidia were scarce and difficult to find, possibly because
the lamellar edge had been injured. The golden-brown material covering parts of the
hymenium is probably the result of the excretion of necropigments from the concolorous
disintegrating basidia and basidioles and corresponds macroscopically to the browning
spots of the lamellae. Similar pigmented and amorphous aggregations on the hymenium
are reported from species of Lyophyllum as well as pigmented basidia from species of
Inocybe, Cortinarius and Pholiota (Clémencon 1997).

C. epibryus has been twice reported from Greece, on leaves of Fagus sylvatica (as
Crepidotus perpusillus, Maire & Politis 1940) and on leaves of Quercus cerris (Polemis et
al. 2002). Our collection is the first recording of C. epibryus on leaves of Castanea sativa
in Greece and one of the very few in Europe (Senn-Irlet 1995).

BON (72
O(
ASO

Fig. 6. C. epibryus: a. basidiospores, b. cheilocystidia. Scale bars = 10 um.

Subsection Fibulatini Singer, 1947

Crepidotus lundellii Pilat Figs 7a-b; 10a, d
Crepidotus lundellii Pilat, Fungi Exsiccati Suecici fasc. V-VI: 10 (1936)

Pileus 3-20 mm, circular to semicircular or roundedly flabelliform, convex to plano-
convex, eccentrically to almost laterally attached to the substrate, with incurved and
later even margin, surface dry, felty, pure white to pale cream. Lamellae whitish in young
specimens, then clay buff and finally cinnamon brown to fulvous, moderately crowded
to crowded, emarginately adnate, margin minutely fimbriate, remaining whitish. Stipe
absent or rudimentary.

Basidiospores 6.5-8.5 (—9.0) x 4.5-5.5 (-6.0) um, Q = 1.40-1.80, in frontal view broadly
ovoid to ellipsoid, in side view ellipsoid to slightly amygdaliform, yellowish in KOH,
wall slightly roughened, almost smooth, frequently seemingly smooth even under oil
immersion but never actually completely smooth (Figs 7a, 10a). Basidia 21-30 x 6-8
um, cylindrical-clavate, 4-spored. Cheilocystidia 32-56 x 7-12 um, clavate, cylindrical,
fusiform, with an obtuse, sometimes subcapitate apex, rarely branched, hyaline, thin-
walled (Figs 7b, 10d). Pileipellis a trichodermium of loosely interwoven hyphae 3-5 um
wide, hyaline, thin-walled. Clamp connections present in all tissues.

Habitat: Gregarious on fallen branches of Platanus orientalis.

Fig. 7. C. lundellii: a. basidiospores, b. cheilocystidia. Scale bars = 10 um.

Specimens examined — Mt. Katachloro, Kedros, Karditsa, riparian vegetation, on
fallen branches of Platanus orientalis, 13 Nov. 1999, Delivorias, ATHU-M 5119; Mt.
Tymfristos, Agios Nikolaos, Evrytania, mixed forest of P. orientalis, Quercus frainetto,
Castanea sativa and Abies borisii-regis, on branches of P. orientalis, 23 Oct. 2004, Gonou,
ATHU-M 5171.

Remarks: C. lundellii is characterized by the unique ornamentation of the basidiospores,
consisting of very low warts and ridges. The spores seem smooth in low magnification

and the ornamentation is revealed only under oil immersion. The basidiospores are
ellipsoid to slightly amygdaliform and faint yellowish in KOH. In the macroscopically
similar C. subverrucisporus, the spore ornamentation is much more distinct, the spore
colour is darker and the cheilocystidia are more consistently narrowly lageniform
(apically tapered) (Senn-Irlet 1995; Bandala et al. 1999).

C. lundellii is newly recorded for Greece and is reported for the first time on Platanus
in Europe (Senn-Irlet 1995). It has also been recently collected on branches of Alnus
glutinosa (Dimou pers. com.).

Crepidotus luteolus (Lambotte) Sacc. Figs 8a-b; 10b, e
Crepidotus luteolus (Lambotte) Sacc., Syll. Fung. (Abellini) 5: 888 (1887)

Pileus 2-15 mm, sessile, young ungulate, campanulate, later convex to plano-convex,
flabelliform, reniform or semicircular when seen from above, laterally or dorsally
attached, often spread out over the substrate, almost resupinate, margin even, straight,
remaining so or becoming undate, lobate, white-yellowish to yellowish-cream when
wet, straw to buff when dried, surface first tomentose-hirsute with a smooth margin,
later smooth throughout or hirsute only near the point of attachment, usually with a rich
tomentum on the substrate. Lamellae adnexed to narrowly adnate, moderately crowded,
whitish or pale yellowish at first, later buff to buffish brown, fulvous when dried, margin
whitish, fimbriate when young, concolorous and almost smooth when mature. Flesh
white. Stipe absent or rarely observed in very young fruit bodies.

Basidiospores 8.0-9.5 (—10.5) x 4.5-5.5 (-6.0) um, Q = 1.55-2.10, ellipsoid in frontal
view, ellipsoid to usually amygdaliform in side view, yellowish brown in KOH, minutely
roughened (Figs 8a, 10b). Basidia 20-30 x 7-9 um, clavate, usually strongly granular,
4-spored. Cheilocystidia 45-60 x 5-8 um, cylindrical to narrowly lageniform, strongly
flexuous, often branched or rarely angular, hyaline, thin walled (Figs 8b, 10e). Lamellar
edge in some sections somewhat gelatinous, holding cheilocystidia rather packed.
Pileipellis either a cutis of interwoven hyphae with transitions to a trichodermium
bearing bundles of exerted hyphal ends, or a real trichodermium with erect hyphae,
hyphae straight, flexuous or winding, thin to slightly thick walled, hyaline or pale yellow,
some of the latter slightly encrusted. Clamp connections present in all tissues.

Habitat: Solitary or in small groups, rather gregarious, on fallen twigs of Platanus
orientalis.

Specimens examined — Mt. Tymfristos, Agios Nikolaos, Evrytania, mixed deciduous
forest of Platanus orientalis, Quercus sp. and Castanea sativa, on fallen twigs of P.
orientalis, 8 Nov. 2003, Gonou, ATHU-M 5110.

Remarks: C. luteolus is characterized macroscopically by the yellowing colors of the
basidiocarps and microscopically by the faintly ornamented, amygdaliform, relatively
long and narrow basidiospores as well as the polymorphic, flexuous, frequently branched
cheilocystidia. Our specimens of C. subverrucisporus exhibit the same yellowing colors
when fresh and could be confused macroscopically with those of C. luteolus. The two
species can be distinguished microscopically by their basidiospores and cheilocystidia.
The basidiospores of C. subverrucisporus differ in being more ornamented and ellipsoid
(broader) rather than amygdaliform in side view, while the cheilocystidia are less
flexuous and branched.

ey)

Fig. 8. a-b. C. luteolus: a. basidiospores, b. cheilocystidia; c-d. C. subverrucisporus: c.
basidiospores, d. cheilocystidia. Scale bars = 10 um.

It is worth mentioning that besides C. luteolus, specimens of C. cesatii were collected
on the same day from the same locality, on nearby fallen twigs of Platanus orientalis.
Basidiocarps of C. luteolus exhibited a pale yellow color on the pileus in contrast to the
whitish color of C. cesatii.

C. luteolus is newly recorded from Greece and is reported for the first time on
Platanus in Europe. It has also been recently collected on Nerium oleander (Dimou pers.
com.)

Crepidotus subverrucisporus Pilat Figs 8c-d; 10c, f; lla
Crepidotus subverrucisporus Pilat, Studia Botanica Cechoslavaca 10: 151 (1949)

Pileus 3-10 mm, circular to semicircular or roundedly flabelliform, convex to plano-
convex, eccentrically to almost laterally attached to the substrate, where usually with a
whitish or yellowish tomentum, margin incurved and later even, surface dry, felty, white

or dirty whitish to pale yellowish cream. Lamellae whitish in young specimens, later
buff and finally cinnamon brown to fulvous, moderately crowded, emarginately adnate,
margin minutely fimbriate, remaining whitish. Stipe absent.

Basidiospores (7.0—) 7.5-10.0 (—11.0) x (4.5-) 5.0-6.0 (—7.0) um, Q = 1.45-1.78, ovoid
to ellipsoid, slightly amygdaliform in side view, yellowish brown in KOH, minutely but
distinctly rugulose (Figs 8c, 10c). Basidia 20-25 x 7-8 um, cylindrical-clavate, 4-spored,
some 2-spored. Cheilocystidia 28-65 x 4-10 x 3-5 um, cylindrical, broadly lageniform
to narrowly, elongate lageniform, often angular or sometimes branched towards the
apex or apex subcapitate, sometimes septate at upper 1/3, hyaline, thin-walled (Figs
8d, 10f, 11a). Pleurocystidia absent but seldom lageniform pleurocystidioid bodies
present. Basidioles and pleurocystidioid bodies sometimes with golden-yellow content.
Pileipellis a trichodermium with transitions to a cutis, hyphae loosely interwoven, 3-6
tum wide, hyaline, thin-walled. Clamp connections present in all tissues.

Habitat: Gregarious on fallen branches of Platanus orientalis.
Specimens examined — Mt. Katachloro, Kedros, Karditsa, riparian vegetation, on
fallen branches of Platanus orientalis, 13 Nov. 1999, Delivorias, ATHU-M 5120; Mt.
Tymfristos, Agios Nikolaos, Evrytania, mixed forest of P. orientalis, Quercus frainetto,

Castanea sativa and Abies borisii-regis, on mossy branches of P. orientalis, 23 Oct. 2004,
Gonou, ATHU-M 5172.

Remarks: The fresh fruit bodies from both collections exhibited a pale yellowish color
in the pileus which was retained in the exsiccata. C. subverrucisporus is characterized by
the minutely but distinctly rugulose, slightly amygdaliform, moderately dark coloured
basidiospores and the rather simple lageniform cheilocystidia. The cheilocystidia
are reported to be generally unbranched (Watling & Gregory 1989; Senn-Irlet 1995;
Breitenbach & Kranzlin 2000). Type studies performed by Senn-Irlet (1993) showed
that the cheilocystidia in the holotype (found on Robinia pseudoacacia) are often septate
(also observed by Bandala et al. 1999) and sometimes branched. The same observation
was made by Senn-Irlet (1995) on material collected from Italy, also on Robinia. We
have encountered in our specimens both septate and branched at the tips cystidia.

We have also occasionally observed pleurocystidioid-like bodies, some with a
golden-yellow content, but they are probably of no taxonomic significance. Bandala et
al. (1999) also report sterile basidiole-like elements rarely present on the sides of the
lamellae and consider them probably to be abnormal basidia or basidioles.

C. subverrucisporus is newly recorded from Greece and is reported for the first time
on Platanus in Europe.

Discussion

With few exceptions, such as C. calolepis or C. cinnabarinus, the species of Crepidotus are
~ more or less macroscopically similar, i.e. whitish, small to medium sized basidiocarps,
with whitish to pale brownish lamellae and without a distinctive smell or taste. Hence,
careful microscopic examination is absolutely essential for determination at a species
level. The most important microscopic features from a taxonomical standpoint are the
morphology of basidiospores, cheilocystidia and, to a lesser degree, pileipellis, and the

presence or absence of clamp connections (Nordstein 1990; Senn-Irlet 1995; Bandala &
Montoya 2004). In few species other features are also of taxonomical importance, such
as the presence of a gelatinous layer in the pileal trama in C. calolepis and C. mollis, the
distant, pinkish lamellae in C. cesatii, or some striking habitat preferences, such as the
growth on stems, leaves or litter in C. epibryus, or directly on soil in C. autochthonus. In
general, however, habitat preferences are an indicative and not a decisive taxonomical
feature. C. calolepis and C. mollis are considered by most authors to grow exclusively
on deciduous trees, but we have collected both species on conifers in more than a few
occasions. C. cesatii var. cesatii is considered to prefer deciduous trees whereas var.
subsphaerosporus coniferous trees, but the decisive distinctive feature between the
two varieties is the shape of the basidiospores and not the habitat. We have collected
specimens of C. cesatii on both deciduous and coniferous trees, but without any notable
microscopic differences between them.

We noted many deviant features in our specimens, such as a callus-like structure
at the apex of the basidiospores in C. calolepis and C. mollis, pleurocystidioid-like
bodies in C. calolepis, C. applanatus var. subglobiger and C. subverrucisporus, septate
cheilocystidia in C. mollis, C. applanatus var. subglobiger, C. autochthonus and C.
subverrucisporus, thick-walled cheilocystidia in C. applanatus var. subglobiger, basidia,
basidioles and cheilocystidia with pigmented content in C. mollis, C. autochthonus and
C. subverrucisporus, amorphous material on the hymenium in C. epibryus, gelatinized
lamellar trama in C. calolepis and C. mollis, and secretory hyphae in many species. The
presence of the callus-like structure in C. calolepis and C. mollis, although sporadic,
is constant and should be considered characteristic for the two species. Singer (1973)
also mentioned such features. All the other features have an inconstant appearance and
are due most probably to environmental conditions or different stages of maturity, and
therefore no taxonomic value can be attributed to them.

The determination of the diversity and distribution of Crepidotus species is not an
easy task, as they usually form small-sized basidiocarps that may be overlooked. Prior
to this work, 7 taxa of Crepidotus were reported from Greece: C. applanatus (Diamandis
& Perlerou 1990; Diamandis 1992), C. cesatii (Maire & Politis 1940, as Dochmiopus
sphaerosporus, Dimou et al. 2002a, as Crepidotus sphaerosporus), C. calolepis (Maire &
Politis 1940), C. cinnabarinus (Dimou et al. 2002b), C. epibryus (Maire & Politis 1940,
as Crepidotus perpusillus; Polemis et al. 2002), C. mollis (Diapoulis 1939; Maire & Politis
1940; Pantidou 1991; Zervakis et al. 1998; Dimou et al. 2002a) and C. variabilis (Maire
& Politis 1940; Minter 1988; Avtzis & Diamandis 1988; Diamandis 1992; Konstantinidis
2002). Most of these taxa were reported only once or twice, with the exceptions of the
seemingly common C. variabilis and C. mollis. Concerning the latter, as stated in this
work, it is possible that some collections attributed to C. mollis may in fact represent
collections of C. calolepis. Some older collections (Diapoulis 1939; Maire & Politis 1940)
cannot be accounted for and probably have not survived to this day. We have examined
collection ATHU-M 1071 identified as C. mollis (Pantidou 1991) and have attributed it
to C. calolepis, and have also cross-examined two specimens of C. calolepis and one of C.
mollis, kindly provided to us by Dimou. We are convinced that C. calolepis is much more
common in Greece than C. mollis.

Crepidotus species never form the dominant element in any European vegetation
unit (Senn-Irlet 1995), and this obviously applies for Greece as well. Most of the gathered
collections consist of rather few individuals. Few of the collected species were found to
grow gregariously, i.e. C. calolepis, C. mollis, C. autochthonus and, to a lesser degree, C.
luteolus and C. subverrucisporus. However, in some occasions we collected more than a
few different species from the same location. Seven taxa: C. calolepis, C. mollis, C. lundellii,
C. subverrucisporus, C. cesatii var. cesatii, C. luteolus and C. epibryus, were collected
from a small area on Mt. Tymfristos (Agios Nikolaos), the first five on the same day. In
addition, C. calolepis and C. cesatii were collected in two successive years from that area.
Three of the similar-looking white species, C. cesatii, C. lundellii and C. subverrucisporus,
were collected on the same day from the same location (Mt. Katachloro). In one case,
basidiocarps of two species, C. cesatii and C. calolepis, were found on nearby branches of
the same Platanus orientalis, a few meters apart from a second Platanus colonized by C.
mollis (Mt. Liakoura). We have not, however, encountered more than one species on the
same branch. Senn-Irlet (1995) states that in no case had she encountered basidiocarps
of more than one Crepidotus species on the same substrate.

Floristic studies in other countries of the Mediterranean region reveal a similar
diversity of Crepidotus species as in Greece. Senn-Irlet (1995) provides data for most
countries surrounding the Mediterranean, such as Bulgaria, Jugoslavia, Turkey, Italy,
France and Spain. A recent checklist of Crepidotus in Croatia includes eight species in
total, all of which have also been found in Greece (Tkalcec & Mesi¢é 2003). The same
applies for the seven species of Crepidotus reported from Turkey (Selsi & Denchev
2005). The diversity of Crepidotus in Spain (Ortega & Buendia 1989) is also similar to
that of Greece. Lonati (2000) presented a paper concerning the diversity of Crepidotus
in the Mediterranean area, in which he reports sixteen species (twelve, if synonymy
is considered) collected from various provinces of Italy. Malencon & Bertault (1975)
report eight species from Morocco, Algeria and Tunisia.

In conclusion, the biodiversity of Crepidotus in Greece includes, to date, 12 taxa in total.
A survey of all species recorded in Greece is given in Table 1, where both published and
unpublished data are included. Five taxa are newly recorded from Greece: C. applanatus
var. subglobiger, C. autochthonus, C. lundellii, C. luteolus and C. subverrucisporus. Other
five taxa are recorded on new substrates for Greece: C. calolepis on trunks and branches
of Abies cephalonica, Abies borisii-regis and Pinus nigra, C. cesatii var. cesatii on twigs and
branches of Platanus orientalis and Pinus nigra, C. epibryus on leaves of Castanea sativa,
and C. variabilis on twigs and branches of Cistus sp., Quercus frainetto and Q. coccifera.
Moreover, C. calolepis and C. mollis are encountered for the first time in Europe on
conifers, C. calolepis, C. lundellii, C. luteolus and C. subverrucisporus on Platanus, C.
autochthonus in Quercus forests and C. variabilis on Cistus.

Acknowledgments

We wish to thank Drs. Beatrice Senn-Irlet and Victor Bandala for their thorough revision of the
paper, valuable comments and constructive correspondence and Dr. Shaun Pennycook for his
nomenclatural review. We thank D. Dimou and S. Diamandis for giving us useful information
from their data on the distribution of Crepidotus species in Greece and especially the former for the
provision of dried specimens for microscopic examination.

nowld “U1o0d ‘*s1ed
nowllq “Urod ‘sIed
PZOOT Je Jo NOUITG ‘sn4odsosavyds “7D se
OF6I SHIOd 29 ole ‘Snsodsosavyds sndommys0q se

x) SI[BJUALLO “]q JO POOM
DIYBAIAS “J JO POOM
"ds SnBD.J JO SdARIT 2 SBIMJ UaT]ey
x) SI[DIUALLO “]q JO SayDueAG peep

11]DS99 “IVA
1140829 *D)

SHDIUAILO “[q PUL S1BA1-11S110g “YW JO jSO10} PoXTUl

NOUN “UIOD “Sad ‘$7daj0]VI “TRA S1jJOUL “) Se
NOUN “WIOd ‘sad ‘s1jjOuL “Dd se
SIPIUIURJSUOY “UID “stad ‘s1da]0]VI “TRA S1]jOUW se
PZONT Te }9 NOUN ‘866 ‘[e 19 SLYPAIIZ, <S7]jOul “DZ se
1661 NopHued ‘sijow ‘dD se
OP6T SHMOd 28 9TTRIN

OP6T SIMOd 8 OTE

SYDIUALLO ‘]q PUL SID

21-115110Q “VW JO \Sa10} poxtul

PPO }Soa1OF
DAU J JO JSIIOJ
$18d1-11S1.10g ‘YW PUP DAIJDS “C) ‘SDJUAILO “J JO \SO10} PoXTU
(Aqyeotpeszods) sypjzuaiso ‘]g 2% S18a4-11S110g “VY JO JSo1OF poxTUr

‘oqjaurvdt ‘C s1da]0]v9 *D

vAIIDS “> 2 “ds snd4aNd ‘stjvJUAILO “[_q JO jSa10} poxTUU
UOHe}ISOA UPTICAII
"dS SNILANC) 2 VALDS VAUYISVD JO {Sa10} PoxTU
“ds Sa1qy 29 VISIU q JO \S210} PoxTUl
Teotpesods) sijpjuai.10 ‘Jq 2 vIIUO|vYdad “Y JO {S210} PxTUt
Disiu q 2 vaiuojvydad “Y JO \Sa1O} PaXxtul
DILUO[VYdad SAIQY WY VAGIU | JO }SOIO} POXTUL
“ds snuig JO \Sa10j

SnuUOYJYIOIND “D)

4a81qQ0]8qns ‘Ter
snjyouvjddp “)

(,.) YIM sty} Sd1QD VAI JO }SI1OJ sa1qv vag JO YUNA} UsT[eF

DISIU SNUIg PUR S1Ba4-11S110g “Y JO \SaIO} paxTUl S1801-11S110g Saigy JO SYUNT] UsT]ey
DIVISAOUL +] JO JSOIOJ DIVISAOU SND JO SoyIUeIG UPJ

Le eo ee a ea ee ee SSIS

‘adoing IO} aye1}Sqns JO p1099I ISI = (#) “99991H JOJ ayeAJsqns sj} 1O/pue satdads Jo p10da1 SIU = (,)
"9090I15) WOIJ paprosas sarseds snjopidas_ Jo AdAIMS Y *T 9QeL

0661 NOsepIad 2 SIpueUIeI
7661 Stpueurelq

snyouvjddv “5

f $1BA4-11S110Q “VW JO S10}
DABIU g JO UOT}EIULTA Jo soliepunog
oyauivdf ‘CE JO \Sa10}
DALJOS *) JO S210}
DABIU q PUR S15a4-1is140g "VW JO \SoIO} POxTUl
DALJDS *D JO SIO}

S1901-11S1109 ‘YW JO pOOM
"ds sna1anQ) JO poom
x) Oauws ‘CE JO poom
DADS “J JO POOM
S1801-11S110Q “W JO pPOOM
DALJDS “FD JO POOM
Diafi9I02 ‘CE JO sayouriq
DSOULIN]S snuTY JO SoydueIq

sIpUueUIRIC] “UIOS °
sTpueureid “UWI0d *
sIpueureiq “U0d °
STPUPLUIC] “UIOD °
sIpueurelq “UI0d *
sIpueuleid] “UI0d °
nowtq “W105 °
NOW “UIOd °
7007 SIprunuesuOy

SYIQVIADA “D

uOT]e}I90A SINDeUT
0jjJaUIDAL “CE JO {S210}
Sidad-11S1109 “VW Pure vALIDS “+ ‘OjJaUIDA ‘C ‘S1]BJUA1L0 *]q JO S10} POXTUL

UOTL}JISOA UPTIECII

rere er eae ee Les a Hos

snaodsimnassaaqns *)

noulg “wrod “siad
SIpruIUesUOy “UWOD “stad
OFGT SUMOd 28 ete
6E6I STMOdeiq

SIDIJUAILO [q PUL S1BA4-11S110g “VW JO }Sa1O} paxtul
S]DJUAILO [q PUL S18A4-11S140g “YW JO. JSe1O} poXTu

Le SS See ee S1DAI-1ISI10G “VW Pure DADS “> ‘OJJauIvAf CD ‘S1]PJUA140 “[q JO IS210J PoXTUl
i TaTASTIOg V0 5]
CK ee ea SE
DALDS “DQ “dS SNIAANC ‘S1]JUALLO ‘]_g JO jSAIO} poxtUl
Pees, ceen SIU eee Oe Ee =
S1Da1-11S110g ‘W puke BAIJDS “D ‘OJauIvAf “OD ‘S1]DJUAILLO “[_ JO JS21OJ PaXTUl
UOMe}aS0A UeLIed

uypepuny ‘D

sndagida ")

nou!

WOOD ‘“Stod

OP6I SHTOd 29 ome ‘snyjisndsad “> se

sIpuewreiq “WI0d ‘sid

Cia? 2 a i ae aa

snul.vqvuul) “D

Fig. 9. a-b. Thick-walled basidiospores with apical wall curving and small depression (arrows);
c. pale yellow hyphae of the pileipellis with granular (g) or minutely encrusting (e) pigment; d.
yellow-brown hyphae of the pileipellis with strongly encrusting zebra-like pigment (eke a,c. C.
mollis (ATHU-M 5123); b, d. C. calolepis (Dimou 731). e-f. Basidiospores: e. C. cesatii var. cesatii
(ATHU-M 5109, 5125); f. C. autochthonus (ATHU-M 5121). Scale bars = 10 um.

ee:

Fig. 10. a-c. Basidiospores; d-f. Cheilocystidia: a, d. C. lundellii (ATHU-M 5119); b, e. C. Iuteolus
(ATHU-M 5110); ¢, f. C. subverrucisporus (ATHU-M 5120). g-h. Basidiospores: g. C. variabilis
(ATHU-M 5112); h. C. applanatus var. subglobiger (ATHU-M 5332); i. C. epibryus (ATHU-M
5106). Scale bars = 10 um.

Fig. 11. ac. Cheilocystidia with septae (arrows): a. C. subverrucisporus (ATHU-M 5120); b. C.
mollis (ATHU-M 5123); c. C. autochthonus (ATHU-M 5121). d. Yellowing basidiole: C. mollis
(ATHU-M 5123). e. Yellowing, thick-walled cheilocystidia: C. autochthonus (ATHU-M 5121). f.
Disintegrating basidiole and basidium with yellow-brown, strongly granular content: C. epibryus
(ATHU-M 5106). g. Pleurocystidioid body: C. calolepis (ATHU-M 5105). h-j. Septate, branched
and thick-walled cheilocystidia: C. applanatus var. subglobiger (ATHU-M 5332). k. Secretory
hyphae in the lamellar trama: C. mollis (ATHU-M 5123). Scale bars = 10 um.

Literature Cited

Aime MC. 1999. Generic concepts in the Crepidotaceae as inferred from nuclear large subunit,
ribosomal DNA sequences, morphology, and basidiospore dormancy patterns. M.S. Thesis,
Virginia Polytechnic Institute and State University, Blacksburg, VA.

Aime MC. 2001. Biosystematic studies in Crepidotus & the Crepidotaceae (Basidiomycetes,
Agaricales). Ph.D Thesis, Virginia Polytechnic Institute and State University. Blacksburg,
Virginia.

Aime MC, Vilgalys R, Miller Jr OK. 2005. The Crepidotaceae (Basidiomycota, Agaricales): phylogeny
and taxonomy of the genera and revision of the family based on molecular evidence. Amer. J.
Bot. 92: 74-82.

Avtzis N, Diamandis S. 1988. Insects and fungi of the National Parks of Olympus, Pelion, Prespes
and Frakton, Drama. Dasiki Erevna 2: 67—75 (in Greek).

Bandala VM, Montoya L. 2000a. A revision of some Crepidotus species related to Mexican taxa.
Mycol. Res. 104: 495-506.

Bandala VM, Montoya L. 2000b. A taxonomic revision of some American Crepidotus. Mycologia
92: 341-353.

Bandala VM, Montoya L. 2004. Crepidotus from Mexico: New records and type studies. Mycotaxon
89 (1): 1-30.

Bandala VM, Montoya L, Moreno G. 1999. Two Crepidotus species from Mexico with notes on
selected type collections. Mycotaxon 72: 403-416.

Bas C. 1988. Orders and families in agarics and boleti. In: Flora Agaricina Neerlandica, Vol. 1. 40-
49. Bas C. et al. eds., AA. Balkema, Rotterdam, Netherlands.

Breitenbach J, Kranzlin FE 2000. Fungi of Switzerland. Vol. 5. Agarics 3™ part. Cortinariaceae.
Mycological Society of Lucern.

Clémengon H. 1997. Anatomie der Hymenomyceten. F. Fliick-Wirth, Teufen.

Diamandis S. 1992. The mushrooms of Greece. Ion, Athens (in Greek).

Diamandis S, Perlerou C. 1990. New recordings of higher Basidiomycetes and Ascomycetes in
Greece. Scientific Annals of the Department of Forestry and Natural Environment: 293-303
(in Greek).

Diapoulis CA. 1939. Contribution to the study of the fungi of Mt. Pelion. Rep. Phys. Sci. 50-51:
1-7 (in Greek).

Dimou DM, Zervakis GI, Polemis E. 2002a. Mycodiversity studies in selected ecosystems of Greece:
I. Macrofungi from the southernmost Fagus forest in the Balkans (Oxya Mountain, Central
Greece). Mycotaxon 82: 177-205.

Dimou DM, Polemis E, Zervakis GI. 2002b. Macromycetes associated with Alnus glutinosa from
Greece. Proceedings of the 11 Hellenic Phytopathological Congress, Preveza, Greece. p. 53.

Ersel FY, Solak MH. 2004. Contributions to the Macrofungi of Izmir Province. Turk. J. Bot. 28:
487-490.

Hawksworth DL, Kirk PM, Sutton BC, Pegler DN. 1995. Ainsworth & Bisby’s Dictionary of the
Fungi. 8" ed. CAB International, Wallingford, UK.

Hesler LR, Smith AH. 1965. North American species of Crepidotus. Hafner Publishing Co., New
York.

Julich W. 1981. Higher taxa of Basidiomycetes. Bibliotheca Mycologica 85. J. Cramer, Vaduz.

- Kirk PM, Ansell AE. 1992. Authors of fungal names. Index of fungi supplement. C.A.B. U.K.

Kirk PM, Cannon PF, David JC, Stalpers JA. 2001. Dictionary of the Fungi. 9° ed. CABI Publishing,
Wallingford. UK.

Konstantinidis G. 2002. Mushrooms. A fictionary microcosm. Capon, Athens (in Greek).

Krisai-Greilhuber I, Senn-Irlet B, Voglmayr H. 2002. Notes on Crepidotus from Mexico and the
south-eastern USA. Persoonia 17: 515-539.

Kiihner R. 1980. Les Hyménomycetes agaricoides (Agaricales, Tricholomatales, Pluteales, Russulales).
Etude générale et classification. Bull. Soc. Linn. Lyon 49: 1-1027, numero speciale.

Lonati G. 1993. Fungi Mediterranei rariores. Crepidotus mollis var squamulosus Coutinho. Mic.
Veg. Med. 8: 83-84.

Lonati G. 2000. Il genere Crepidotus in area mediterranea. Mic. Veg. Med. 15: 161-186.

Maire R, Politis J. 1940. Fungi Hellenici. Catalogue raisonné des champignons connus jusqu ici en
Gréce. Actes de l’Institute Botanique de I’ Université d’Athénes 1: 27-179.

Malencon G, Bertault R. 1975. Flore des champignons supérieurs du Maroc. Tome II. Travaux de
l Institut Scientific Chérifien et de la Faculté des Sciences de Rabat. Série botanique et bologie
végétale N° 33. Rabat.

Minter DW. 1988. British Mycological Society Greek Foray. London.

Moncalvo J-M, Vilgalys R, Redhead SA, Johnson JE, James TY, Aime MC, Hofstetter V, Verduin
SJW, Larsson E, Baroni TJ, Thorn RG, Jakobsson $, Clémencon H, Miller OK. 2002. One
hundred and seventeen clades of euagarics. Mol. Phylogenet. Evol. 23: 357-400.

Moser M. 1978. Keys to Agarics and Boleti (Polyporales, Boletales, Agaricales, Russulales). Roger
Philips, London.

Nordstein S. 1990. The genus Crepidotus (Basidiomycotina, Agaricales) in Norway. Synopsis
Fungorum 2, Fungiflora, Oslo. :

Ortega A, Buendia AG. 1989. Notas sobre el genero Crepidotus (Fr.) Staude en Espafia peninsular.
Int. J. Myc. Lich. 4 (1-2): 93-105.

Oztiirk C, Kasik G, Dogan HH, Aktas S. 2003. Macrofungi of Alanya District. Turk. J. Bot. 27:
303-312.

Pantidou ME. 1991. Mushrooms in the forests of Greece. The Goulandris National History
Museum, Athens.

Pilat A. 1948. Monographie des espéces européenes du genre Crepidotus Fr. Atl. Champ. Eur. 6.
Praga.

Polemis E, Zervakis GI, Dimou DM. 2002. New and interesting findings of macrofungi from
the islands of Andros and Naxos (Cyclades, Greece). Book of Abstracts, 7" International
Mycological Congress, Oslo. p. 169-170.

Senn-Irlet B. 1993. Type studies in Crepidotus II. Persoonia 15: 155-167.

Senn-Irlet B. 1995. The genus Crepidotus (Fr.) Staude in Europe. Persoonia 16 (1): 1-80.

Senn-Irlet B, De Meijer A. 1998. The genus Crepidotus from the State of Parana, Brazil. Mycotaxon
66: 165-199.

Sesli E, Denchev CM. 2005. Checklists of the myxomycetes and macromycetes in Tiley.
Mycologica Balcanica 2: 119-160.

Singer R. 1947. Monograph of the genus Crepidotus. Lilloa 13: 59-95.

Singer R. 1973. The genera Marasmiellus, Crepidotus and Simocybe in the neotropics. Beih. Nova
Hedwigia 44: 1-484.

Singer R. 1986. The Agaricales in modern taxonomy. 4" ed. Koeltz Scientific Books, Koeningstein.

Stangl J, Krieglsteiner GJ, Enderle M. 1991. Die Gattung Crepidotus (Fr.) Staude 1857 in Deutschland
unter besonderer Beriicksichtigung Augsburger Funde. Zeit. Mykol. 57: 117-148.

Tkaléec Z, Me&si¢ A. 2003. Preliminary checklist of Agaricales from Croatia V: Families
Crepidotaceae, Russulaceae and Strophariaceae. Mycotaxon 88: 279-314.

Watling R, Gregory NM. 1989. British Fungus Flora. 6. Crepidotaceae, Pleurotaceae and other
pleurotoid agarics. Royal Botanic Garden, Edinburgh.

Zervakis G, Dimou D, Balis C. 1998. A check-list of the Greek Macrofungi Beitaite hosts and
biogeographic distribution: I. Basidiomycotina. Mycotaxon 66: 273-336.

MYCOTAXON

Volume 94, pp. 43-46 October-December 2005

The lichen flora of the Termessos National Park
in Southwestern Turkey

OzcE TUFAN, HiseyIn SUMBUL & AYSEN OZDEMIR TURK

ozgetufan@akdeniz.edu.tr
Akdeniz University, Faculty of Arts and Sciences, Biology Department,
TR-07058 Antalya, Turkey

Abstract - Between March 2002 and 2003, the lichen flora of the Termossos National
Park was studied for the first time. In all, 161 taxa (152 species, 4 subspecies, 5 varieties)
were determined from 1114 lichen samples, of which 86 were new to Antalya Province
and 5 were new to Turkey. The complete checklist can be downloaded as PDF file from
www.mycotaxon.com/resources/weblists/html.

Key words - lichens, Giilliik Mountain, Antalya

Introduction

The number of studies on the lichen flora of Turkey has increased significantly over the
last two decades (e.g., Aslan 2000, Breuss & John 2004, Cicek & Ozdemir Tiirk 1998,
Giiveng et al. 1996, Ozdemir Tiirk & Giiner 1998, Oztiirk & Giiven¢ 2003). Although
the lichen flora of the Mediterranean phytogeographical region of Turkey has received
more attention than the other regions of Turkey (John 1996, 2003; John & Nimis 1998;
Nimis & John 1998; John et al. 2000), even this area needs additional research. To
determine the lichen flora of the region, floristic studies that focus on small areas with
high biodiversity are needed.

Throughout the Mediterranean region of Turkey, there are ruins and cities from the
ancient civilizations, but until now no lichen floristic or biodeterioration study has been
published from such places. Termessos (Giilliik Mountain) National Park, located on the
West side of the Taurus Mountains in Antalya province, southwestern Turkey, is such a
site. It is famous for its ancient city, Termessos, which is situated on a natural platform
at the top of Gilliik Mountain, which has been formed by chemical erosion and tectonic
movements. It includes a canyon with very steep walls as high as 500-600 m.

Material and Methods

The research is based on 1114 lichen samples, which were collected from 54 localities
(Table 1) in Termessos National Park between March 2002 and September 2003. In
every locality coordinates and altitude were measured by GPS (Garmin 12X) and all
lichen samples were taken together with their substratum. The samples were brought the
laboratory and air-dried under room conditions (25 + 2 °C, RH 60+10).

For identification, macroscopic and microscopic characters were examined with
stereo- and light microscopes and by reference to recent literature (e.g. Wirth 1995,
Purvis et al. 1992, Clauzade & Roux 1985, Giordani et al. 2002, Jorgensen 1997, Zeybek
et al. 1993, Breuss 1990, Moberg 1977). Following identification, the lichens were
deposited in Akdeniz University Herbarium (AKDU).

Results

A PDF file containing the list of lichen species (including locality numbers and substrata)
encountered in Termessos National Park, table of localities, and map of the study area
can be downloaded from http://www.mycotaxon.com/resources/ weblists.html. The
abbreviations of authors are in accordance with Brummitt & Powell (1992). Lichen taxa
new to Turkey are indicated by *, those new to Antalya province by #.

Discussion

This study reports 161 taxa from Termessos National Park, of which Collema
conglomeratum, Lecania inundata, Leptogium furfuraceum, Peltigera monticola and
Physconia servitii are new to Turkey and 86 are new to Antalya province. Although the
lichen flora of the Mediterranean region of Turkey is reasonably well studied, it is quite
remarkable to find still so many new lichen records for the region as well as some new
to the country, emphasizing that much more explorative effort should be made on its
lichen flora.

In the study area, in addition to common lichen species for the Mediterranean
Region, such as Lecanora bolcana and Diploschistes ocellatus, we determined “manna”
lichens, such as Aspicilia desertorum and A. hispida, which usually grow in steppes,
suboceanic species such as Degelia plumbea and Staurolemma omphalarioides, and
oceanic species, such as Collema furfuraceum and C. nigrescens. Although the study
area is relatively small (ca. 6702 ha), the wide variation in its topology, formed by high
mountains, valleys and a deep canyon, evidently provides habitats for a rich lichen
biodiversity.

Calcareous species are dominant due to the widespread occurrence of calcareous .
rocks throughout the study area, and because of the frequency of trees with acidic
bark, such as Pinus nigra and Quercus coccifera, most of the epiphytic species are
acidophytic.

Of particular note are Anthracocarpon virescens, Caloplaca adriatica, Hypocenomyce
anthracophila, Neocatapyrenium rhizinosum, Pertusaria hymenea, Placidium pilosellum,
Solenopsora liparina and Staurolemma omphalarioides, for which there are only one or
two records from Turkey (Pisut 1970; Breuss 1998; Nimis & John 1998; John et al. 2000;
John 1996, 2003; Breuss & John 2004).

On the ruins of the ancient city of Termessos, not only species with a wide ecological
amplitude, such as Aspicilia calcarea, Caloplaca aurantia, Lecanora muralis, Lobothallia
radiosa, Placynthium nigrum and Xanthoria elegans were found, but also species mainly
found in the Boreal-Mediterranean region and between the south of Central Europe and
the Mediterranean Region such as Aspicilia farinosa, Caloplaca chrysodeta, C. xantholyta,
Collema cristatum, Diploschistes ocellatus, Lepraria nivalis, Solenopsora candicans and

Solenopsora liparina (Wirth 1995). Because the ancient city was built from local stones,
the species on the ruins are similar to the lichen flora found elsewhere in the study
area.

SES ARAL tex
“ <
yA
ra
ra
x ~

Nae”
KARAKIRSE
#

oe OSI
+o

F.3
ee
cape Rrregsst en &
> ae

eat

bey

yn aA
Sener

ot:

. > <
a dae — .
< . Zi ae 5 ~~ e

er ee we
“t SORIA STEN & i Nak

;

gst Pen? ae 4
Po geuearennpecac ®
oie “$y

SEARAVARALY !

sha f
ia S

2 y
¥ é F ha Pre
‘i = ey as
34 Sra BS 4. AOEAKAP ADE ae ‘
4 ; ae 3 AS Og 2
gt & % < ers 3 oe

% ® 2

i es * : , SRR aE

ABRUTLEDE oe, i

«ES.

Figure 1: Map of Termessos National Park

Acknowledgements

The authors thank Prof. Mark R. D. SEAWARD (England) and Dr. Harrie SIPMAN (Germany) for
suggestions and comments that improved the manuscript. The lichen species were collected during
the project “The comparison of the lichen floras of the Termessos National Park and Diizler¢ami
Region damaged in the July 1997 fire’, funded by Akdeniz University Scientific Research Projects
Unit (Project number 2002.02.0121.02). We are indebted to Akdeniz University Scientific Research
Projects Unit for financial support, to Prof. Dr Per. Magnus JORGENSEN (Norway), Prof. Dr Helmut
MAyRHOEER (Austaria), Prof. Dr Teuvo AuTI (Finland), Assoc. Prof. Dr Roland MoBerG (Sweden),
Dr Othmar Breuss (Austaria), Dr Orvo VITIKAINEN (Finland), Dr Brian Copprns (Edinburg),
Dr Volker JoHN (Germany) and Alan ORANGE (Britain) for their identification of lichens, and to
the Antalya Directorship of National Parks for granting permission for this study in Termessos
National Park.

Literature Cited

Aslan A. 2000. Lichens from the regions of Artvin, Erzurum, and Kars (Turkey). Israel Journal of
Plant Sciences 48: 143-155.

Breuss O. 1990. Die Flechtengattung Catapyrenium in Europa. Stapfia 23, 110 pp.

Breuss O. 1998. Catapyrenium und verwandte Gattungen (lichenisierte Ascomyceten,
Verrucariaceae) in Asien—eine erste Ubersicht. Annalen des Naturhistorischen Museum in
Wien, B, 100: 656-669.

Breuss O, John V. 2004. New and interesting records of lichens from Turkey. Osterreichische
Zeitschrif fiir Pilzkunde 13: 281-294.

Brummitt RK, Powell CE. 1992. Authors of plant names. Royal Botanical Gardens, Kew, 732 pp.

Clauzade G, Roux C. 1985. Likenoj de Okcidenta Eurupo. Bulletin de la Societé Botanique du
Centre-Ouest, Nouvelle série, 893 pp.

Cicek A, Ozdemir Tiirk A..1998. Lichen flora of Sakarya province (Turkey). Doga-Turkish Journal
of Botany 22: 99-119.

Giordani P, Nicora P, Rellini I, Brunialti G, Elix JA. 2002,. The lichen genus Xanthoparmelia
(Ascomycotina, Parmeliaceae) in Italy. Lichenologist 34 (3): 189-198.

Giivenc $, Aslan A, Oztiirk $. 1996. The lichen flora of Kapidag Peninsula.- In: Oztiirk, M. A.,
Secmen, O. & Gérk, G. (eds.) Plant life in southwest and central Asia. Proceedings of the 4
th plant life in southwest Asia symposium held in Izmir 21 - 28 may 1995, Ege Univ. Press,
Bornova-Izmir, pp. 472-478.

John V. 1996. Preliminary catalogue of lichenized and lichenicolous fungi of Mediterranean Turkey.
Bocconea 6: 173-216.

John V. 2003. Flechten aus der Tiirkei, von G. Ernst gesammelt. Herzogia 16: 167-171.

John V, Nimis PL. 1998. Lichen flora of Amanos mountain and the province of Hatay. Doga-Turkish
Journal of Botany 22: 257-267.

John V, Seaward MRD, Beatty JW. 2000. A neglected lichen collection from Turkey: Berkhamsted
School expedition 1971. Doga-Turkish Journal of Botany 24: 239-248.

Jorgensen PM. 1997. Further notes on hairy Leptogium species. Symbolae Botanicae Upsalienses
32 (1): 113-130.

Moberg R. 1977. The lichen genus Physcia and allied genera in Fennoscandia. Symbolae Botanicae
Upsalienses 22: 1-108.

Nimis PL, John V. 1998. A contribution to the lichen flora of Mediterranean Turkey. Cryptogamie, -
Bryologie et Lichénologie 19: 35-58.

Ozdemir Tiirk A, Giiner H. 1998, Lichens of the Thrace region of Turkey. Doga-Turkish Journal of
Botany 22: 397-407.

Oztiirk $, Gitveng $. 2003. Lichens from the western part of the Black Sea Region of Turkey. Acta
Botanica Hungarica 45: 169-182.

Pisut, I. 1970. Interessante Flechtenfunde aus der Tiirkei. Preslia (Praha) 42: 379-383.

Purvis OW, Coppins BJ, Hawksworth DL, James PW, Moore DM. 1992. The lichen flora of Great
Britain and Ireland. Edmundsbury Press, London, 719 pp.

Wirth V. 1995. Die Flechten Baden—Wirttembergs. Teil: 1-2, Eugen GmbH & Co., Stuttgart, 1006
pp.Zeybek U., John V, Lumbsch HT. 1993. Turkiye likenlerinden Hypogymnia (Nyl.) Nyl. cinsi
iizerinde taksonomik arastirma. Doga-Turkish Journal of Botany 17: 109-116.

Zeybek U, John V, Lumbsch HT. 1993. Tiirkiye likenlerinden Hypogymnia (Nyl.) Nyl. cinsi tizerinde
taksonomik arastirma. Doga-Turkish Journal of Botany 17: 109-116.

MYCOTAXON

Volume 94, pp. 47-50 October-December 2005

Two new species of Anthracoidea (Ustilaginales)
from China

LIN Guo

guol@sun.im.ac.cn
Key Laboratory of Systematic Mycology e& Lichenology
Institute of Microbiology, Chinese Academy of Sciences
Beijing 100080, China

Abstract—Two new species, Anthracoidea setosae on Carex setosa and A. xizangensis on
Kobresia duthiei, are described and compared with A. misandrae and related species.

Key words—smut fungi, Ustilaginomycetes, taxonomy

A new species of Anthracoidea on Carex setosa (Subgen. Carex, Sec. Frigidae) was
discovered from our herbarium (HMAS 67908, 34929, 34930). These specimens
were wrongly identified by the author (Guo 1994) as A. misandrae. The new species
of Anthracoidea is similar to A. misandrae and A. sempervirentis Vanky on host plants
in the same section of Carex in having ustilospores of the same size. It differs mainly
from A. misandrae by ustilospores with minute warts measuring 0.125-0.3 um in
diam., while A. misandrae has ustilospores with larger warts [(0.2-)0.4-0.8(-1) um in
diam. (Kukkonen 1963: 83)]. It differs mainly from A. sempervirentis by ustilospores
with regularly distributed warts as seen by SEM (scanning electron microscopy), while
A. sempervirentis has ustilospores with a “surface by SEM partly with sparse, 0.1-0.2
um high knobs, partly with abundant and dense, up to 0.5 um high, irregular, often
confluent, rounded warts.” (Vanky 1979: 226). The new species is described as:

Anthracoidea setosae L. Guo, sp. nov. Figs. 1-2

Sori in ovariis, subglobosi vel ovoidei, 1.2-2 mm longi, 1-1.8 mm lati, primum membrana
cinerascenti, fungali cooperti, deinde expositi. Massa sporarum nigra, semiagglutinata.
Ustilosporae a fronte globosae, ellipsoideae, leviter irregulares vel irregulares, 17.5-25(-27)

x 12.5-20 um, ab acie 10-15 um latae, flavidobrunneae vel atrobrunneae; pariete
aequaliter vel inaequaliter incrassato, 1-2.5(-3) wm crasso, tumores interni desunt, regiones
lucem repercutientes desunt, superficie minute et dense verruculoso sub SEM.

Sori in ovaries, subglobose or ovoid, 1.2-2 mm long and 1-1.8 mm wide, at first
covered by a grayish, fungal membrane, later becoming exposed. Spore mass black,
_ semi-agglutinated. Ustilospores in plane view globose, ellipsoidal, slightly irregular or
irregular, 17.5-25(-27) x 12.5-20 um, in side view 10-15 um wide, yellowish-brown or
blackish-brown; wall evenly or unevenly thickened, 1-2.5(-3) um, no internal swellings,
no light reflective areas, surface minutely and densely verruculose as seen by SEM.

On Carex setosa Boott (Cyperaceae, Subgen. Carex, Sect. Frigidae), Gansu: Zhouqu,
Shatanlinchang, alt. 3050 m, 4 IX 1992, L. Guo 1276, HMAS 67908 (holotypus hic

designatus); Sichuan: Emei Shan, Leidongping, alt. 2500 m, 10 VII 1969, C. M. Wang, Y.
X. Han & Q. M. Ma 314, HMAS 34930 (paratypus); Emei Shan, Jindingsi, alt. 3150 m, 9
VII 1969, C. M. Wang, Y. X. Han & Q. M. Ma 296, HMAS 34929 (paratypus).

Etymology: Refers to the host plant Carex setosa.

Anthracoidea misandrae was discovered in the Herbarium of the Institute of Botany,
Chinese Academy of Sciences (PE) and collected by Prof. Kuan Kechien from Xinjiang
Uygur Autonomous Region in 1957. It is described as:

Anthracoidea misandrae Kukkonen, Ann. Bot. Soc. Zool.-Bot. Fenn. ,Vanamo*
34(3): 82, 1963. ve

Sori in ovaries, ellipsoidal, 2.5-3.5 mm long and 1.5-2.5 mm wide, at first covered by a
grayish, fungal membrane, later becoming exposed. Spore mass black, semi-agglutinated.
Ustilospores in plane view subglobose, ellipsoidal or ovoid, 17.5-25(-26) x 15-20(-22)
um, in side view 10-14 um wide, dark reddish-brown; wall evenly thickened, ca. 1 um,
no internal swellings, no light reflective areas, surface verrucose.

On Carex stenocarpa Turcz. ex V. Krecz. (Cyperaceae, Subgen. Carex, Sect. Frigidae),
Xinjiang: Nilka Xian, 60 Km N of Wulasitai (in the Borohoro Mountains) 31 VIII 1957,
K. C. Kuan 3991, HMAS 132710.

Another new species of Anthracoidea on Kobresia duthiei (Sec. Elyna) was discovered
from our herbarium (HMAS 67973) and collected by Prof. Zhuang Jianyun in 1990.
The specimen was wrongly identified by the author as A. filifoliae L. Guo (1995-1996)
on the section Kobresia. The new species differs from A. filifoliae by minute warts on
the surface of the ustilospore as seen by SEM and host plants in different sections of the
genus Kobresia, while A. filifoliae has dense and minute warts between the larger warts
on the surface of the ustilospores. Only A. elynae (Syd.) Kukkonen (1963: 65) has been
recorded previously on the section Elyna. The new species differs from A. elynae by
having warts on the surface of the ustilospores, while the surface of the ustilospores of
A. elynae is smooth. The new species is described as:

Anthracoidea xizangensis L. Guo, sp. nov. | Figs. 5-6

Sori in ovariis, ellipsoidei vel ovoidei, 1-2 mm longi, 0.7-1 mm lati, primum membrana
cinerascenti, fungali cooperti, deinde expositi. Massa sporarum nigra, semiagglutinata.
Ustilosporae a fronte globosae, ellipsoideae vel ovoideae 17-22.5 x 15-18 wm, ab acie 10-15
um latae, atrobrunneae; pariete aequaliter incrassato, 1.5-2 um crasso, tumores interni
desunt, regions lucem repercutientes desunt, superficie minute et dense verruculoso sub
SEM.

Sori in ovaries, ellipsoidal or ovoid, 1-2 mm long and 0.7-1 mm wide, at first covered
by a grayish, fungal membrane, later becoming exposed. Spore mass black, semi-

Figs. 1-2. Ustilospores of Anthracoidea setosae on Carex setosa as seen by LM (light microscopy)
and SEM (HMAS 67908, holotypus).

Figs. 3-4. Ustilospores of Anthracoidea misandrae on Carex stenocarpa as seen by LM and SEM
(HMAS 132710).

Figs. 5-6. Ustilospores of Anthracoidea xizangensis on Kobresia duthiei as seen by LM and SEM
(HMAS 67973, holotypus). Bars = 10 um

agglutinated. Ustilospores in plane view globose, ellipsoidal, or ovoid, 17-22.5 x 15-18
um, in side view 10-15 um wide, blackish-brown; wall evenly thickened, 1.5-2 um, no
internal swellings, no light reflective areas, surface minutely and densely verruculose as
seen by SEM.

On Kobresia duthiei C. B. Clarke (Cyperaceae, Sect. Elyna), Xizang: Dinggye, Yala Shan,
alt. 4950 m, 15 VIII 1990, J. Y. Zhuang 2919, HMAS 67973 (holotypus hic designatus).

Etymology: Refers to the locality Xizang Autonomous Region (Tibet).

Since 2000 (Guo 2000), eight new species and three new records of the genus Anthracoidea
have been recorded in China (Guo 2002, 2004, Guo & Wang 2005, Guo & Zhang 2004,
Wang & Piepenbring 2002, Zhang & Guo 2004), including A. setosae and A. xizangensis
(in this paper).

Acknowledgements

The author would like to express her deep thanks to Drs. Vanky and Chlebicki for reading the
manuscript and serving as pre-submission reviewers, to Dr. Pennycook for nomenclature review,
to Profs. Liang Songjun and Zhang Shuren (Institute of Botany, Chinese Academy of Sciences)
for identifying the host plants, and to Mrs. Xie Jiayi for assistance with SEM photographs. ‘This
study was supported by the National Natural Science Foundation of China (No. 30230020 and No.
30270016).

Literature Cited

Guo L. 1994. Anthracoidea and allied genera in China (Ustilaginales). Mycosystema 7: 89-104.

Guo L. 1995-1996. Anthracoidea filifoliae sp. nov. and four smut species new to China. Mycosystema
8-9: 163-168.

Guo L. 2000. Flora Fungorum Sinicorum, Ustilaginaceae Vol. 12, Science Press, Beijing (China).
124 pp.

Guo L. 2002. Two new species of Ustilaginomycetes and a species new to China. Mycotaxon 82:
147-150.

Guo L. 2004. Anthracoidea shaanxiensis sp. nov. (Ustilaginales) from China. Nova Hedwigia 79:
507-509.

Guo L, Wang SR. 2005. A new species and a new record of Anthracoidea (Ustilaginales) from China.
Mycotaxon 93: 159-162.

Guo L, Zhang HC. 2004. A new species and two new records of Ustilaginomycetes from China.
Mycotaxon 90: 387-390.

Kukkonen I. 1963. Taxonomic studies on the genus Anthracoidea (Ustilaginales). Ann. Bot. Soc.
Zool.-Bot. Fenn. “Vanamo” 34(3): 1-122.

Vanky K. 1979. Species concept in Anthracoidea (Ustilaginales) and some new species. Bot. Not.
U32: 221-23

Wang SR, Piepenbring M. 2002. New species and new records of smut fungi from China. Mycol.
Progr. 1: 399-408.

Zhang HC, Guo L. 2004. Two new species and a new record of Anthracoidea (Ustilaginales) from
China. Mycotaxon 89: 307-310. j

MYCOTAXON

Volume 94, pp. 51-54 October-December 2005

A new species of Lepiota (Agaricaceae, Basidiomycetes)
from China

HAN-CHEN WANG

higherfungi2005@yahoo.com.cn
Kunming Institute of Botany, Chinese Academy of Sciences
Kunming 650204, Yunnan Province, P. R. China
Institute of Applied Ecology, Chinese Academy of Sciences
Shenyang 110016, Liaoning Province, P. R. China
Graduate School of the Chinese Academy of Sciences, P. R. China

ZHU-LIANG YANG*

fungi@mail.kib.ac.cn
Kunming Institute of Botany, Chinese Academy of Sciences
Kunming 650204, Yunnan Province, P. R. China

Abstract—A new species, Lepiota catenariocystidiata, is described and illustrated. It is
compared with similar species.

Key words—Agaricales, taxonomy

Introduction

During our study of lepiotaceous fungi, we came across an undescribed species of the
genus Lepiota (Pers.: Fr.) Gray. It is described and illustrated herein. In descriptions
of the basidiomata, color designations (e.g., 1A1) are from Kornerup & Wanscher
(1981), and color names with first letters capitalized (e.g., Pale Smoke Gray) are from
Ridgway (1912). In descriptions of basidiospores, the notation [n/m/p] shall mean n
basidiospores measured from m basidiomata of p collections in Melzer’s reagent. Q is
used to mean quotient of length and width of a spore in side view; Q means average Q of
all basidiospores + sample standard deviation. Herbarium code HKAS = Herbarium of
Cryptogams, Kunming Institute of Botany, Chinese Academy of Sciences.

Taxonomy

_ Lepiota catenariocystidiata Han C. Wang & Zhu L. Yang, sp. nov. Figs. 1-4

Pileus 3-5 cm latus, initio subcampanulatus, deinde convexus vel applanatus, albidus vel
griseolus, squamulis tomentosis, griseis vel obscure griseis. Lamellae liberae, albidae vel
cremeae. Stipes 4-6 x 0.3-0.6 cm, subcylindricus, albidus, annulatus, squamulis confertis,

* Corresponding author

tomentosis, griseis infra annulum. Annulus superus, membranaceus. Basidiosporae
(7.0) 7.5-9.0 (10.0) x (3.5) 4.0-4.5 (5.0) um, oblongae vel subcylindricae, incoloratae,
hyalinae, dextrinoideae. Basidia 20-30 x 7.5-10 um, subclavata, 4-sporigera, raro 2-
sporigera. Pleurocystidia nulla. Cheilocystidia 10-20 x 8-12 um, subglobosa, ovata vel
breviclavata, catenaria, incolorata. Squamulae pilei ex hyphis subcylindricis terminalibus
compositae. Fibulae praesentes.

Holotype: CHINA, Yunnan Prov., Mengla County, Menglun, 2. XI. 1989, Z.L. Yang 918
(HKAS 22145).

Etymology: Named because of the cheilocystidia often in chains.

Basidiomata (Fig. 1) scattered. Pileus 3-5 cm in diam, at first subcampanulate, then
convex to applanate, with an obtuse umbo or non-umbonate; pileal surface dry, whitish
to grayish (1A1-1B1; Pale Smoke Gray) but with pinkish tinge (11A2-11B2; Light
Brownish Drab) at center, densely covered with minute, dark gray (11C1 + 11D1 +
11E1; Dark Neutral Gray to Blackish Slate) tomentose squamules over disc, with small,
concentrically arranged, grey to dark grey squamules towards the margin, margin
often slightly exceeding lamellae. Lamellae free, whitish to cream-coloured, moderately
crowded, in 2-3 ranks, up to 0.7 cm broad, with white to concolorous eroded edge. Stipe
4-6 x 0.3-0.6 cm, central, subcylindrical, hollow, slightly enlarged near base, surface
whitish, lower part covered with grey (11C1 + 11D1; Dark Neutral Gray to Hair Brown)
tomentose squamules often in belts. Annulus superior, membranous, upper surface
white and glabrous, lower surface covered with grey tomentose squamules, persistent or
fugacious. Context whitish, unchanging; odor indistinct; taste slightly hot.

Basidiospores (Fig. 2) [42/2/2] (7.0) 7.5-9.0 (10.0) x (3.5) 4.0-4.5 (5.0) um [Q = (1.67)
1.75-2.25, Q=2.01 + 0.18], oblong to subcylindrical, with a distinct suprahilar depression
in side view, water-drop-shaped in front view, broader at apical part, attenuate towards
the base, slightly thick-walled, colorless, hyaline, dextrinoid, reddish in Congo Red, not
metachromatic in Cresyl Blue. Basidia 20-30 x 7.5-10 um, subclavate, hyaline, thin-
walled, 4-spored, rarely 2-spored. Pleurocystidia absent. Cheilocystidia (Fig. 3) abundant,
10-20 x 8-12 um, subglobose, ovoid to short clavate, often in chains, colorless and hyaline.
Squamules (Fig. 4) on pileus a disrupted trichodermium consisting of loose fascicles of
long, more or less erect, subcylindrical, terminal elements (45-300 x 10-17 um) with.
tapering or round apex and pale yellow-brown to dark yellow-brown intracellular
pigments; with short clavate cells at the base of these long elements; the repent hyphae
at the base of erect elements sometimes with incrusting pigments. Squamules on surface
of stipe similar to those on pileus. Clamp connections abundant in basidiomata.

Habitat: On well-rotten wood with soil in limestone monsoon forests; fruiting in
summer and autumn in southwestern China at 600-700 m elev.

Known distribution: Known from tropical Yunnan only.

Additional material examined: CHINA, Yunnan Prov., Mengla County, Menglun
Nature Reserve, 22. X. 1988, Zang 11515 (HKAS 20358).

Notes: Lepiota catenariocystidiata is well characterized by its whitish to grayish pileus
with a pinkish center, gray to dark gray squamules on the pileus made up of a disrupted
trichodermium with long subcylindrical terminal elements and short clavate cells at the
base of these long elements, water-drop-shaped basidiospores in front view, catenulate
cheilocystidia and the common presence of clamp connections in the basidiomata.

Figs. 1-4. Lepiota catenariocystidiata (from holotype)
1. Basidiomata. 2. Basidiospores. 3. Cheilocystidia. 4. Squamules on pileus

Due to the trichodermium type of the squamules on the pileus and the oblong to
subcylindrical basidiospores, L. catenariocystidiata may belong to Lepiota sect. Ovisporae
(J.E. Lange) Kuhner. Species with pileal squamules made up of long, erect elements and
short, clavate elements in between were put in the subsect. Felininae Bon within sect.
Ovisporae (Vellinga 2001). Because L. catenariocystidiata has short, clavate elements at
the base of long, erect ones, it should be placed in the subsection. However, according to
recent molecular phylogenetic studies, the ITS data set does not support sect. Ovisporae,
and thus a re-evaluation of this section is needed (Vellinga 2003). The present species
may be clustered within the Clade 1 of Lepiota s. |. (Vellinga 2003).

Lepiota catenariocystidiata may be related to L. felina (Pers.) P. Karst., L. pseudolilacea
Huijsman and L. pseudohelveola Kiihner ex Hora. However, the latter two species have
differently coloured basidiomata, ellipsoid to oblong basidiospores in front view and
rarely with a suprahilar depression in side view, and differently shaped cheilocystidia
(Kithner 1936; Huijsman 1947; Hora 1960; Enderle & Krieglsteiner 1989; Bon 1981,
1996; Candusso & Lanzoni 1990). According to Vellinga (2001), L. pseudohelveola
should be regarded as a synonym of L. pseudolilacea. Lepiota felina differs from L.
catenariocystidiata in the colour of the basidiomata, the shape of the cheilocystidia and

basidiospores (Kithner 1936; Huijsman 1947; Hora 1960; Bon 1981, 1996; Enderle &
Krieglsteiner 1989; Candusso & Lanzoni 1990; Vellinga 2001).

The basidiospores of L. catenariocystidiata are very similar to those of L. plumbicolor
(Berk. & Broome) Sacc., originally described from Sri Lanka. However, the latter has
blackish purple squamules on pileus with elongate clavate terminal elements with an
obtusely rounded apex and clavate-cylindrical cheilocystidia (Pegler 1972, 1986).

Acknowledgements

Weare very grateful to Dr. E.C. Vellinga for having sent us her valuable publications on Agaricaceae,
and to Drs. E.C. Vellinga and D.E. Desjardin for their critical reviewing the manuscript. This project
was financed by the Natural Science Foundation of Chinas Yunnan Province (No. 2002C0059M)
and the National Natural Science Foundation of China (No. 30270017).

Literature cited

Bon M. 1981. Clé monographique des “Lépiotes” d'Europe (= Agaricaceae, Tribus Lepioteae et
Leucocoprineae). Doc. Mycol. 11 (43): pl-p77.

Bon M. 1996. Die Grofpilzflora von Europa 3. Lepiotaceae (iibersetzt und bearbeitet von F.
Medjebeur-Thrun & W. U. Thrun). IHW- Verlag: Eching (Germany). 141 pp.

Candusso M, Lanzoni G. 1990. Lepiota s. |. Fungi Europaei 4. Giovanna Biella: Saronno (Italy).
743pp.

Enderle M, Krieglsteiner GJ. 1989. Die Gattung Lepiota (Pers.) S. EF Gray emend. Pat. in der
Bundesrepublik Deutschland (Mitteleuropa). Z. Mykol. 55: p43-p104.

Hora FB. 1960. New check list of British Agarics and Boleti. Transactions British Mycol. Soc. 43:
p440-p459.

Huijsman HSC. (1947). Lepiota pseudolilacea nov. spec. Bull. Soc. Linn. Lyon 16: p180-p183.

Kornerup A, Wanscher JH. 1981. Taschenlexikon der Farben. 3. Aufl. Muster-Schmidt Verlag:
Zurich (Switzerland). 242pp.

Kiihner MR. 1936. Recherches sur le genre Lepiota. Bull. Soc. Mycol. France 52: p175-p238.

Pegler DN. 1972. A revision of the genus Lepiota from Ceylon. Kew Bull. 27: p155-p202.

Pegler DN. 1986. Agaric Flora of Sri Lanka. Kew Bull. Add. Ser. 12: p1-p519.

Ridgway R. 1912. Color Standards and Color Nomenclature. R. Ridgway, Washington, D.C. (USA).
43pp.

Vellinga EC. 2001. Lepiota (Pers. : Fr.) S. FE Gray. In: Flora Agaricina Neerlandica 5 (eds. M.E.
Noordeloos, Th.W. Kuyper and E.C. Vellinga). A. A. Balkema Publishers, Holland: p109-p151.

Vellinga EC. 2003. Phylogeny of Lepiota (Agaricaeae) - Evidence from nrITS and nrLSU sequences.
Mycol. Progr. 2: p305-p322.

MYCOTAXON

Volume 94, pp. 55-73 October-December 2005

ITS sequence analysis and ascomatal development of
Pseudogymnoascus roseus

Y. JIANG & Y. -J. YAo*

yaoyj@sun.im.ac.cn
Systematic Mycology and Lichenology Laboratory, Institute of Microbiology
Chinese Academy of Sciences, Beijing 100080, China

Abstract—ITS sequence analysis and ascomatal development of Pseudogymnoascus
roseus strains isolated from sclerotia of Cordyceps sinensis collected from the Tibetan
Plateau, China, are reported in this paper. The ITS sequences of three strains from
different locations were identical and were compared with sequences obtained from the
BLAST search in GenBank. The strains display the same morphology as the reference
collection deposited in K, matching the species description of P roseus. Ascomatal
development of the P roseus strains is described. Ascomata of P. roseus were found to
comprise an aggregation of asci from several different ascomatal initials enveloped by
a loose, thick-walled hyphal network. In the parsimony analysis, ITS sequences of P.
roseus and other Myxotrichaceae grouped outside the Onygenales and clustered with
those of discoid fungi. Members of Myxotrichaceae were considered closely related to
discomycetes, but greatly diverged from onygenalean fungi. Myxotrichaceae did not
form a monophyletic group in the ITS tree.

Key words—DNA, fungal culture, taxonomy

Introduction

Pseudogymnoascus Raillo, a genus of Ascomycetes established with two species
in 1929, has been referred to either Gymnoascaceae Baran. (e.g. Kuehn 1958, Arx
1971, Alexopoulos & Mims 1979, Orr 1979, Benny & Kimbrough 1980, Eriksson &
Hawksworth 1986, 1993) or to Onygenaceae Berk. (Arx 1987). However, it was placed
by Currah (1985) in Myxotrichaceae Locq. ex Currah, based on cellulose degradation
capacity, smooth ascospores and rhexolytically dehiscing conidia. The latter taxonomic
treatment has been widely accepted (Alexopoulos et al. 1996, Kirk et al. 2001). Species
of this genus have yellow or rose, globose to subglobose, discrete or confluent ascomata;
ascomatal peridium composed of a network of slightly thick-walled hyphae; appendages
simple and not distinct; asci globose to ellipsoid, normally 8-spored; ascospores ellipsoid
- to fusoid, smooth, hyaline, yellow, orange to pink (Cejp & Milko 1966, Orr 1979, Currah
1985).

In addition to the original two species of Pseudogymnoascus, P. roseus and P. vinaceus
Raillo, several more species have since been described, e.g. P. caucasicus Cejp & Milko,

* Author for correspondence

P. bhattii Samson, P. alpinus E. Mill. & Arx and P. dendroideus Locq.-Lin. However,
Samson (1972) considered P. roseus and P. vinaceus identical and lectotypified the genus
with P. roseus. Orr (1979) discussed the status of the genus and recognised two species, P.
vinaceus and P. roseus, listing P. bhattii as a synonym of P. vinaceus. In his monographic
study of Onygenales, Currah (1985) treated both P. vinaceus and P. bhattii as synonyms
of P. roseus. Although Samson's (1972) choice of P. roseus as the type species has been
followed by others (Arx 1974, 1981, 1987, Currah 1985, Sigler et al. 2000), the genus was
also typified by P. vinaceus early (Kuehn 1958, Orr 1979).

As more species of Pseudogymnoascus were described, the range of morphological
characters became more diverse. For example, P alpinus was described as having
navicular-fusoid ascospores, and ascomata with branched and recurved appendages
(Miller & Arx 1982); P. dendroideus with ramified ascomatal appendages and striated
ascospores (Locquin-Linard 1982); and P. roseus var. ornatus Udagawa & Uchiy. with
irregularly lobate-reticulate ascospores (Udagawa & Uchiyama 1999). Further, a weakly
cellulolytic species having fusoid ascospores with a longitudinal sigmoid crest was
assigned to the genus as Pseudogymnoascus sp. (Lumley et al. 2000).

Anamorphs of Pseudogymnoascus have been referred to Geomyces Traaen (Orr 1979,
Currah 1985). Geomyces pannorum var. vinaceus (Dal Vesco) Oorschot is considered as
the anamorph of P. roseus (Sigler & Carmichael 1976, Oorschot 1980).

Systematically, Myxotrichaceae was placed in the order Onygenales, along with
Arthrodermataceae Locq. ex Currah, Gymnoascaceae and Onygenaceae, by Currah
(1985). Species of Myxotrichaceae are saprobic, cellulose-degrading, and usually
inhabit forest soils and decay plant material. Members of Gymnoascaceae do not
exhibit strong substrate preferences, and are neither keratinolytic nor cellulolytic. The
Arthrodermataceae and the Onygenaceae degrade keratin and usually inhabit soils
enriched with keratin or dung. Currah (1994) further restricted the Onygenales to
keratinolytic genera and suggested that the Myxotrichaceae might represent a distinct
evolutionary line from typical members of Onygenales and derive from the inoperculate
discomycetes and that it merited a placement in its own order. The distant relationship
between the Myxotrichaceae and other members of Onygenales has been confirmed by
recent studies (Sugiyama et al. 1999, Mori et al. 2000, Kirk et al. 2001). :

Recently, molecular approaches have been introduced to the systematic study of
Myxotrichaceae and related fungi (Bowman & Taylor 1993, LeClerc et al. 1994, Hambleton
et al. 1998, Sugiyama et al. 1999, Sugiyama & Mikawa 2001). Some molecular evidence
indicates that Myxotrichaceae are distantly related to other members of Onygenales
(Sugiyama et al. 1999, Mori et al. 2000). Sugiyama et al. (1999) examined the molecular
systemtatics of onygenalean taxa (including P roseus and members of Amauroascaceae
Arx, Arthrodermataceae, Gymnoascaceae and Onygenaceae) based on 18S rDNA
sequences and suggested that the Myxotrichaceae should be placed in an independent
position among the Helotiales and the Erysiphales, on a different lineage from the
keratin-degrading fungi. Based on sequences of 18S rDNA and partial sequences of 28S
rDNA, Mori et al. (2000) demonstrated that the Myxotrichaceae was distantly related
to the other onygenalean families, as a sister group to the Erysiphales and that the
Erysiphales/Myxotrichaceae clade was also closely related to some discomycetous fungi,
e.g. Helotiales and Thelebolaceae (Brumm.) Eckblad. Pseudogymnoascus has also been
used as the outgroup in other molecular systematic studies, e.g. Hambleton et al. (1998)

and Sugiyama & Mikawa (2001). The molecular research has provided more evidence to
support the idea that the Myxotrichaceae is not closely related to onygenalean fungi.

Ascomatal development of Pseudogymnoascus has been described in some
taxonomic studies (Samson 1972, Locquin-Linard 1982, Miiller & Arx 1982, Tsuneda
1982, Ito & Yokoyama 1987). Samson (1972) described the ascomatal initials as
borne on the vegetative hyphae, consisting of coiled ascogonia and producing loose
wefts of ascogenous hyphae inside hyphal tufts, and illustrated the ascomatal initials
and the ascus formation. When describing the new species P. alpinus, Miller & Arx
(1982) indicated that ascomatal initials grew as aerial branches of vegetative hyphae,
loosely interwoven and sympodially branched once or twice. Locquin-Linard (1982)
provided three drawings to describe the different stages of ascomatal develolpment of
P. dendroideus. Tsuneda (1982) illustrated the development of ascomata in a scanning
electron microscopic study of P. roseus and Ito & Yokoyama (1987) provided a photograph
of the ascomatal initial but without description. The process of ascomatal development
in Pseudogymnoascus has not yet been described in detail.

Pseudogymnoascus roseus is a species of worldwide distribution frequently found
in soil, usually from alpine or forest areas (Christensen et al. 1962, Orr 1979, Ito &
Yokoyama 1985, 1987, Currah 1985, Yokoyama et al. 1989, Udagawa & Uchiyama 1999),
and occasionally on dung (Ellis & Ellis 1988). It has been also reported from tropical
regions (Farrow 1954, Siddiqi 1964, as P vinaceus). Pseudogymnoascus roseus was also
reported to form mycorrhizal associations with Vaccinium angustifolium Aiton in the
laboratory (Dalpé 1989), and typical ericoid mycorrhiza with salal (Gaultheria shallon
Pursh), and also to degrade cellulose and to use organic forms of nitrogen (Xiao & Berch
1995),

During fieldwork undertaken on the Tibetan Plateau for investigation of the Chinese
Caterpillar Fungus (Cordyceps sinensis, a well-known fungus used as a tonic in traditional
Chinese medicine), some other fungi were also isolated from sclerotia of the fungus.
Among them, three strains displayed different characters from those of C. sinensis
in culture. Sequences of internal transcribed spacers (ITS) in the nuclear ribosomal
DNA (nrDNA) were obtained for molecular systematic analysis and observations on
the cultures were made to elucidate the development of ascomata in these strains. The
taxonomic position of the strains was determined as P. roseus based on both molecular
data and morphological observation. The results are reported here to provide further
information on the biology of this fungus.

Materials and Methods

Fungal cultures

Fungal cultures used in this study were isolated from C. sinensis specimens, collected
from Xiaojin County, Sichuan Province, and Yulong Snow Mountain, Yunnan Province
- of China, on the southeast of the Tibetan Plateau. Soil and plant debris on the fresh
specimens were removed and the surface of the specimens was sterilised with 70%
ethanol before isolation. The exoskeleton of the host larva was peeled off by using a
scalpel and small pieces of the inner tissue of sclerotium of C. sinensis were transferred
to fresh slopes of bran agar-peptone medium (potato dextrose agar (PDA) supplemented
with 5 % wheat bran and 0.5 % peptone). A few pieces of the exoskeleton were also used

as inocula for comparison. Pure cultures were obtained by sub-culturing hyphal tips
of primary isolates. Living cultures were maintained at the Institute of Microbiology,
Chinese Academy of Sciences, and dried voucher specimens are deposited in HAMS
(Chinese Academy of Sciences, Beijing, China) and K (Royal Botanic Gardens, Kew,
UK). The details of strains used in this study are listed in Table 1. The cultures were kept
at 4 °C for 3-16 weeks for morphological observation and molecular experiments.

DNA extraction

Samples of fresh mycelium were obtained by scraping the culture from the surface of the
nutrient slopes after 6 weeks of incubation. DNA extraction was carried out following a
modification of Yao et al. (1999). About 0.1 g of fresh mycelium (including some agar)
was ground into powder in liquid nitrogen and transferred to a 1.5 ml tube. The lysis
buffer of 600 ul 2% CTAB was added, followed by incubation in a water bath at 65 °C for
1h or more. An equal volume of phenol/chloroform/isoamylol (25:24:1) was added and
mixed, then centrifuged at 13000 rpm for 10 min. The supernatant was transferred to a
fresh 1.5 ml tube, followed by extraction of the chloroform/isoamylol alcohol (24:1). After
centrifugation, the supernatant was transferred to a fresh tube and 250 ul isopropanol
was added to precipitate the DNA at —20 °C for 4 h or overnight. The precipitate was
centrifuged at 13000 rpm for 10 min, then the liquid was drained off and the tube dried
at room temperature for more than 2 h. The DNA preparation was resuspended in 40
ul of sterile deionised water. The crude extracts containing unquantified DNA amounts
were used as templates for PCR amplification. Dilution of these extracts 2-10 times was
sometimes required for successful DNA amplification.

PCR amplification and sequencing

The entire ITS region of nrDNA, including ITS1, ITS2 and 5.88 gene, was amplified
by polymerase chain reaction (PCR) utilizing the ITS5/4 primers (White et al. 1990).
The amplification was performed in 25 ul volumes of reaction mixture containing: 10
mM Tris/HCl (pH 8.3), 2.5mM MgCl, 0.2 mM of each of the four deoxyribonucleotide
triphosphates, 0.4 uM of each of the two primers, 24 U ml' Taq polymerase (Sino-
American Biotechnology Co.), 1 ul of DNA template (some of them were diluted from.
the crude DNA extracts). The PCR was performed with an initial denaturation of 97 °C
for 2.5 min and 35 cycles of 97 °C for 30 sec, 50 °C for 1 min, 72 °C for 1.5 min and final
72 °C for 10 min.

Products were purified using Watson's PCR Purification Kit (Watson Ltd). Sequencing
was performed by the cyclic reaction termination method using fluorescently labelled
dideoxyribonucleotide triphosphates, according to the manufacturer’s protocols on the
Geneamp PCR System 2400 or 9700 (Perkin-Elmer). The sequencing products were
purified by ethanol precipitation according to the sequencing kit protocol (ABI Prism®
BigDye™ Terminator Cycle Sequencing Ready Reaction Kit, Original and Version 2.0,
ABI). Sequencing was performed on an ABI Prism® 3100 Genetic Analyzer (Applera
Corporation) and data collected on a Dell computer with the DNA Sequencing Analysis
programme (ABI Prism®’DNA Sequencing Analysis Software™, Version 3.7). Each
fragment was sequenced in both directions for confirmation and the two strands of
sequences were assembled with Seqscape programme (ABI Prism’ SeqScape Software™,
Version 1.1).

Table 1. Test strains of Pseudogymnoascus roseus and Cordyceps sinensis used in this

study.
GenBank
eee Fungus Location | Elev. Colt Voucher | Access.
ca date 4

Xiaojin Sclerotium 8
Pseudogymnoascus HMAS
: County, 3700m of Cordyceps June, AY608923
roseus Raillo ‘ 79435
Sichuan sinensis 2000
ee Yulong Snow Exoskeleton of 31 are
seudogymnoascus
8y Mountain, 4060m C. sinensis host May, AY608924
roseus 79436
Yunnan larva 2001
Yulong Snow : 31 aS
Pseudogymnoascus ‘ Sclerotium of C. . 79438
rors! Mountain, 4060m ; é May, K(M AY608922
Yunnan giiasier 2001 (M)
108601
oes pe Sclerotium of C. oh HMAS
Mountain, 3 , May, 79439 AY608925
Yunnan eshte 2001

DNA sequence analysis and molecular identification of the strains

ITS sequences obtained from this study were compared with existing sequences in
GenBank by BLAST database search (Altschul et al. 1997). Additional ITS sequences
from Myxotrichaceae (Myxotrichum arcticum) and from families in the Onygenales
(including Gymnoascus Baran. of Gymnoascaceae, Ajellomyces McDonough & A. L.
Lewis of Onygenaceae, Amauroascus J. Schrot. of Onygenaceae and Arthroderma Curr.
of Arthrodermataceae), two representatives of pyrenomycetes, Neurospora crassa Shear
& B. O. Dodge and Erysiphe cichoracearum, and two species of basidiomycetes were also
retrieved from GenBank. One of the C. sinensis strains among the isolates obtained from
this study was also included for ITS sequence analysis. All the sequences from GenBank
are listed in Table 2. Sequences were initially aligned with BioEdit 5.0.6 (Hall 1999)
and analysed in PAUP 4.0b10 for Macintosh (Swofford 2001). Extra bases of the ITS
fragment in several sequences from Genbank were edited. The alignment was further
manually adjusted to reduce some obvious mismatch of sequences created by computer
alignment.

A total of 29 sequences was included in the analysis and a data matrix containing 761
base pairs of nucleotides was established. A few dozen bases at both ends were excluded
from the analysis owing to uncertainty in determining the sequence. Heuristic searches
(Swofford & Olsen 1990, Maddison 1991), including TBR (tree bisection-reconnection)
swapping for 1000 replicates of random taxon addition using equal weights were used
to explore the set of possible trees from many starting points. Ten trees were saved
at each replicate. Nucleotide substitutions were treated as unordered and alignment
gaps as missing. Relative supports were assessed by bootstrapping (Felsenstein 1985)
using equally weighted characters for 1000 replicates. The tree was rooted with the two
basidiomycetes, Agaricus bisporus and Ustilago maydis.

Isolation
source

Cordyceps sinensis
(Berk.) Sacc.

Table 2. ITS sequences from GenBank used for sequence analysis.

Fungus

Taxonomic position

Accession #

Ajellomyces capsulatus Se
_ McGinnis & Katz ©

Arthroderma persicolor (Stockdale)
Weitzman et al.
Bisporella citrina (Batsch) Korf & S.E.
_Carp.

oe viburni aay Groves

Erysiphe cichoracearum DC.

Otani
Geomyces asperulatus Sigler & J. W.
Carmich.
Geomyces pannorum (Link) Sigler & J Ww.
_ Carmich. _

Geomyces pannorum

_ Carmich. var. pannorum co
Gymnostellatospora japonica Udagawa et al.

Gymnoascus petalosporus (G. FE Orr et al. )
Gymnoascus punctatus (B. G. Dutta & G.
oR, Ghosh) Arx.

Neofabraea malicorticis H. S. Jacks.
_ Neurospora tetrasperma Shear & B. O.
Dodge
Pezicula ocellata (Pers.) Seaver
Pseudogymnoascus roseus

Pseudogymnoascus roseus

Scleromitrula spiraeicola (Dennis) er
Schumach. & Holst-Jensen

Sclerotinia trifoliorum Erikss.

Ustilago maydis (DC.) Corda

Agaricus bisporus (J. E. Lange) Imbach

Amauroascus mutatus (Quél.) Rammeloo

ae deformans Oita DNS

Gelatinipulvinella astraeicola Hosoya KY.

Myxotrichum arcticum Udagawa et al.

Arthrodermataceae;

_ Geomyces pannorum (Link) Sigler & J.W. |.

Dermateaceae; Helotiales

Agaricaceae; Agaricales
Onygenaceae; Onygenales
Onygenaceae; Onygenales
Onygenales

Helotiaceae; Helotiales

Dermateaceae; Helotials

ROM Rhytismatales |

Erysiphaceae; Erysiphales |

Helotiaceae; Helotiales
nae as
Anamorph
Anamorph
Myxotrichaceae

Gymnoascaceae; Onygenales

DU ie Sages

JSR,
Dcainaiccceee OES

Sordariaceae; Sordariales

Myxotrichaceae
Myxotrichaceae
LOOM SELE Helotiales

SAL Loess oa

AF465404

AF038353

AJ271565

AJ000614

AF335454

AF141163

AF203469
AF011295

U72611

AJ390390

AJ509872

AF015789

AF307760

AF062818

AJ315829

AJ315825

AF062810

AF141189

AF388929
AF141199
ye
Neier

Z81448

Z99676

Ustilaginaceae; Ustilaginales AF038826
ee tes g see orl

Morphological observation

The cultivated strains were examined frequently over 12 weeks to observe the growth of
the colony. When ascomata were visible, daily observation was carried out to distinguish
the different stages of ascomatal development. For ascomatal initial stages, minute
tufts of hyphae were removed and placed in a drop of water on a slide for microscopic
observation. For later ascomatal development stages, the ascomata were removed under
the dissecting microscope and sectioned by using a freezing microtome or dissected on
the slide to spread the asci and ascospores. Most preparations were mounted in water and
observed immediately under the microscope. Some of the slides were stained with cotton
blue in lactic acid to preserve the structure for later observation and photographing.

Results
Molecular analysis

The complete sequences of the ITS region of the strains CS20, CS22, CS6-61 and CS18
were 521-543 bp long. The ITS sequences from CS20, CS22 and CS6-61 were identical
and different from that of CS18, which was identified as C. sinensis. The sequences have
been submitted to GenBank with accession numbers from AY608922 to AY608925.

The sequences obtained from the BLAST search could be divided into several groups
based on the taxonomic position of the fungi. They were named Pesudogymnoascus and
its related fungi, including P. roseus, Geomyces, Gymnostellatospora Udagawa et al. and
Chrysosporium Corda. The majority of the sequences were of discomycetes, including
Helotiales and Rhytismatales, and of other ascomycetes, including Dothideales and
Erysiphales. The sequences selected for analysis represented the major groups found in
the BLAST search. To clarify the systematic relationship of CS20, CS22 and CS6-61
with Onygenales species, sequences of Gymnoascus, Myxotrichum Kunze, Amauroascus,
Arthroderma and Ajellomyces were included in the analysis.

A total of 675 bp of the ITS regions was used in the analyses. Among the nucleotides,
185 were constant. Of the remaining variable bases, 329 were potentially parsimony
informative. Ten most parsimonious trees were obtained with this alignment. One of them
is shown in Fig. 1. The sequences formed four groups marked as pseudogymnoascean,
discomycetous, pyrenomycetous and onygenalean according to the species within
each group. The other nine trees differed from Fig. 1 in the positions of AF081431-
Pseudogymnoascus roseus and AF062818-Gymnostellatospora japonica within the
pseudogymnoascean group; the position of AF203469-Elytroderma deformans being
a sister group to both the pseudogymnoascean group and the major clade of the
discomycetous group in some other trees; and the positions of AF335454-Bisporella
citrina and U72611-Gelatinipulvinella astraeicola (as ‘astraoeca’ in Genbank) within the
discomycetous group. |
_ The pseudogymnoascean group comprised sequences of P. roseus, Geomyces and
Gymnostellatospora and was supported by bootstrap analysis at 88% (Fig. 1). The
sequences of CS20, CS22, CS6-61 and of AF062819, named P. roseus in GenBank, were
identical. AF081431-P. roseus is an incomplete ITS sequence containing only ITS2 and
partial 5.8S gene, almost identical to the same part of ITS sequences of AF062819-P
roseus, CS20, CS22 and CS6-61. Although it was shown with no change from others

of these sequences in Fig. 1, it was sometimes placed as a sister group to AF062819-
P. roseus, CS20, CS22 and CS6-61 in the other parsimony trees. The grouping of
these sequences in a terminal clade received 92% bootstrap support. Sequences of
AJ509872 and AF015789, both named as Geomyces pannorum in Genbank, grouped
together with 83% bootstrap support. They formed a clade with the P. roseus sequences
having bootstrap support of 74%. The other two sequences of Geomyces, AF307760-G.
pannorum and AJ390390-G. asperulatus, are almost identical with only two nucleotide
substitutions. The two sequences clustered with AF062818-Gymnostellatospora japonica
having 69% support in Fig. 1, but the latter was grouped with the P. roseus and Geomyces
pannorum clade in some other trees. Several records of named Geomyces pannorum in
GenBank (accession numbers from AJ509866 to AJ509871) have similar sequences to
AJ509872 and AF015789 and were represented by the latter two in this analysis.

Thediscomycetous group mainly contained Helotialesand Rhytismatales. Myxotrichum
arcticum (Myxotrichaceae) and Erysiphe cichoracearum (Erysiphaceae) were also included
in this group. The discomycetous group was the sister group to the pseudogymnoascean
group, but it was polyphyletic because one of the discomycetes, Elytroderma deformans,
was placed as an immediate sister group to the pseudogymnoascean group (Fig. 1). In
fact, the pseudogymnoascean group is imbedded within the discomycete taxa.

Neurospora tetrasperma (AF388929) and Cordyceps sinensis (CS18) were clustered
together to form the pyrenomycetous group, which was supported by 100% in bootstrap
analysis. The pyrenomycetous group is the sister group to the clade containing
pseudogymnoascean and discomycetous groups.

Five species from four families of Onygenales were clustered together forming
the onygenalean group. The support for this group was very strong, reaching 95% in
bootstrap analysis although they demonstrated many variations in ITS sequences.

Morphological descriptions

Morphological characters of the strains, including colony, anamorph and teleomorph,
were observed and described from culture. The developmental sequence of ascomata
is described and illustrated in detail to demonstrate the formation of a massive ascoma.
Culture: Isolates of CS20, CS22 and CS6-6lon bran-agar medium formed white
colonies with thick aerial mycelium covering the sclerotium tissue. Colonies of the
cultures were flocculant with woolly aerial hyphae, white at first but later becoming
pinkish brown to purple, with pigmentation varying in the same colony. Reverse of
the colony was red-brown to purplish brown. Ascomata appear in 6-8 weeks. Mature
ascomata were pale yellowish-brown to pinkish brown and were either scattered upon
the surface of the colony or aggregated into dense clusters. Finally the woolly aerial
hyphae disappear and the colonies are covered with clay-pink, farinaceous granules.
Microscopic observation: Vegetative hyphae were hyaline, 1.0-2.5 um diam.
Ascomata were discrete or confluent, globose to subglobose, 52-320 um diam., at first
white, finally pale pink to pinkish brown under the dissecting microscope. The outer
part of the ascoma formed a defined layer of hyphae, which was usually regarded as a
peridium. The peridium was composed of pale yellow to yellow-brown, septate, thick-
walled hyphae, 2.0-3.0 um diam., sometimes thickening at the node reaching 3.5 um
diam. Thin-walled hyphae arising from the thick-walled hyphae in the peridium were
regarded as appendages, which were simple and up to 40 um long. Asci were hyaline,

C&22
CS6-61
= S20
AF062819 Psezdogpmmoascus roseus
oF AFO81431 Pseudogymmoascus roseus
7 } As509872 Geompoes parmorum ]
- 33 8 AF015789Gecmpoes pernorum
$0 al AJS3SSO0390 Geompoes asperulatus
2 38 " AF SU? 760 Geompees permorum var, pamnorien
: io AFUE28 1 8Gymastellatospora japonica
38 AF 203459 Biptraderm a deformnans
f4( = AP141163Dered vitor
5t 16 AF141199Pexicula ocellata
2 = AF1A11S9heofabraca malicorficrs
73 22 __ J99B7EStlerotvia frifaliorzan
23 1448 Sieromitide sniracicola ry
89 re te AP335454 Bisporelia citing
63 AFOG26 10 Mprotricizan ancticum
AFO1 1295 Bivsiphe cichoraceaum
77611 Gelatinipedvinelia astraceicola
ne 430 2 AF 338929 Neurospora isfrasperma 3
100 a C318 Cordycens sinensis
a 28 _ A. 1915829 Gymmaascus petalospons
% BS 38. A1915825 Grrmoascus purciates
6 52 AFOSESES Aeliompces capsud ahes 4
144 33 Bg Potent
95 AJOD0B 1 4 Arthroderma persicolor
ks AJ27 1565 Amaeoascus mutates
183 AP ASSAM Agaricus bisnorus
EL AF(IG8926 Ustilago maydis
50 changes

Fig. 1. One of the ten most parsimonious trees obtained from the analysis of nucleotide sequences of ITS regions
(nrDNA). The upper and lower numbers on each branch denote the number of estimated substitutions and the
percentage of bootstrap replicates respectively. Only bootstraps higher than 50% are shown. The length of the
tree is 1607 steps, with consistency index=0.5083 and retention index=0.5401. Group 1=pseudogymnoascean,
2=discomycetous, 3=pyrenomycetous and 4=onygenalean.

_subglobose to oval, stalked, 8-spored, (6.0—) 7.0-9.0 um diam. Ascospores were hyaline,
ellipsoid to fusoid-ellipsoid or fusoid, pale olivaceous to pink, smooth, yellowish brown
in mass, 3.5-5.5x1.8-3.0 um.

Anamorph: Hyphae were hyaline, smooth and thin-walled, 0.8-2.5 um wide.
Conidiophores were hyaline and dendroid, or sometimes absent. Conidia formed
terminally or were intercalary, thin-walled, smooth, 3.0-6.0x2.0-3.5 um. The terminal
conidia had a truncate base (about 1.8 um wide) and were cuneiform, ellipsoid or
ampullaceous. The intercalary conidia were barrel-shaped. Numerous conidia sometimes

Figs 2-9. Pseudogymnoascus roseus. Fig. 2. Anamorphic stage. Terminal and intercalary conidia were borne
on dendroid conidiophores. Fig. 3. Ascoma initial. The ascoma initial arose as a short branch (arrow) from a
vegetative hypha. Fig. 4. Two pairs of adjacent ascoma initials. The right two initials curved towards each other
whilst the left two curved away to the opposite direction. Fig. 5. Ascoma initial coil. The other part of the initial
is out of focus. Fig. 6. The same ascoma initial in Fig. 5 observed at a different focus. Hyphal branches emerge
from the coil. Fig. 7. Close-up of two ascoma initials. The initials have complex coiling hyphae and branches. Fig.
8. Multiple ascoma initials from one site. Two tight ascoma initial coils (arrow heads) and two initial branches
(arrows) are visible. Fig. 9. Young asci produced in groups. There is no ascospore delimitation at this stage.
Bar=10 um, except for Fig. 2, where Bar=20 um.

‘Figs 10-17. Pseudogymnoascus roseus. Fig. 10. Young ascospores formed within asci. Ascospores (arrow) are
clearly visible at this stage and there is no envelopment of the asci, which were produced from the same ascoma
initial. Fig. 11. Groups of asci. The groups of asci lack a defined envelope separating them from the surrounding
hyphae and may merge together to form an ascus aggregation. Ascospores are visible within asci. Fig. 12. A small
and immature globose ascoma. There is a released ascus to the upper right of the ascoma. Fig, 13. Part of a section
of an ascoma. A large number of asci are enwrapped by a network of thick-walled hyphae (peridium). Fig. 14.
Close-up of peridium in a section of an ascoma. The peridium hyphae are thick-walled with many branches. Fig.
15. Dissection of an ascoma. The asci in the ascoma are released at the upper right from the peridium, which is at
the lower left. Fig. 16. Dissection of an ascoma. Asci are formed on stalks (arrow). Fig. 17. Released ascospores.

Bar=10 um in Figs 10-12, 14 and 17; Bar=20 um in Fig. 16 and Bar=30 wm in Fig. 13.

aggregated together to form a subglobose conglobation. If the strains were kept for long
enough, ascomata of P roseus appeared and the colonies became pinkish coloured in
6-8 weeks.

Development of ascomata: Ascomatal initials are scattered among, and formed from,
vegetative hyphae. Initially, ascomatal initial branches, usually 2.5 um diam. wide, arise
from vegetative hyphae. The short branch with thicker cytoplasm than surrounding
vegetative hyphae (Fig. 3) was the earliest stage of ascomatal initial observed. As
ascomatal initials grew, they became curved. Adjacent ascomatal initials might
sometimes grow toward each other or apart from each other (Fig. 4). Figure 4 shows
two pairs of adjacent initials: the right two initials curved towards each other while
the left two curved away to the opposite direction. The conjunction of two initials and
differentiation of gametangia were not detected. Ascomatal initials continued to grow
and formed coils (Figs 5, 6). Figures 5 and 6 show an ascomatal initial coil observed at
different focuses. Some thick branch structure emerged from the coil. The initials coiled
further to form helical loops (Figs 5-8). Several initials arising nearby were at the same
or different developing stages (Figs 7, 8). Figure 8 shows two tightly coiled ascomatal
initials (arrow heads) and two ascomatal initial branches (arrows) which arose from
the same hypha. Figures 5-8 also show irregular branches stretched out from the coiled
initials. These branches can continue to grow and form new coils, or interweave to form
an enveloping network in the later stages.

As the ascomatal initial develops, asci are produced. Asci are globose and produced
in groups (Fig. 9). Asci begin to enlarge and ascospores are delimitated and form inside
the asci (Figs 10, 11). The asci aggregated to form large structures without any defined
envelope separating them from the surrounding hyphal components (Figs 10, 11).
Figure 11 demonstrates groups of asci can be produced close to each other, and asci from
different initials can result in single ascus aggregations. As the number of asci increases,
ascomata also increase in size and appear as dark spheres under the microscope owing to
the thickness preventing light transmission (Fig. 12). The early ascomata appear as small
white points attached to white vegetative hyphae under the dissecting microscope.

As ascus aggregation develops and merges from different ascomatal initials, a network
of thick-walled hyphae also envelops the asci. The thick-walled hyphae interweave to
form a loose network, which is pale yellow to yellow in colour. Pigmentation of these
hyphae increases as the ascomata enlarge. Eventually, a specified layer of the hyphal
network, i.e. the peridium, is formed. Figures 13 and 14 are sections of ascomata showing
a large number of asci surrounded by the hyphal network (peridium). The peridial
network comprises thick-walled hyphae which are richly branched and anastomosed
(Figs 14, 15). Some thin-walled, short branches from the hyphal network extend from
the globose ascoma. Figure 15 demonstrates that the peridium is composed of loosely
interwoven hyphae, which forms a net enveloping the densely packed asci. The whole
ascoma appeared dark coloured under the transmission microscope, but as spheres with
some shades of pink to pale purple under the dissecting microscope.

Figure 16 shows the attachment of asci to hyphal stalks squeezed out of an ascoma
which had a hyphal network (peridium) enveloping the ascus aggregation. When the
ascoma matures, a large number of ascospores are released from asci spreading out of
the ascoma and among the hyphal network. The ascospores were fusoid to ellipsoid
(Fig nl):

Discussion

The sequence comparison revealed that the ITS sequences of CS20, CS22 and CS6-61
were identical to AF062819-Pseudogymnoascus roseus in GenBank. The DNA sequence
analysis showed that these sequences and AF081431-P roseus, the partial sequence of
ITS region included in this study, formed a unique terminal group. The strains CS20,
CS22 and CS6-61 should be regarded as the same species as AF062819-P. roseus, which
was submitted by Hambleton et al. in 1998 from strain UAMH 9163, isolated from roots
of Abies lasiocarpa (Hook.) Nutt. in Alberta, Canada.

The morphological characters of CS20, CS22 and CS6-61 matched those described
for P roseus by Cejp & Milko (1966), Orr (1979) and Currah (1985). A reference
collection of P. roseus deposited at K (K(M) 116466: Pseudogymnoascus roseus, isolated
from Eucalyptus, Australia, G. Johnson, 1975) was also examined for confirmation
and they showed the same morphological features. Based on the molecular and
morphological data, CS20, CS22 and CS6-61 were identified as P. roseus. The strains also
exhibit an anamorphic stage with dendroid conidiophores, and cuneiform to ellipsoid
and terminal or intercalary conidia. Compared with the morphological characters of
Geomyces pannorum var. vinaceus (Sigler & Carmichael 1976, Oorschot 1980), the
anamorphic stage of these strains should be classified in the genus Geomyces and might
be the same as G. pannorum var. vinaceus.

The two G. pannorum sequences (AF509872 and AF015789) demonstrated only a
few variations from that of P. roseus and formed a clade with P roseus in the ITS analysis.
This result suggested that the two strains of G. pannorum were likely to be related to P
roseus. The sequence variation between G. pannorum and P. roseus was nearly the same
as within the G. pannorum clade.

Four sequences of Geomyces, i.e. three G. pannorum and one G. asperulatus, were
separated into two clades. It is possible that more than one taxon has been involved
in the strains named as G. pannorum. The sequence of AF307760-G. pannorum vat.
pannorum is closer to AJ390390-G. asperulatus than to the other two G. pannorum
isolates. Geomyces asperulatus and G. pannorum are similar in morphology. Geomyces
asperulatus has hyaline, narrow, sometimes branching conidiophores 0.5-1.0 um long,
and yellow, barrel-shaped (or cuneiform if terminal), long-chained arthroconidia whist
G. pannorum differs from G. asperulatus in forming conidia in shorter chains and in
having aleurioconidia formed laterally on the hypha. It is not easy to distinguish the
two taxa based on morphology. It appears that molecular systematic analysis based
on the DNA sequence data may be a reliable method to avoid misidentification.
Gymnostellatospora japonica was clustered with two of the four Geomyces sequences
(AJ390390 and AF307760), and is possibly related to P. roseus and Geomyces species,
but they may not be the same species judged from the sequence variations and from the
parsimony analysis. Gymnostellatospora was published and placed in Myxotrichaceae
by Udagawa et al. (1993), based on gross morphological characteristics. Species of
Gymnostellatospora possess yellowish or reddish brown ascomata; hyphal network of
peridium; indistinct ‘appendages’; 8-spored, globose or ovoid, evanescent asci; and
fusoid, hyaline to pale yellow ascospores (Udagawa et al. 1993). These features are similar
to those of Pseudogymnoascus. However, the peridial hyphae of Gymnostellatospora are
incompositoperidium-type (see Currah 1985) at maturity and the ascospore wall has

narrow longitudinal crests and a convex surface, which is clearly different from that
of Pseudogymnoascus. If the two genera are more widely sampled for investigation of
molecular sytematics, it may be possible to find relationships between them.

The systematic position of the genera Gymnostellatospora, Myxotrichum and
Pseudogymnoascus were classified in the same family, Myxotrichaceae. Members of these
genera are similar in morphology, having brown shaded ascomata; hyaline, globose or
subglobose asci; and hyaline, ellipsoid or fusoid ascospores. In the present ITS sequence
analysis, Myxotrichum arcticum was distantly related to P roseus and Gymnostellatospora
japonica. Myxotrichum arcticum was placed in the discomycetous group, and P. roseus
and Gymnostellatospora japonica formed a separate clade with the anamorphic Geomyces.
Members of Myxotrichaceae in this analysis were not in a monophyletic group, as
speculated by Currah (1994) based on ascospore morphology. They were separated
and embedded among discomycete taxa. Based on 18S rDNA analysis, Sugiyama et al.
(1999) described two separate lineages within Myxotrichaceae, in which Myxotrichum
was separated from Pseudogymnoascus. Hambleton et al. (1998) also reported that
Myxotricum and Byssoascus Arx diverged significantly from Gymnostellatospora japonica
and P. roseus in ITS sequence analysis. The result of the present study coincides with
those reports by Sugiyama et al. (1999) and Hambleton et al. (1998). Although the close
relationship between members of Myxotrichaceae and discomycetes has been revealed
in molecular studies, their ascomatal structure and morphology differ remarkably. Asci
of discomycetes are formed from a hymenium within the apothecium, but a hymenium
or apothecium are absent in P. roseus and other species of Myxotrichaceae.

Pseudogymnoascus was formerly placed in Onygenales (e.g. Currah 1985, 1988).
The onygenalean fungi produce evanescent asci in the mycelium or cleistothecial
ascomata, and unicellular ascospores. To confirm their molecular relationship, several
ITS sequences of onygenalean fungi were included in this analysis. The sequences of
onygenalean fungi greatly diverged from those of P roseus, Geomyces pannorum and
other selected Myxotrichaceae. Pseudogymnoascus roseus and Myxotrichum arcticum are
separated from the onygenalean group by the pyrenomycetous group, and closely related
to the discomycetes. The results of the present study reveal that the onygenalean group
is distantly related to the Myxotrichaceae in ITS sequence and shows the independent
evolutionary line of P. roseus and Myxotrichum from other onygenalean taxa as suggested
by Currah (1994). Recent molecular systematic studies (Sugiyama et al. 1999, Mori et al.
2000) based on a different region of rDNA also obtained the same results.

The onygenalean fungi were rather isolated from other ascomycetes tested. The
discomycete and pyrenomycete species were more closely related to each other than to
the onygenalean fungi (Fig. 1). Furthermore, many variations in ITS sequences were also
observed among the onygenalean fungi. It seems that there is a complex relationship in
Onygenales and great divergence may exist within the order.

Morphologically, Pseudogymnoascus is similar to members of Onygenales in
many aspects. The ascomatal stucture and brown colour of the reticulate hyphal
network (peridium) in Pseudogymnoascus is very close to that of Gymnoascus. The
characters of the peridium were very much emphasised in previous classifications and
Pseudogymnoascus was considered to be related to Gymnoascus, which possesses oblate
ascospores with an acute rim. Pseudogymnoascus differs from Gymnoascus only in the

absence of peridial appendages and ascospore morphology. Currah (1985) noted that
characters of ascospore morphology, enzymatic capacities, and nature and the occurrence
of anamorphs provide significant information for classification. Based on ascospore
morphology and cellulolytic capacities, Currah (1985) placed Pseudogymnoascus in
Myxotrichaceae and Gymnoascus in Gymnoascaceae, thus separating these two genera
in different families. Molecular investigations (Sugiyama et al. 1999, Mori et al. 2000,
and this study) also consider that Pseudogymnoascus is widely separated from members
of Gymnoascus and other onygenalean fungi.

Different peridial types evolved within the prototunicate ascomycetes in response
to selective pressures affecting spore dispersal from enclosed areas (Currah, 1994). The
loose hyphal network of the peridium exposes the asci and ascospores. Along with
the evanescent asci, this may contribute to the release and dispersal of ascospores and
increase the chance of propagation. The similar peridium occurring in quite different
lineages of genera may be the result of convergent evolution.

The close relationship of P roseus with the discomycetes has been suggested
by molecular investigations (Sugiyama et al. 1999, Mori et al. 2000, and this study).
Pseudogymnoascus roseus and other members of Myxotrichaceae share some characters
in common: unicellular ascospores; scattered (without a hymenium), thin-walled and
evanescent asci; cleistothecial ascomata; and ascomatal peridium of a thin hyphal
weft. These characters are very different from those of typical discomycetes. Mori et
al. (2000) considered that the close relationship between Erysiphales, Myxotrichaceae
and some discomycetous fungi (mainly Helotiales and Thelebolaceae) suggested a
novel evolutionary pathway from cleistothecial discomycetous fungi to Erysiphales and
Myxotrichaceae. The present study also revealed a close relationship between P. roseus,
other members of Myxotrichaceae and discomycete fungi.

Pseudogymnoascus roseus shares a similar structure of ascoma and peridium
with members of Onygenales. The ascomatal structure and loose hyphal network of
the peridium found in P. roseus and other species of Myxotrichaceae may have been
reversed from the advanced apothecium to primitive ascoma in Onygenales, if the latter
is considered to have diverged earlier in the ascomycetes. This reversion may also have
occurred more then once (at least in the pseudogymnoascean group and Myxotrichum
arcticum (Fig. 1) in the course of evolution.

Based on the observation of ascomatal development in this study, the formation of
ascoma in P. roseus was initiated from short branches of vegetative hyphae. Currah (1985)
generalised that the fertile ascomata of Onygenales were initiated by the formation of
paired gametangial hyphae. Ascomatal development in P roseus may be similar to that
in Onygenales, but the microscopic observation made in this study did not detect the
contact of two gametangia and the migration of nuclei or cytoplasm. ‘The structure of
hyphae in the ascomatal initial coils was complex and it proved difficult to distinguish
their constituents under the light microscope.

Several ascomatal initials often appeared very close to each other from the same site
in the colony of P roseus. Asci from one or several initials might grow together without a
defined envelope at early stages. Many asci grouped to form a large globose aggregation.
A loose weft of hyphae (peridium) developed later, enveloping the aggregation. From
the observation in this study, a large ascoma should be regarded as the ascus aggregation

from several different ascomatal initials because it occupied a large space covering the
area where different initials were formed. The peridium is only a loose network of
thick-walled hyphae, and was termed a ‘reticuloperidium’ by Currah (1985). Like the
ascoma, the peridium may also come from several different ascomatal initials. Although
initial stages of ascomatal development and the structure of mature ascomata have
been described (Cejp & Milko 1966, Orr 1979, Currah 1985), detailed observation of
ascomatal formation has not been reported elsewhere. It is revealed for the first time
that the ascomata in Pseudogymnoascus are formed by the aggregation of asci.

The morphology of ascospores and of peridial appendages are important taxonomic
characters in recognising species of Pseudogymnoascus. The ascospores are generally
considered smooth and the appendages not distinct in Pseudogymnoascus. Two species
of Pseudogymnoascus have rather different features from P. roseus: P. dendroideus has
ramified appendages and striated ascospores with slight thickening at the equator
(Locquin-Linard 1982) and P. alpinus has navicular-fusoid ascospores, and branched
and recurved appendages (Miller & Arx 1982). Either the taxonomic position of these
two species is in need of reconsideration or the generic concept of Pseudogymnoascus
must be revised. The species that Lumley et al. (2000) described as ‘“Pseudogymnoascus
sp. also requires further investigation because the longitudinal sigmoid crest on the
ascospores is not characteristic of Pseudogymnoascus. Molecular research may elucidate
the relationships of these morphologically different fungi.

Pseudogymnoascus roseus is distributed worldwide and has often been isolated from
alpine regions. It is interesting that the fungus was also isolated from sclerotia of C.
sinensis in this study. Because of its medicinal value, C. sinensis has been the target of
efforts to obtain pure isolates for massive production in industrial fermentation. Various
fungi, about 22 names in 13 different genera, have been related in the literature to the
anamorph of C. sinensis, either for isolates from material of the fungus or for postulated asexual
states (Jiang & Yao 2002). Although many of the isolates are not true C. sinensis, they may
have similar chemical properties and medicinal effects, e.g. Paecilomyces sinensis Q. T.
Chen et al. and Tolypocladium sinense C. Lan Li (Gui & Chen 1983, Li 1988, Liu et al.
1991). Some of those isolates are even widely used in manufacture referring to the products
of C. sinensis (Jiang & Yao 2002, 2003). It may be ascribed to the interaction of fungi
or selective pressure in the same ecological environment that different fungi produce
similar medicinal properties. Probably the strains of Pseudogymnoascus roseus were
present in the alpine soil of the Tibetan Plateau and contaminated the Cordyceps isolates.
As another micro-organism living in the same niche with C. sinensis, whether P. roseus
has similar chemical properties that can be used for medicinal purpose may deserve
further investigation. Currah (1985) suggested that the pale rose reticuloperidium and
ascospores of P. roseus probably indicated a reliance on burrowing animals for dispersal.
The host of C. sinensis, the caterpillar larvae of Hepialus armoricanus Obertheir, living
in the same microcosm may also be one of the animals helping the dispersal of P. roseus
ascospores.

Acknowledgements

The authors are grateful to Drs B. M. Spooner and P. D. Bridge for serving as pre-submission
reviewers and for their valuable comments and suggestions. This project is supported by the Chinese
Academy of Sciences and the National Natural Science Foundation of China through the ‘Key
Research Direction of Renovation Program (KSCX2-SW-101C)’ and the scheme of ‘Introduction
of Overseas Outstanding Talents, and ‘National Science Fund for Distinguished Young Scholars’
(30025002) respectively.

References

Alexopoulos CJ, Mims CW. 1979. Introductory Mycology. 3rd Edition. John Wiley & Sons, Inc.,
New York, USA.

Alexopoulos CJ, Blackwell M, Mims CW. 1996. Introductory Mycology. 4th Edition. John Wiley &
Sons, Inc., New York, USA.

Altschul SF, Madden TL, Schaffer AA, Zhang J-H, Zhang Z, Miller W, Lipman DJ. 1997. Gapped
BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids
Research 25: 3389-3402.

Arx, JA von. 1971. On Arachniotus and related genera of the Gymnoascaceae. Persoonia 6: 371-
380.

Arx, JA von. 1974. The general of fungi sporulating in pure culture. 2nd Edition. J. Cramer, Vaduz,
Germany.

Arx, JA von. 1981. The genera of fungi sporulating in pure culture. 3rd Edition. J. Cramer, Vaduz,
Germany.

Arx, JA von. 1987. A re-evaluation of the Eurotiales. Persoonia 13: 273-300.

Benny GL, Kimbrough JW. 1980. A synopsis of the orders and families of plectomycetes with keys
to genera. Mycotaxon 12: 1-91.

Bowman BH, Taylor JW. 1993. Molecular mnie of pathogenic and non-pathogenic Onygenales.
In: The Fungal Holomorph: mitotic, meiotic and pleomorphic speciation in fungal systematics
(eds. D.R. Reynolds and J.W. Taylor) CAB Inernational, Wallingford, UK: 169-178.

Cejp K, Milko AA. 1966. Genus Pseudogymnoascus Raillo. (Gymnoascaceae). Céska Mykologica
20: 160-163.

Christensen M, Whittingham WF, Novak RI. 1962. The soil microfungi of wet-mesic forests in
southern Wisconsin. Mycologia 54: 374-388.

Currah RS. 1985. Taxonomy of the Onygenales: Arthrodermataceae, Gymnoascaceae, Myxotrichaceae
and Onygenaceae. Mycotaxon 24: 12-16.

Currah RS. 1988. An annotated key to the genera of the Onygenales. Systema Ascomycetum 7:
1-12.

Currah RS. 1994. Peridial morphology and evolution in the prototunicate ascomycetes. In
Ascomycete systematics: problems and perspectives in the nineties (ed., D.L. Hawksworth).
Plenum Press, New York, USA: 281-293.

_Dalpé Y. 1989. Ericoid mycorrhizal fungi in the Myxotrichaceae and Gymnoascaceae. New
Phytologist 113: 523-527.

Ellis MB, Ellis JP. 1988. Microfungi on Miscellaneous Substrates. An Identification Handbook.
Croom Helm etc., London. UK.

Eriksson O, Hawksworth DL. 1986. Notes on ascomycete systematics. Systema foconceiin 5:
113-174.

Eriksson O, Hawksworth DL. 1993. Outline of the ascomycetes-1993. Systema Ascomycetum 12:
51-257.

Farrow WM. 1954. Tropical soil fungi. Mycologia 46: 632-646.

Felsenstein J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution
39: 783-791.

Gui X-M, Chen X-L. 1983. Research on chemical component of Paecilomyces sinensis. Bulletin of
Chinese Materia Medica 8(4): 32. [in Chinese].

Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program
for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95-98.

Hambleton S, Egger KN, Currah RS. 1998. The genus Oidiodendron: species delimitation and
phylogenetic relationships based on nuclear ribosomal DNA analysis. Mycologia 90: 854-869.

Ito T, Yokoyama T. 1985. Filamentous fungi collected in far eastern USSR. Institute for Fermentation,
Osaka, Research Communications 12: 34-62.

Ito T, Yokoyama T. 1987. Descriptive catalogue of IFO fungus collection X. Institute for
Fermentation, Osaka, Research Communications 13: 83-85.

Jiang Y, Yao Y-J. 2002. Names related to Cordyceps sinensis anamorph. Mycotaxon 84: 245-254.

Jiang Y, Yao Y-J. 2003. Anamorphic fungi related to Cordyceps sinensis. Mycosystema 22: 161-176.
[in Chinese].

Kirk PM, Cannon PF, David JC and Stalpers JA. 2001. Dictionary of the Fungi. 9th Edition. CAB
International, Wallingford, UK.

Kuehn HH. 1958. A preliminary survey of the Gymnoascaceae. I. Mycologia 50: 417-439.

LeClerc MC, Philippe H, Gueho E. 1994. Phylogeny of dermatophytes and dimorphic fungi based
on large subunit ribosomal RNA sequence comparisons. Journal of Medical and Veterinary
Mycology 32: 331-341.

Li Z-L. 1988. A study of Tolypocladium sinense C. L. Li sp. nov. and cyclosporin production. Acta
Mycologica Sinica 7: 93-98. [in Chinese].

Liu Y-R, Wu C-Z, Li C-C. 1991. The anti-oxidization effect of Paecilomyces sinensis. Journal of
Chinese Materia Medica 16: 240-242. [in Chinese].

Locquin-Linard M. 1982. Pseudogymnoascus dendroideus Locquin-Linard, nouvelle espece de
Gymnascale (Ascomycetets) Coprophile d’afrique du nord. Cryptogamie Mycologie 3: 409-
414,

Lumley TC, Abbott SP, Currah RS. 2000. Microscopic ascomycetes isolated from rotting wood in
the boreal forest. Mycotaxon 74: 395-414.

Maddison DR. 1991. The discovery and importance of multiple islands of most-parsimonious
trees. Systematic Zoology 40: 315-328.

Mori Y, Sato Y, Takamatsu S. 2000. Molecular phylogeny and rediation time of Erysiphales inferred
from the nuclear ribosomal DNA sequences. Mycoscience 41: 437-447.

Miller E, Arx JA von. 1982. Pseudogymnoascus alpinus, nov. spec. Sydowia Annales Mycologici
35:2135-137.

Oorschot CAN van. 1980. A revision of Chrysosporium and allied genera. Studies in Mycology 20:
1=99.

Orr GE. 1979. The genus Pseudogymnoascus. Mycotaxon 8: 165-173.

Samson RA. 1972. Notes on Pseudogymnoascus, Gymnoascus and related genera. Acta Botanica
Neerlandica 21: 517-527.

Siddiqi MA. 1964. Fungus flora of coffea arabica in Nyasaland. Transaction of British Mycological
Society 47: 281-284.

Sigler L, Carmichael JW. 1976. Taxonomy of Malbranchea and some other Hyphomycetes with
arthroconidia. Mycotaxon 4: 349-488.

Sigler L, Lumley TC, Currah RS. 2000. New species and records of saprophytic ascomycetes
(Myxotrichaceae) from decaying logs in the boreal forest. Mycoscience 41: 495-502.

Sugiyama M, Mikawa T. 2001. Phylogenetic analysis of the non-pathogenic genus Spiromastix
(Onygenaceae) and related onygenalean taxa based on LSU sequences. Mycoscience 42: 413-
421.

Sugiyama M, Ohara A, Mikawa T. 1999. Molecular phylogeny of onygenalean fungi based on small
subunit ribosomal DNA (SSU rDNA) sequences. Mycoscience 40: 251-258.

Swofford DL. 2001. PAUP: phylogenetic analysis using parsimony. Version 4.0b10. Sinauer
Associate, Sunderland, Massachusetts, USA.

Swofford DL, Olsen L. 1990. Phylogeny reconstruction. In Molecular Systematics (eds. M. Hilis and
C. Mortiz). Sinauer Associates, Sunderland, Massachusetts, USA: 411-501.

Tsuneda AA. 1982. Scanning electron-microscopy of Pseudogymnoascus roseus. Mycologia 74:
844-847,

Udagawa S, Uchiyama S. 1999. Taxonomic studies on new or critical fungi of non-pathogenic
Onygenales. Mycoscience 40: 277-290.

Udagawa S, Uchiyama S, Kamiya S. 1993. Gymnostellatospora, a new genus of the Myxotrichaceae.
Mycotaxon 52: 157-164.

White TJ, Bruns T, Lee S, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. In PCR Protocols, A Guide to Methods and Applications (eds.
M.A. Innis, D.H. Gelfand, J.J. Sninsky and T.J. White). Academic Press, London, UK: 315-322

Xiao G, Berch SM. 1995. The ability of known ericoid mycorrhizal fungi to form mycorrhizae with
Gaultheria shallon. Mycologia 87: 467-470.

Yao Y-J., Pegler DN, Chase MW. 1999. Application of ITS (nrDNA) sequences in the phylogenetic
study of Tyromyces s. |. Mycological Research 103: 219-229.

Yokoyama T, Ito T, Yin Y-Q. 1989. Filamentous fungi isolated from soils in the XinJiang Uighur
Autonomous Region, China. Institute for Fermentation, Osaka, Research Communications 14:
118-142.

’ P
il i

: Joa ‘aie SAME hate
* a Ash ‘ea

Bax! m

Te PAC « Oe a aK

ar , .
=o PS d 7 ™ P ~~ f
a i dikien :.
% “-a)

| ae: nh q) af ak pao. f igieayt nd
Rye, ; a ce ee ace cad bac sphegioasA tune ie
ro is ie Sane, ne hoes pif cae sh ait hah Pas ica ihe

aT i Ruf ie ; ay eh Wy cn be las ; £8 wv ity :
We ra - laine ten nee iat Waite. vert és oy mua ii a “jh
¥ ie nate i ah renal ee nt oy," a ined oh, a ,
mye td i uty
neem an om es vey: 2 oyiin pe 2 eg ‘
ae rie, ™ sc ee fits ha mai het bas ira ‘ pax iam maVierY 7 neice i‘ Biekeiiinniyne” M he . |
ae “ ee fi hi Bi y
; ven vi fish We & oe fe eth hee joni erm tral 4 TOIT pi OW TT we
ial a eee iid iH ay rae PURLEY SEAS ROE nt Doe ay whe AP, wet
Nc Se erate len eisai ERE LT ANE inhi SMT dada yes ending
; ~o\ oe ;
ie Peron ce a iit "3 ii Sits i: mat wee: “arts Tt) AR «0
;

4 ey 7 eS ayhetek ea AlocetA, waligateicat sities INS Pie
7 4 : Pan} a Mg dd a ‘el ‘ s _ ; “
set Al ; a ae toy y.* inl , uh Te 6.3 wha vn p. his 7 ‘Ni Ww my We ea Gi? - *
, 4 YP ao
ls ; is - Tad i , “). i. peat: 3 Pytyl shan peti ti jalan Pe aad Temas 6 joe
A “ah ,
nt Tg Wk ut we ef vA , WO A ea fea, sangh {ae ORY: de ve itenaaethil
yy ee sige u bi rae (i aay) :. Gat tems er eu deh bei naire | “f 4a) 1 iy nq ay Cirerenh: et 2
: ‘ tae ye! ae ewe OVP Toe y vay ‘ase la “\aseee® te ee te ee aa
¥ “J, : “ae 4 das iy / TeAt at oi ¥ : % és
ao bY, Cy aan SUR TE YC reg COKRPOC TENE Oe Rid. PA Cay ie eat, Ni ieagie Re ae ve
7 iii U J ; 7 ’ a 4 y : i j p wi " aa
i a nT ’ i‘ yk a ; - t ~ ‘i a sagt ie i = :
| ; j i : Vi), » ahs ul Ph hs a ma ey ay iP ee" ae nie aot hae voli LAL OF > rin aniting yy? eh yes in 1 :
Te. ro NaRdn ome SMM SIS ray 28509 TS 0 ey il ge SE 2 ae ” Pee hee |
i ‘he biel in / Lh yew . “eat ‘itt tyra) wld “ gen ay f ih l' il pie i) \ ys ah piste, ; My ,
ay wal " i 4 ; vor, ny dated a! Hy fu gs i a ne "14 7 a ee, on * . p - ) %, ” ia ' ale : 4
7 “tub hy ad Vy Medien Cnn 4 ine mM ee ‘ae Fives a cTyiy rena a pane) 4 eesth ets seh -
Fay vlbasdegh sl [Phony eT SA pipswentate dt | Miaeclanae ie rela, ee ae a |
4 a P ak
mee a) vite son ire DA ath WR A a peeves <M le old eae nie a se hve Medion ki 4
Ow ata Ve gay ftp Se © Se 7 ' a 4
we y ' } ay,
j Ve iene ai amr se ih, Acai “tase Linh oh pectin’ on oa ie b aaa on ~4
‘lee » , ie Y, ) . a ed eer ae Ny ae ho .
5 oe i : fl i . ~ & :
+ 7 7 ot ( “ ; ren aa serpin Ser 12 AS A , BA
; :

mn 3 aes a : 7%, ane ety “GAL itaaead apt ren bee sy Pint aie
baie reir ts oie a as de bared Net re a
| Hi | ne : tg

- me i

MYCOTAXON
Volume 94, pp. 75-84 October-December 2005

Morphological and molecular characterization of the mycorrhizas
of Inocybe rufuloides and I. splendens

Mirco [ottT1, MAURO MARCHETTI,
ENRICO BONUSO & ALESSANDRA ZAMBONELLI

zambonel@agrsci.unibo.it
Dipartimento di Protezione e Valorizzazione Agroalimentare
via Fanin 46, 40127 Bologna, Italy

Abstract—The mycorrhizas of Inocybe rufuloides on Pinus pinea and of Inocybe splendens
on Ostrya carpinifolia were characterized by morphological and molecular methods.
Molecular identification was performed by comparing the rDNA ITS sequences
obtained from Inocybe fruiting bodies with those of the mycorrhizas collected from
the same area. Morphological characterization was carried out by a simplified Agerer
protocol. This study provides sets of characters which can be used in further studies
for the identification of these two Inocybe species found contaminating Tuber infected
plants in experimental truffieres.

Key words—ectomycorrhizas, ribosomal DNA sequences, morphological description,
truffle cultivation

Introduction

Ectomycorrhizas are dominant in forests of temperate and boreal regions of the Northern
Hemisphere (Brundrett et al. 1996). It has been estimated that 6000 or more species of
fungi form ectomycorrhizal associations with approximately 10% of the Angiosperms
and many Gymnosperms (Trappe 1987). The ectomycorrhizal communities are dynamic
and changes in their population structure occur depending on the age of the host plants,
season and environmental factors (Molina et al. 1992, Deacon & Fleming 1992). In the
past research into ectomycorrhizal fungal diversity were almost exclusively carried
out by identifying and counting fruiting bodies that appeared above the ground or by
inspecting the roots of trees and grouping their ectomycorrhizas into morphotypes
(Selosse 2001). While the first method is relatively quick and easy the number of species
of ectomycorrhizal fungi that fruit above the ground is generally considered to be a
gross underestimate of the number of ectomycorrhizal fungi present in an environment
(Yamada & Katsuya 2001, Selosse 2001). For example, ectomycorrhizal fungi such as
Cenococcum geophilum and many members of Telephoraceae, which are some of the
most common mycorrhizas (Richard et al. 2005, Horton & Bruns 2001), do not produce
fruiting bodies or form cryptic fruiting structures. In contrast, although morphotyping
of ectomycorrhizas give a better picture of fungal diversity and subtle changes that can
occur during competition in ectomycorrhizal communities, it is often impossible to
relate the morphotypes to a known fungal species (Horton & Bruns 2001).

The recent application of molecular methods has revolutionised our ability to identify
ectomycorrhizal fungi. They are useful either for the certification of plants that have been
inoculated with commercially valuable species such as Tuber and also allow us to carry
out more ambitious studies on ectomycorrhizal community structures and competition
within them (Amicucci et al. 2002, Dahlberg, 2001). A comparison of ITS sequences
obtained, for example, from traditionally identified fruiting bodies with those obtained
from mycorrhizas can provide a means for identifying the fungi that form mycorrhizas
(Horton & Bruns 2001). However ITS sequences for many ectomycorrhizal fungi have
yet to be determined and so their identification remains impossible.

The aim of the work presented here was to provide a set of molecular and morphological
characters for the identification of Inocybe rufuloides and Inocybe splendens by ITS
sequencing of the mycorrhizas and of their fruiting bodies and the morphological
description of their mycorrhizas which were found as contaminants in cultivated
truffieres.

Materials and methods
Sampling

The fruiting bodies of the two Inocybe species used in this study were collected from
two different experimental trufhéres of Emilia Romagna, Italy. I. rufuloides was found in
October 2003 in a Pinus pinea - Tuber borchii productive trufheére established in 1990.
The plantation is located in Marina di Ravenna on the Adriatic coast (49° 30’ 24” N, 17°
60’ 70” E) on littoral sandy soil (Zambonelli et al., 2000) while I. splendens was collected
in March 2004 in a Tuber aestivum trufhere established in 1997 with Corylus avellana,
Ostrya carpinifolia and Quercus pubescens infected seedlings in the park of S. Giulia,
Palagano, Modena (44° 23’ 50°N, 10° 39° 40°E, elevation 932 m) (Zambonelli et al.
2005). I. rufuloides was found near P. pinea in the T: borchii trufhiére and I. splendens
close to the trunks of the O. carpinifolia seedlings in the T. aestivum truffiere. Dried
specimens of each species were deposited in the herbarium of the “Centro di Micologia”
of Bologna (I. rufuloides n.1994, I. splendens n. 5033).

Root samples were also collected from the truffieres under fruiting bodies by removing
6 cm diameter soil cores between 0-30 cm. The soil cores were stored overnight in
refrigerator at 5 °C and the roots then removed by carefully washing over an 0.8 mm
mesh sieve.

Morphological characterisation

The I. rufuloides and I. splendens basidiomes were identified on the basis of their macro-
and microscopic morphological characters (Heim 1931; Kuyper 1986; Stangl 1989;
Moser et al. 1994, 1996; Bon 1997; Franchi et al. 2001). The microscopic features of the
basidiomes were examined in both fresh and dried material previous rehydrated in 10%
KOH and stained with Congo red.

Samples of mycorrhizas putatively formed by Inocybe sp. were selected from the root
samples of Pinus pinea and Ostrya carpinifolia on the basis of their morphological
features following Agerer’s descriptions of Inocybe mycorrhizas (Agerer 1987-2002).
Their morphological features were then described using sets of characters suggested

by Agerer (1987-2002, 1991). The colour of the fresh mycorrhizas was recorded under
a stereomicroscope and compared with the Royal Botanic Garden colour identification
chart (RBG chart) (1969). Mycorrhizal tips were then fixed in FAA bleached by heating
to 90 °C in 10% w/v KOH and treated with a few drops of H,O, for 20-30 seconds in
order to better examine the anatomy of the mantle under the microscope (Giomaro et
al. 2000). Ectomycorrhizal tips were fixed in glutaraldehyde (25%), embedded in Tissue
Tek OCT (Sakura, Zoeterwounde, Netherlands) compound and then cut with a rotary
cryomicrotome (Tissue Tek® II, Miles, Elkhart, IN, USA) (8-10 um thickness). Serial
sections were stained with cotton blue, mounted in lactic acid and observed under a
ECLIPSE TE 2000-E microscope (Nikon, Tokyo, Japan).

Mean dimensions of fruiting body and mycorrhiza characters were determined using
Axio Vision 2.05 software (Carl Zeiss Vision GmbH, Hallbergmoos, Germany) from
images captured with a DXM1200F digital camera (Nikon, Tokyo, Japan) and standard
deviations then calculated. Each biometrical character was the mean of at least 50
measurements.

Molecular characterisation

Molecular identification of the mycorrhizas and fruiting bodies was performed using
sequence data of the ITS regions of the ribosomal DNA. Total genomic DNA was
isolated by DNeasy® Plant Mini Kit (QIAGEN, Hilden, Germany) according to the
manufacturer's instructions and then eluted in 50 ul of sterile water. Ten mycorrhizas
of each morphotype were pooled and 100 ug of fruiting body tissue were used. ITS-1,
5.88 and ITS-2 regions were amplified in a 50 ul volume reaction containing 1-10 ng
of genomic DNA, using the primers pair ITS1 and ITS4 (White et al., 1990) in a T
gradient Thermal Cycler (BIOMETRA, Gottingen, Germany) according to Amicucci et
al. (1996). PCRs were performed using 1.5 units of Taq DNA polymerase (Fermentas,
Vilnius, Lithuania).

The amplified products were first purified by Gene Clean II kit (BIO 101, Vista, CA, USA)
and then sequenced using both the primers mentioned above. Sequence reaction was
performed using the ABI PRISM 3700 DNA Analyzer (Applied Biosystem, Foster City,
CA, USA). The obtained ITS sequences of fruiting bodies and mycorrhizas were compared
each other and with those on the GenBank (http://www.ncbi.nlm.nih.gov/BLAST/) and
UNITE (http://unite.zbi.ee/analysis.php3) databases using BLASTN search (Altschul et
al., 1997). The ITS sequences of the fruiting bodies obtained in this study have been
deposited in GenBank with the following accession numbers: I. rufuloides (DQ067579)
and I. splendens (DQ067580).

Results

Morphological characterization

-Inocybe rufuloides Bon

The I. rufuloides basidiomes had pileus 15-35 mm broad, campanulate, conico-convex,
then plano-convex, at maturity applanate, with or without umbo, with margin inflexed
when young, dark brown, orange-brown, tomentose around disc, outwards fibrillose,
with fibrils diverging and sometimes squamulose-subsquarrose. Lamellae were adnexed

Fig. 1 - Caulocystidia (a), spores (b), cheilocystidia (c) and pleurocystidia (d) of I. rufuloides
(Bars = 10 um).

to adnate, L = 28-45, | = 1-3, moderately crowded, ventricose, 4-8 mm broad, pale
greyish buff, then brown, dark brown, edge fimbriate, whitish. The stipe was 25-50 x
3-5 (6) mm, equal to clavate, subbulbous, brown to orange brown, extreme apex hairy-
pruinose, near base whitish, downwards longitudinally white-fibrillose. The context was
white in pileus, red-brown in stipe; smell and taste spermatic. The spores were (8) 10.5 +
1.4 (13) x (4.7) 5.9 + 0.7 (7) um, Q = (1.5) 1.8 + 0.2 (2.1), smooth, ovoid to amygdaliform,
with subobtuse to indistinctly conical apex (Fig. 1b). The basidia were 28-38 x 9-12 um,
2-4-spored. The hymenial cystidia were 50-70 x 10-20 um, cylindrico-clavate, clavate,
fusiform, lageniform, sometimes subcapitate, with a thick wall 1.5-2.5 um, slightly
yellow with ammoniac (Figs 1c & 1d). Caulocystidia were absent or present only at stipe
apex (to 1/10"), similar to hymenial cystidia and mixed with cauloparacystidia (Fig. 1a),
downwards are present caulocystidioid hairs.

I. rufuloides mycorrhizas were simple, ramified or with limited dichotomous branching
involving a few lateral root tips, rarely coralloid. The unramified ends were short, straight
or slightly twisted, 594.4 + 167.3 um long and 419.1 + 79.0 um in diameter. The structure
of the surface was woolly with whitish emanating hyphae. The mycorrhizal tips were
white (RBG chart n. 7) or greyish-cream (RBG chart n. 1) and orange-cream (RBG chart
n. 44) at the base. When viewed with a microscope the mantle was plectenchymatous
and had three distinct layers. The outermost was composed of partially bundled, loosely
woven hyphae which were without a gelatinous matrix (Fig. 3a) whereas the middle and
inner layers were made of tightly appressed hyphae (Fig. 3b & 3c). The mantle was 68.5

Fig. 2 - Caulocystidia (a), pleurocystidia (b) and spores (c) of I. spendens (Bars = 10 um).

+ 13.1 um thick and the Hartig net was one, rarely two cells deep, 3.5 + 1.1 wm thick
and composed of a single hyphal row. In cross sections the mantle was composed of
loosely arranged cells 4.7 + 0.8 um x 2.6 + 0.5 um in the external layers and 4.4 + 0.9 um
x 2.8 + 0.5 um cells in the inner layer. The root cortical cells were tangentially oval 43.0
+ 9.1 um x 19.6 + 4.4 um. The root cortical cells with Hartig net were radially oval 33.0
+ 7.4 um x 18.0 + 4.1 um. In longitudinal section the mantle was composed of loosely
arranged hyphal cells 5.4 + 1.2 um x 3.4 + 0.9 um in the external layer and of 5.0 + 1.2
um x 3.0 + 0.6 um in the inner layer. The shape of the root cortical cells was oval 58.3
+ 15.7 um (tangentially) x 24.7 + 5.5 um. The root cortical cells adjacent to the Hartig
net were 38.9 + 9.8 um (tangentially) x 19.7 + 4.6 um. The emanating hyphae (2.1 + 0.4
um thick) possessed clamp connections with a distinct hole and had a characteristically
constricted fusion point between the arched part of the clamp and the parental hypha
(Fig. 3d). Rhizomorphs and cystidia were absent.

Inocybe splendens R. Heim

I. splendens basidiomes had pileus 30-50 (70) mm broad, convex, soon plano-convex,
finally applanate, with inflexed margin, later straight, often with conspicuous but low
broad umbo, brownish-ochraceous to dark brown, sericeous-fibrillose, with fibrils not or
diverging, sometimes radially rimulose. Lamellae were adnate to almost free, L=45-65,
l=1-3, crowded, ventricose, 3-9 mm broad, whitish then greyish-yellow, finally yellow-
brown, sometimes with olivaceous tinge, edge whitish, fimbriate. The stipe was 25-90

Fig. 3 - Mantle of I. rufuloides mycorrhizas (a external, b middle, c internal layers) and of I.
splendens mycorrhizas (f external, g internal layers) under a light microscope. Clamp connections
of I. rufuloides (d) and of I. splendens (e) (Bars = 5 um).

x 6-15 mm, sometimes equal, but often marginately bulbous or subbulbous, whitish,
finally ochraceous-yellow to pale brownish, pruinose all over. The context was white in
pileus, ochraceous-yellow in stipe; smell subspermatic or as Amanita phalloides, taste
not distinct. The spores, were (8) 10.7 + 1.513) x (4.8) 5.9 + 0.9 (7) um, Q = 1.7.0.2
(20), smooth, amygdaliform, with suprahilar depression, with subconical apex (Fig. 2c).
The basidia were 26-40 x 8-12 um, 4-spored. The hymenial cystidia were (45) 50-80 x
14-20 (27) um, clavate, fusiform to utriform, sometimes sublageniform, with a thick
wall 1.5-3.0 um, colourless or slightly yellow with ammoniac, with crystalliferous at apex
(Fig. 2b); paracystidia pyriform, thin-walled, colourless. The caulocystidia were similar
to hymenial cystidia, descending almost to base of stipe, mixed with cauloparacystidia
throughout (Fig. 2a).

I. splendens mycorrhizas were simple or with monopodial ramification with few lateral
root tips. The unramified ends were straight or slightly twisted 965.2 + 353.2 mm long
and 222.4 + 29.4 mm in diameter. The structure of the surface was woolly with whitish

emanating hyphae. The colour of tips was white (RBG chart n. 7) or greyish-cream
(RBG chart n. 1) and orange-cream at the base (RBG chart n. 44). Under a microscope
the mantle was plectenchymatous, with two distinct layers, formed of closely appressed
hyphae and without a gelatinous matrix (Fig. 3f & 3g). The thickness of the mantle was
27.2 + 5.3 um. The Hartig net was one, rarely two cells deep, 2.4 + 0.5 um thick, and
one cell wide. In cross section the mantle was composed of appressed hyphal cells 4.2
+ 1.3 um x 2.0 + 0.6 um in the external layer and of 4.1 + 1.3 um x 2.0 + 0.7 um in the
inner layer. The root cortical cells were approximately tangentially oval 31.7 + 6.1 um x
20.9 + 5.0 um. The root cortical cells adjacent to the Hartig net were radially oval 27.7 +
4.5 um x 14.0 + 2.7 um. In longitudinal section the mantle was composed of appressed
hyphal cells 4.4 + 0.8 um x 2.5 + 0.6 um in the external layer and 4.3 + 1.0 um x 2.5 +
0.6 um in the inner layer. The shape of the root cortical cells was oval 40.0 + 7.5 um
(tangentially) x 19.9 + 4.5 um. The root cortical cells with Hartig net were 37.9 + 7.4 um
(tangentially) x 13.1 + 3.5 um. The emanating hyphae (2.0 + 0.3 um thick) possessed
clamp connections with a small hole and with a characteristically constricted fusion
point where the arched part of the clamp met the parental hypha (Fig. 3e). Rhizomorphs
and cystidia were lacking.

Molecular characterisation

The amplicons of I. rufuloides and I. splendens resulting from ITS1/ITS4 amplification
showed length of 690 pb and 710 pb respectively. No differences were found between
sequences obtained from mycorrhizas and from the respective fruiting body of each
Inocybe species. The sequences resulting from ectomycorrhizae and fruiting body of
I. rufuloides showed 93% level of similarity (510/544 nt) with a nearly complete ITS1-
5.8S-ITS2 sequence of an uncultured ectomycorrhiza of Inocybe (accession number
AY825514) described by Richard et al. (2005). Instead, the sequences resulting from
ectomycorrhizae and fruiting body of I. splendens showed 90% level of similarity
(580/640 nt) with a nearly complete ITS1-5.8S-ITS2 sequence of an uncultured fungus
from ectomycorrhizal root isolate (accession number AY702725) described by Izzo et
al. (2005). Lower similarities were obtained with the Inocybe sequences in the UNITE
database.

Discussion

The molecular and morphological characterization of I. rufuloides and I. splendens
mycorrhizas provide reliable instruments for the identification of these two fungi that
are potential contaminants in natural and cultivated truffieres.

Many species of ectomycorrhizal fungi are able to contaminate cultivated truffieres
such as less valuable Tuber species, Cenococcum spp., Hymenogaster spp., Tomentella
spp., Scleroderma spp., Hebeloma spp., and several, as yet, unidentified fungi known
only as morphotypes (Donnini & Bencivenga 1995, De Miguel & Saez 2005). This
replacement of inoculant fungi in truffieres by more aggressive competing fungi is one
of the most important problems during the cultivation of truffles (Sourzat 2001). These
ectomycorrhizal species usually either have a broad range of adaptability to different
ecological conditions or ecological requirements similar to cultivated truffles (Dalberg
2001, Giovannetti 1983). I. rufuloides is reported to grow in association with Pinus

maritima on sandy soil along the Mediterranean coasts while I. splendens is associated
with broad-leaf trees on calcareous sand and clay soils in Europe (Kuyper 1986). These
are the same habitats where T. borchii and T. aestivum grow respectively. The discovery
of Inocybe spp. in cultivated trufhéres and natural Tuber magnatum (Giovannetti 1983,
Pirazzi 2001), T. aestivum (Chevalier & Frochot 1997) and T: borchii (Zambonelli et al.
2002) truffiéres, and their ecological requirements seems to confirm that members of
this genus, might be important competitors.

The morphological characterization of I. rufuloides and I. splendens mycorrhizas
confirms that some characters such as the plectenchymatus mantle structure, the form
of the fusion point of clamp connections can be useful to distinguish the mycorrhizas
formed by the species belonging to the genus Inocybe (Agerer 1987-2002). However,
the only morphological characters don't allow identification at species level. Moreover,
colour and form of the mycorrhizas can vary with their age; the form of the mantle cells,
which is a quite important taxonomic character, can show some differences depending
on the fungal strain and the host plant (Giomaro et al. 2000, 2002; Sisti et al. 2003).

The early identification of the presence of contaminant fungi in cultivated trufheres
offers growers the possibility to promptly introduce cultivation procedures that favour
the establishment and development of Tuber ectomycorrhizas such as correct irrigation
rates and mulching (Zambonelli et al. 2005).

Molecular analyses have allowed us to unequivocally identify I. rufuloides and I. splendens
mycorrhizas by comparing their ITS sequences in the symbiotic and reproductive
phases. The ITS sequence of I. rufuloides and I. splendens deposited in genbank will be a
useful tool for other researchers who need to confirm the morphological identification
of these fungi by the comparison of their sequences and, for example, will permit them
to quantify the extent of problems caused by these fungi and develop specific strategies
for their control.

Acknowledgements

The authors thank Dr. Ian Hall and Prof. Ursula Peintner for their manuscript presubmission
review and for the help in the arrangement of the manuscript.

Literature Cited

Agerer R. 1987-2002. Colour Atlas of Ectomycorrhizae. Einhorn-Verlag, Schwabisch Gmiind.

Agerer R. 1991. Characterization of ectomycorrhiza. In: Norris JR, Read DJ, Varma A. (eds.)
Techniques for the study of mycorrhiza. Methods in microbiology, vol 23, pp. 25-73. Academic
Press, London.

Altshul SF, Madden TL, Schaffer AA, Zhang JH, Zhang Z, Miller W, Lipman DJ. 1997. Gapped
BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acid
Research 25: 3389-3402.

Amicucci A, Potenza L, Guidi C, Rossi I, Bertini L, Zambonelli A, Stocchi V. 2002. Molecular
techniques in the study of edible ectomycorrhizal mushrooms. In: Hall I, Wang Y, Danell E,
Zambonelli A. (eds.) Edible Mycorrhizal Mushrooms and their Cultivation, Proceedings of
the Second International Conference on Edible Mycorrhizal Mushrooms, 3-6 July 2001,
Christchurch. New Zealand Institute for Crop and Food Research, CD-ROM.

Amicucci A, Rossi I, Potenza L, Zambonelli A, Agostini D, Palma F, Stocchi V. 1996. Identification
of ectomycorrhizas from Tuber species by RFLP analysis of the ITS region. Biotechnology
Letters 18: 821-826.

Bon M. 1997. Clé monographique du genre Inocybe (Fr.) Fr. (2éme partie: sous-genre Inocybe =
Inocybium (Earle) Sing.). Documents Mycologiques 28: 1-77.

Brundrett M, Bougher N, Dell B, Grave T, Malajczuk N. 1996. Working with Mycorrhizas in Forestry
and Agriculture. Australian Centre for International Agricultural Research, Monograph 32,
Canberra.

Chevalier G, Frochot H. 1997. La truffe de Bourgogne (Tuber aestivum Chatin). Pétrarque,
Levallois-Perret.

Dahlberg A. 2001. Community ecology of ectomycorrhizal fungi: an advancing interdisciplinary
field. New Phytologist 150: 555-562.

De Miguel AM, Saez R. 2005. Algunas micorrizas competidoras de plantaciones truferas.
Publicationes de Biologia, Universidad de Navarra, Serie Botanical6: 1-18.

Deacon JW, Fleming LV. 1992 Interactions of ectomycorrhizal fungi. In: Allen MJ. (ed) Mycorrhizal
Functioning an Integrative Plant-Fungal Process, pp. 249-300. Chapman and Hall, New York.

Donnini D, Bencivenga M. 1995. Micorrize inquinanti frequenti nelle piante tartufigene. Nota 2-
Inquinanti in campo. Micologia Italiana 24: 185-207.

Franchi P, Gorreri L, Marchetti M, Monti G. 2001. Funghi di ambienti dunali. Grafiche 2000,
Ponsacco.

Giomaro G, Sisti D, Zambonelli A, Amicucci A, Cecchini M, Comandini O, Stocchi V. 2002.
Comparative study and molecular characterization of ectomycorrhizas in Tilia americana and
Quercus pubescens with Tuber brumale. FEMS Microbiology Letters 216: 8-14.

Giomaro G, Zambonelli A, Sisti D, Cecchini M, Evangelista V, Stocchi V. 2000. Anatomical and
morphological characterisation of mycorrhizas obtained in vitro using Tilia platyphyllos Scop.
plantlets and five different strains of Tuber borchii Vittad. Mycorrhiza 10: 107-114.

Giovanetti G. 1983. Nella coltivazione il futuro del tartufo bianco. LInformatore Agrario 39: 27463-
27466.

Heim R. 1931. Le genre Inocybe, précédé dune Introduction générale 4 Etude des Agarics
Ochosporés. Encyclopédie Mycologique 1. Paul Lechevalier & Fils, Paris.

Horton TR, Bruns TD. 2001. The molecular revolution in ectomycorrhizal ecology: peeking into
the black-box. Molecular Ecology 10: 1855-1871.

Izzo A, Agbowo J, Bruns TD. 2005. Detection of plot-level changes in ectomycorrhizal communities
across years in an old-growth mixed-conifer forest. New Phytologist 166: 619-629.

Kuyper TW. 1986. A revision of the genus Inocybe in Europe. I. Subgenus Inosperma and the
smooth-spored species of Subgenus Inocybe. Persoonia Suppl. 3: 1-247.

Molina R, Massicotte H, Trappe JM. 1992. Specificity phenomena in mycorrhizal symbioses:
community-ecological consequences and practical implications. In: Allen MJ. (ed) Mycorrhizal
Functioning an Integrative Plant-Fungal Process, pp. 357-423. Chapman and Hall, New York.

Moser M, Jiilich W, Furrer-Ziogas C. 1994. Farbatlas der Basidiomyceten, III/29 Inocybe splendens.
Gustav Fischer Verlag, Stuttgart.

Moser M, Jiilich W, Furrer-Ziogas C. 1996. Farbatlas der Basidiomyceten, III/38 Inocybe rufuloides.
Gustav Fischer Verlag, Stuttgart.

Pirazzi R. 2001. Tuber magnatum Pico: un fungo micorrizogeno tardivo. In: Actes du V’ Congrés
International: Science et Culture de la Truffe, 4-6 mars 1999, Aix en Provence, pp. 233-236.
Federation Francaise des Trufficulteurs, Paris.

Richard F, Millot S, Gardes M, Selosse MA. 2005. Diversity and specificity of ectomycorrhizal
fungi retrieved from an old-growth Mediterranean forest dominated by Quercus ilex. New
Phytologist 166: 1011-1023.

Royal Botanic Garden 1969. Flora of British Fungi. Colour identification chart. Her Majesty's
Stationery Office, Edinburg.

Selosse MA. 2001. Avancées récentes dans étude des communautés et des populations
ectomycorhiziennes. Lejeunia 165: 1-108.

Sisti D, Giomaro G, Cecchini M, Faccio A, Novero M, Bonfante P. 2003. Two genetically related
strains of T: borchii produce Tilia mycorrhizas with different morphological traits. Mycorrhiza
LS wlO7=115.

Sourzat P. 2001. Evolutions technologiques et écologiques de la trufficulture en France et notamment
dans le département du Lot. In: Actes du V° Congres International: Science et Culture de la
Truffe, 4-6 mars 1999, Aix en Provence, pp. 419-424. Federation Francaise des Trufficulteurs,
Paris.

Stangl J. 1989. Die Gattung Inocybe in Bayern. Hoppea 46. Denkschriften der Regensburgishen
Botanischen Gesellschaft, Regensburg.

Trappe JM. 1987. Phylogenetic and ecologic aspects of mycotrophy in the angiosperms from an
evolutionary standpoint. In: Safir GR. (ed) Ecophysiology of VA Mycorrhizal Plants, pp. 5-25.
CRC Press, Boca Raton.

White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ. (eds.) PCR
protocol: a guide to methods and applications, pp. 315-322. Academic Press, S. Diego.

Yamada A, Katsuya K. 2001. The disparity between the number of ectomycorrhizal fungi and those
producing fruit bodies in a Pinus densiflora stand. Mycological Research 105: 957-965.

Zambonelli A, Iotti M, Zinoni F, Dallavalle E, Hall IR. 2005. Effect of mulching on Tuber aestivum
ectomycorrhizas in an experimental trufhere. New Zealand Journal of Crop and Horticultural
science 33: 65-73.

Zambonelli A, Iotti M, Giomaro G, Hall IR, Stocchi V. 2002. T: borchii cultivation: an interesting
perspective. In: Hall I, Wang Y, Danell E, Zambonelli A. (eds.) Edible Mycorrhizal Mushrooms
and their Cultivation, Proceedings of the Second International Conference on Edible
Mycorrhizal Mushrooms, 3-6 July 2001, Christchurch. New Zealand Institute for Crop and
Food Research, CD-ROM.

Zambonelli A, Iotti M, Rossi I, Hall IR. 2000. Interaction between Tuber borchii and other
ectomycorrhizal fungi in a field plantation. Mycological Research 104: 698-702.

MYCOTAXON

Volume 94, pp. 85-88 October-December 2005

Russula in Himalaya 1:
A new species of subgenus Amoenula

K. Das’, S.L. MILLER’, J.R. SHARMA,
P. SHARMA4, & R.P. BHATT*

daskanad@yahoo.co.in
' Mycology and Plant Pathology Group, Agharkar Research Institute
G.G. Agarkar Road, Pune 411 004, India

?Botany Department, University of Wyoming
Laramie, Wyoming 82071 USA

Botanical Survey of India, 192, Kaulagarh Road
Dehradun 248195, India

*Department of Botany, H.N. Bahuguna Garhwal University
Srinagar (Garhwal) 246174, India

Abstract—Russula mukteshwarica, a species closely related to R. violeipes, is proposed
here as new to science. Macro- and micromorphological characters of this species are
described and illustrated in detail.

Key words—macrofungi, Russulaceae, taxonomy, phylogeny, India

Introduction

Extensive investigation on Himalayan Russulaceae has been carried out by the authors
(Das & Sharma 2003, Das et al. 2003, Das & Sharma 2004, Das et al. 2004, Das &
Sharma 2005, Das et al. 2005) for the last eight years. During macrofungal surveys of
Kumaon and Garhwal Himalaya, the authors came across a species of Russula which
after thorough macro- and microscopic studies followed by molecular analysis appeared
to be an undescribed taxon and is proposed here as Russula mukteshwarica.

Materials and Methods

Macroscopic characters were noted from fresh material. Microscopic characterization
was done from dried material by mounting free hand basidiome sections in 5% KOH,
Melzer’s reagent, Congo red, Lactophenol-cotton blue and Carbol Fuchsin. Colour
terms follow Kelly & Judd (1955). Microscopic line drawings were made with the aid
of a camera lucida at original magnification of 1500x for basidiospores, 1000x for other
microstructures. Density of lamellae (L/cm) was measured at the margin of the pileus
excluding lamellulae. Spore print colour follows Romagnesi (1967). Basidiospores length
excludes the length of ornamentation. Basidium length excludes the length of sterigmata.

Quotient (Q = L/W) was calculated considering the mean value of length and width of
25 basidiospores. Herbarium names used follow Holmgren et al. (1990). Materials and
methods for rDNA sequencing followed those of Miller & Henkel (2004).

Description of the species

Russula mukteshwarica K. Das, S.L. Mill. J.R. Sharma & R.P. Bhatt sp. nov.
Figure 1
Etymology: From Mukteshwar, referring to the type locality.

Pileus 65-130 mm diam., planoconvexus, leviter depressus in centro, purpureus ad
violaceus. Lamellae adnatae, confertae, luteae. Stipes 45-87 x 14-27 mm, cylindricus,
purpureus. Sporae in cumulo albae, 7.6-9.3 x 7.3-8.2 um, subglobosae vel globosae,
amyloideae, verrucosae et incomplete reticulatae. Pleurocystidia 80-110 x 11-17 um,
fusiformia. Cheilocystidia 70-100 x 11-16 um. Pileipellis bistrata. Typus: INDIA,
Uttaranchal, Nainital, Mukteshwar, August 2003, leg. K. Das, KD2120 (HOLOTYPUS,
BSD; ISOTYPUS, TUR-A) ;

Pileus 65-130 mm diam., planoconvex, becoming umbilicate with depressed center at
maturity; pileipellis dry, viscid when moist, pruinose to subvelvety, dark purple, deep to
very deep purple or deep to dark violet, light to brilliant or very greenish yellow at the
center; margin slightly decurved, almost plain at maturity, irregularly lobed, splitted,
peeling up to 1/4" of the radius. Lamellae broadly adnate to adnexed, close (ca 7-9
per cm), forked from the base, brittle, cream to pale yellow or light greenish yellow;
lamellulae present; edges even. Stipe 45-87 x 14-27 mm, cylindric to subclavate, dry,
pruinose, light reddish purple at the top, gradually with white areas downwards but
always with a white rim between the juncture of lamellae and stipe, pale greenish yellow
(lemon yellow) at the base. Context stuffed, cream, changing light brown with phenol.
Taste mild. Spore print white (Ia).

Basidiospores 7.6-9.3 x 7.3-8.2 um, subglobose to globose (Q = 1-1.15, av. 1.05-1.10);
ornamentation amyloid, composed of warts (=0.75 um long) and ridges forming
incomplete reticulum. Basidia 30-45 x 7-9 um, subclavate to clavate, 4-spored;
sterigmata =6.5—7 um. Pleurocystidia 80-110 x 11-17 tm, abundant, emergent up
to 40 um, ventricose, subfusiform to fusiform, thick walled, content dense; wall up to
1.3 um thick. Lamellae edge fertile, composed of basidia and cystidia. Cheilocystidia
70-100 x 11-16 um, thick walled, same as pleurocystidia. Subhymenium layer narrow,
up to 12 um thick, cellular. Pileipellis two layered; upper layer composed of suberect to
erect subulate, septate hyphae, 5-11 um broad, pileocystidia absent; subpellis cellular.

Ecology - Russula mukteshwarica grows in close association with species of Quercus,
Rhododendron and Myrica in moist deciduous to mixed subtropical to temperate
(1800-2200 m) forests.

OTHER SPECIMENS EXAMINED: INDIA, Uttaranchal: NarniTAL, Mukteshwar, August
2003, leg. K. Das, KD2127; PirHoRAGARH, Dafia Dhura, September 2001, leg. K. Das &
J.R. Sharma, KD4082; Pauri, Nagdev forest on path to Snake Temple, June 2003, leg. P.
Sharma & S.L. Miller, PR310; ibid., June 2003, leg. S.L. Miller & P. Sharma, SLM 03-04, .
SLM 03-07; ibid., Khirsu, June 2003, leg. S.L. Miller & P. Sharma, SLM 03-22.

Fig. 1. Russula mukteshwarica (from holotype). a. Basidiomes. b. Basidiospores. c. Pleurocystidia.
d. Cheilocystidia. e. Cross-section of pileipellis. Bars: a = 10 mm; b-e = 10 um.

Comments - Typically subulate, up to 70 um long hyphal ends of pileipellis and absence
of dermatocystidia undoubtedly place the taxon in the subgenus Amoenula Sarnari. This
species resembles Russula amoenicolor Romagn., R. violeipes Quél. and R. amoena Queél.
from Europe. However, all these three species have a different spore print colour which
varies from Ila—IIc (Romagnesi 1996), or from Ia-IIa (Sarnari 1998). Moreover, the
red to purple colour of stipe base in R. amoenicolor; presence of distinctly globose lower
cells of the pilear hyphae in R. violeipes and the comparatively narrower pleurocystidia
and reddish stipe base in R. amoena further separate these three species from R.
mukteshwarica. Molecular analysis gathered from rDNA sequencing of the ITS gene

region (not shown) has also confirmed that the new species belongs to the subgenus
Amoenula and is closely related to R. violeipes.

Acknowledgements

We wish to express our gratitude to Dr. M. Sanjappa, Director and Dr. D.K. Singh, Joint Director,
Botanical Survey of India, Kolkata and Dr. V.S. Rao, Director, Agharkar Research Institute, Pune
for providing facilities during the present study. We are thankful to Mr. Jukka Vauras, Abo akademi
University (Turku, Finland) and Dr. L.L. Norvell (USA) for critically reviewing the manuscript and
checking the Latin diagnosis. This research was also partially supported by funding to S.L. Miller
from the National Science Foundation (DEB-0315607), USDA (2003-01542) and EPSCoR (04-
47681). We gratefully acknowledge Terry McClean from the Nucleic Acid Exploration Facility at
the University of Wyoming for sequencing these specimens.

Literature Cited

Das K, Sharma JR. 2003. New and interesting species of Lactarius from India. Mycotaxon 88:
7 I-38).

Das K, Sharma JR. 2003. New records of Russula from Kumaon Himalaya. Indian Journal of
Forestry 26 (3): 320-326.

Das K, Sharma JR. 2004. Lactarius in Kumaon Himalaya 2: New and interesting species of subgenus
Plinthogali. Mycotaxon 89 (2): 289-296.

Das K, Sharma JR. 2005. New records of Lactarius from India. Annals of Forestry 13 (1): 1-8.

Das K, Sharma JR, Verbeken A. 2003. New species of Lactarius from Kumaon Himalaya, India.
Mycotaxon 88: 333-342.

Das K, Sharma JR, Montoya L. 2004. Lactarius (Russulaceae) in Kamaon Himalaya. 1. New species
of subgenus Russularia. Fungal Diversity 16: 23-33.

Das K, Sharma JR, Basso MT, Bhatt, RP. 2005. Lactarius (Russulaceae) in Kumaon Himalaya 4: A
new species of subgenus Piperites. Mycotaxon 91: 1-7.

Holmgren PK, Holmgren NH, Barnett LC. 1990. Index Herbariorum. Part 1: Herbaria of the
world, 86" ed. Bronx: New York Botanical Garden.

Kelly KL, Judd DB. 1955. The ISCC-NBS Method of Designating Colors and a Dictionary of Colour
Names. ISCC-NBS Color-Name Charts Illustrated with Centroid Colors. National Bureau of
Standards Circular 553. U.S. Government Printing Office, Washington, DC.

Miller SL, Henkel TW. 2004. Biology and molecular ecology of subiculate Lactarius species from
Guyana. In C.L. Cripps, ed., Fungi in forest ecosystems - systematics, diversity and ecology.
New York Botanic Garden, vol. 89, pp. 297-313.

Romagnesi H. 1996. Les russues d’Europe et d'Afrique du nord. Bordas, Paris.

Sarnari M. 1998. Monografia illustrata del genere Russula in Europa. Tomo Primo. Italia. 799 pp.

7
;

MYCOTAXON

Volume 94, pp. 89-92 October-December 2005

Streptopodium passiflorae comb. nov.
on Passiflora rubra

J. R. LIBERATO * & R. W. BARRETO ?

jose.liberato@dpi.qld.gov.au
' Department of Primary Industries & Fisheries, Plant Pathology Herbarium
80 Meiers Rd, Indooroopilly, Qld 4068, Australia

? Universidade Federal de Vicosa, Departamento de Fitopatologia
Vicosa, MG, 36571-000, Brazil

Abstract — Reexamination of Ovulariopsis passiflorae, the causal agent of a powdery
mildew on Passiflora rubra, revealed that the fungus has dimorphic conidia and
conidiophores formed from the external mycelium, a combination of features typical
of Streptopodium. An emended description of this species is provided and the new
combination Streptopodium passiflorae is proposed.

Key words — Erysiphaceae, Phyllactinieae

Introduction

Ovulariopsis passiflorae Syd. (Erysiphaceae) was described on Passiflora rubra L. based on
a specimen collected in Venezuela by Sydow (1930). Its published description suggested
that its maintenance in Ovulariopsis Pat. & Har. under the present concept for the genera
in the Phyllactinieae (Braun et al. 2002) might be inadequate. A re-examination of the
type specimen was made, confirming this suspicion. This paper reports the results of
this new study of the type material and the nomenclatural change that resulted from it.

Material and Methods

In order to elucidate whether the conidiophores were produced from external or
internal mycelium, a critical feature for separating genera in the Phyllactinieae, a whole
leaf clearing and staining technique was used. Leaf pieces were immersed in solution of
50 g chloral hydrate in 20 mL of distilled water and left in stoppered glass vials at room
temperature, for 24 h. The leaf pieces were then mounted on microscope slides in 85%
lactic acid with aniline blue 1 g/L (Liberato et al. 2005). Only turgid and mature conidia
(those unattached to conidiophores) were measured.

Results

Dimorphic conidia were found, feature that excludes the possibility of this fungus
belonging to Ovulariopsis. The leaf clearing and staining technique enabled the
visualization of superficial hyphae entering the leaves through stomata, an indication

that the fungus has hemiendophytic mycelium (partly external and partly internal).
With a single exception [species belonging to Cystotheca (Braun 1987)], this feature
is exclusive to the tribe Phyllactinieae (Braun et al 2002). This technique also enabled
the visualization of conidiophores arising from external mycelium. This combination
of characters clearly indicates that the fungus belongs in the genus Streptopodium R.Y.
Zheng & G.Q. Chen emend. (Liberato et al. 2004).

Taxonomic Description

Streptopodium passiflorae (Syd.) Liberato & R.W. Barreto comb. nov. (emended)
Figs. 1-8
= Ovulariopsis passiflorae Syd. Ann. mycol. 28(1-2): 199, 1930.
On living leaves. Mycelium hypophyllous. Superficial hyphae branched, septate, hyaline,
flexuous, 4-6 um wide, mycelial appressoria indistinct. Conidiophores produced from
the external mycelium, cylindrical, hyaline, smooth, unbranched, septate, up to 264 x
5-7 um, foot-cells mostly straight or somewhat slightly sinuous, very long, followed
by 1-2 shorter cells. Conidia single, dimorphic: primary conidia lanceolate, apically
pointed, 54-84 x 14-28 um, I/w ratio 1.9-5.1; secondary conidia cylindrical to clavate
with apically rounded, basally subtruncate ends, 50-76 x 16-26 um, I/w ratio 1.9-4.8,
aseptate, hyaline, smooth. One germ tube per conidium, up to 2 x the length of the
conidium, with indistinct appressoria. Primary conidium with germ tube at base
or at apex, secondary conidium with germ tube arising from the conidial shoulder.
Teleomorph: not found.

SPECIMENS EXAMINED - VENEZUELA, La Victoria, Aragua, on Passiflora rubra L.,
31 Jan 1928, H. Sydow (HOLOTYPE: BPI 414143; ISOTYPE: K(m) 131785).

Discussion

There are few reports of powdery mildew on Passiflora. Oidium passiflorae Politis was
described from Greece (Politis 1938) and also reported in Germany (Braun 1998) and
Australia (Liberato 2006). Anamorphic Leveillula taurica (Lév.) G. Arnaud was reported
in Australia (Liberato 2006). Amano (1986) listed Passiflora spp. as hosts of these three’
species in some countries, although this author did not provide the original references
from such records. ‘The status of the two South African specimens, listed as Ovulariopsis
passiflorae (Doidge 1950), and of Ovulariopsis sp. reported in Colombia (Tamayo &
Pardo Cardona 2000) remain to be clarified. Misplacement of members of Streptopodium
in Ovulariopsis appears to have occurred with some frequency in the past. For instance
the powdery mildew of Tabebuia serratifolia (Vahl) G. Nicholson, originally identified
by Ferreira (1989) as Ovulariopsis sp. was recently recollected and described as the new
species Streptopodium tabebuiae Liberato & R.W. Barreto (Liberato & Barreto, 2005).
This work represents part of an ongoing study aimed at elucidating the status of some
dubious Ovulariopsis.

Now, there are five species included in Streptopodium: S. bonariense (Speg.) R.Y.
Zheng & G.Q. Chen (teleom.: Pleochaeta polychaeta (Berk. & M.A. Curtis) Kimbr. &
Korf) (Zheng & Chen 1978), S. caricae Liberato & R.W. Barreto (Liberato et al. 2004),
S. diospyri G.J.M. Gorter (Gorter 1988), S. passiflorae and S. tabebuiae (Liberato &

Figs 1-8. Streptopodium passiflorae (from isotype) (bar = 20 um). Figs 1-4. Conidiophores.
Figs 5-6. Primary conidia. Figs 7-8. Secondary conidia.

Barreto 2005). Moreover, three other species of Pleochaeta Sacc. & Speg. emend. have
unnamed anamorphs belonging in Streptopodium: P. indica N. Ahmad, A.K. Sarbhoy &
Kamal (Ahmad et al. 1995), P. prosopidis (Speg.) U. Braun (Braun 1987) and P. shiraiana
(Henn.) Kimbr. & Korf (Zheng & Chen 1978, Gorter & Eicker 1983).

Acknowledgements

The author acknowledges the herbaria BPI and K(m) for specimen loans and thank Dr Uwe Braun
(Martin-Luther-Universitat, Germany), Dr Hyeon-Dong Shin (Korea University) and Dr M.
Havrylenko (Universidad Nacional del Comahue, Argentina), who kindly reviewed the manuscript.
J. R. Liberato acknowledges financial support from the Brazilian Fundacao Coordena¢ao de
Aperfeicoamento de Pessoal de Nivel Superior (CAPES).

Literature Cited

Ahmad N, Sarbhoy AK, Kamal. 1995. New powdery mildews from India. Mycological Research
99; 374-376.

Amano K. 1986. Host range and geographical distribution of the powdery mildew fungi. Japan
Scientific Societies Press, Tokyo.

Braun U. 1987. A monograph of the Erysiphales (powdery mildews). Beih. Nova Hedwigia 89:
1-700.

Braun U. 1998. Neufunde Echter Mehltaupilze (Erysiphales) aus der BR Deutschland. Schlechtendalia
1: 31-40.

Braun U, Cook RTA, Inman AJ, Shin HD. 2002. The taxonomy of the powdery mildew fungi. Pp.
13-55 in Bélanger RR, Bushnell WR, Dik AJ, Carver TLW (Eds.) The powdery mildews: a
comprehensive treatise. APS Press, St. Paul.

Doidge EM. 1950. The South African fungi and lichens to the end of 1945. Bothalia 5: 1-1094.

Gorter GJMA. 1988. Die Suid-Afrikaanse BRUM: 2 (meeldouswamme). Annale Universiteit
Stellenbosch, reeks A3, 3: 1-64.

Gorter GJMA, Eicker A. 1983. Uncinula polychaeta, Pleochaeta and Streptopodium in South Africa.
Transactions of the British Mycological Society 81: 398-401.

Ferreira FA. 1989. Patologia florestal. Principais doengas florestais no Brasil. Sociedade de
Investiga¢des Florestais, Vicosa.

Liberato JR. 2006. Powdery mildew on Passiflora in Australia. Australasian Plant Pathology
35373=75)

Liberato JR, Barreto RW. 2005. Additions to the Brazilian Erysiphaceae: Ovulariopsis durantae sp.
nov. and Streptopodium tabebuiae sp. nov. Fungal Diversity 18: 95-106.

Liberato JR, Barreto RW, Louro RP. 2004. Streptopodium caricae sp. nov, with a discussion on
powdery mildew of papaya and an emended description of the genus Streptopodium and of
Oidium caricae. Mycological Research, 108: 1185-1194.

Liberato JR, Barreto RW, Shivas RG. 2005. Leaf-clearing and staining techniques for the observation
of conidiophores in the Phyllactinioideae (Erysiphaceae). Australasian Plant Pathology 34: 401-
404.

Politis J. 1938. Contribution a létude des champignons des [les Ioniennes. Praktika tes Akadémias
Athenon, 13: 602-610.

Sydow H. 1930. Fungi venezuelani. Annales Mycologici 28: 29-224.

Tamayo MP, Pardo Cardona VM (2000). Primeros registros y observaciones sobre mildeos polvosos
y blancos en granadilla (Passiflora mollissima (HBK) Bailey), curuba (Passiflora ligularis Juss.)
y otras pasifloraceas en Colombia. ASCOLFI Informa 26 (5): 40-42.

Zheng RY, Chen GQ. 1978. Taxonomic studies on the genus Pleochaeta of China. II. The imperfect
state of Pleochaeta: Streptopodium gen. nov. Acta Microbiologica Sinica 18: 181-188

MYCOTAXON

Volume 94, pp. 93-102 October-December 2005

Type revision of three Termitomyces species from India

BisHolTANe?? ly =ZeWweresays-J.Y¥AO*?

yaoyj@sun.im.ac.cn
'Systematic Mycology and Lichenology Laboratory
Institute of Microbiology, Chinese Academy of Science
Beijing 100080, China

*Mycology Section, Royal Botanic Gardens, Kew
Richmond, Surrey TW9 3AB, UK

°Graduate School of Chinese Academy of Sciences
Beijing 100080, China

Abstract—Taxonomic status of three Termitomyces species described from India, viz.
T. longiradicatus, T. quilonensis and T: poonensis, is discussed in this paper based on
examination of the type material. Termitomyces longiradicatus is proved to be asynonym
of T: heimii, and T. quilonensis and T. poonensis are conspecific with T: eurhizus.

Key words— Tricholomataceae, termite symbionts, nomenclature, taxonomy

Introduction

Termitomyces R. Heim is a paleotropical genus of agarics obligately symbiotic with
termites belonging to the subfamily Macrotermitinae (Isoptera). The Termitomyces
species are usually characterised by the termite association, pinkish spore print,
prominent perforatorium on the pileus and the subterranean pseudorhiza connected to
the comb in the termite nest. Termitomyces has been proved to be a monophyletic clade
in Agaricales based on molecular phylogenetic analyses (Moncalvo et al. 2000, Aanen et
al. 2002, Rouland-Lefevre et al. 2002, Fraslev et al. 2003).

Termitomyces was established with ten species and six forms in 1942 (Heim 1942a),
and more species and combinations were subsequently proposed by Heim (1942b,
1948, 1951, 1952, 1958) and by Otieno (1964, 1968). The genus was monographed
by Heim (1977) with 28 taxa, including 20 species and eight forms from Africa and
Asia. In the following decades, many new taxa were introduced, e.g. four from China
(He 1985, Zhang and Ruan 1986, Wei et al. 2004), seven from India (Natarajan 1975,
1977, 1979, Sathe & Daniel 1980, Sathe & Deshpande 1980, Dhancholia et al. 1991),
three from South Africa (Reid 1975, Van der Westhuizen & Eicker 1990), one from
Zambia (Pegler & Piearce, 1980) and another from Tanzania (Saarimaki et al. 1994),
eight from Cameroon (Mossebo et al. 2002) and five from South America (Gomez 1995;
this report requires confirmation because South America is beyond the distribution

* Author for correspondence

range of Macrotermitinae). In total, 68 taxa have been published in Termitomyces, with
81 names including combinations and autonames. The genus is currently placed in
Tricholomataceae R. Heim ex Pouzar (Kirk et al. 2001).

The eight new taxa, including seven species and one form described from India
are T. albidolaevis Dhanch. et al., T: heimii, T. indicus Natarajan, T: longiradicatus,
T. quilonensis, T. poonensis, T. radicatus Natarajan and T: microcarpus f. santalensis R.
Heim. Among these names, T: albidolaevis was invalidly published according to Art. 37.5
of International Code of Botanical Nomenclature (Greuter et al. 2000) and T. indicus
was considered to represent T. microcarpus f. santalensis (Pegler & Vanhaecke, 1994).
Many species of Termitomyces reported in India, e.g. T’ clypeatus R. Heim (Purkayastha
1985), T: eurhizus (Purkayastha 1985), T. heimii (Natarajan 1979), T: microcarpus (Berk.
& Broome) R. Heim (Natarajan 1983), T. radicatus (Natarajan 1977) and T. striatus
(Beeli) R. Heim (Purkayastha 1985), are also reported from China (Wei & Yao 2003).

In an ongoing project of Termitomyces species in China and worldwide, collections
from India, including the type material of T. longiradicatus, T. quilonensis and T. poonensis,
were kindly made available for study by the curator of the Herbarium of Mycology
and Plant Pathology Department, Agharkar Research Institute, Pune, India (AMH).
Examination of those specimens, compared with collections preserved in Mycological
Herbarium, Academia Sinica (HMAS), Herbarium of Cryptogams, Kunming Institute
of Botany, Academia Sinica (HKAS) and Herbarium, Royal Botanic Gardens, Kew (K),
reveals that T: longiradicatus, T: quilonensis and T: poonensis are later synonyms of other
species of Termitomyces. The results of this study are presented in this paper.

Materials and Methods

Dried specimens from the herbaria listed above were examined both macroscopically
and microscopically. The dried specimens were photographed and dimensions measured.
Most of the type specimens have been damaged, especially that of T: longiradicatus.
The following description is based on the examination of the herbarium material. For
microscopic studies, free-hand sections of dried basidiomata, including lamellae and
cutis, were prepared using a razor-blade and mounted in a 5% KOH solution. Size
ranges of basidiospores, basidia, lamella hyphae and cutis were measured using an
ocular micrometer. At least 30 basidiospores and 20 basidia of each mature specimen
were measured except otherwise specified. The microscopic characters were drawn with
the aid of a camera lucida.

Taxonomy

Termitomyces longiradicatus Sathe & J. T. Daniel [as ‘longiradicata’] in MACS Monograph
No. 1. Agaricales (Mushrooms) of South West India (Pune): 102 (1981) [as 1980].
Figs 1 & 2

Pileus 1.2-5.0 cm diam., campanulate or convex when young and then becoming plano-
convex with an umbonate perforatorium; surface pale brown at the center, greyish white
elsewhere. Lamellae cream, 3.0-4.0 mm broad, sinuate, crowded with lamellulae. Stipe
2.0 cm or longer, 0.5-0.8 cm diam., central, cylindric; surface pale brown. Pseudorhiza

0.5-0.7 cm diam., over 6.0 cm long; surface pale brown; smooth. Annulus broad and
thick, greyish white, double-ringed, persistent on the upper part of the stipe; consisting
of narrow, parallelly arranged hyphae of 2.0-5.0 um diam. Context fleshy, consisting
of thin-walled, inflated hyphae, 3.0-20 um diam. Basidiospores 7.0—8.5 x 4.0-6.0 um,
ellipsoid, inamyloid. Basidia 18.5-24 x 8.5-9.5 um, tetrasporic, clavate. Lamella-edge
heterogenous. Cheilocystidia 21-56 x 10.5-27 um, pyriform to inflated pyriform,
hyaline. Pleurocystidia 28-67 x 14.5-28 um, numerous, thin-walled, pyriform, hyaline.
Hymenophoral trama regular, with parallel, thin-walled, hyaline hyphae, 3.0-20 um
diam. Subhymenial layer narrow. Pileipellis an epicutis of radially parellel, repent hyphae,
up to 5.5 um diam.

Specimen examined: India: Kerala State, Peechi, solitary, associated with termite nest,

sine date, sine collector, AMH 4522 (holotype).

The color of pileus, stipe and pseudorhiza was observed from the dried material of the
holotype, but it was described in the protologue as ‘white-cream with pale grey tint’ for
the pileus, ‘white becoming creamish white’ for the stipe and ‘white’ for the pseudorhiza,
presumably from the fresh material. Pileus context and lamellae in the holotype are
seriously damaged by insects. There were only a few lamellae, basidiospores, basidia
and cystidia available for examination (Fig. 2), but the lamellae and the range of the
size of microscopic characters were described according to the original description. The
tissue of stipe and pseudorhiza is also badly damaged in the holotype and the interior
structure cannot be determined.

Termitomyces longiradicatus was described as close to T. heimii but different from the
latter in having much longer radicating stipe (25-32 cm when fresh, with pseudorhiza up
to 29 cm below the ground) and well-formed cheilocystidia (Sathe & Daniel 1981). From
the original illustration and the present observation, the length of the stipe described for
the holotype by Sathe & Daniel (1981) must include the pseudorhiza. However, the long
stipe (5-9 cm) and pseudorhiza (7-36 cm), together with numerous cheilocystidia in
the hymenium, have been reported in T: heimii (Pegler & Vanhaecke 1994). The length
of the pseudorhiza is determined by the depth of the termite comb and the cystidia
may be absent or present in species of Termitomyces. These are, therefore, not constant
taxonomic characters. Specimens with long pseudorhiza and numerous cheilocystidia
are found in many other collections from Asia, e.g.

China: Yunnan, Jinghong, bought on the local market, 3 Aug. 2003, T. -Z. Wei & Q. -B.,
Wang, W03-6, HMAS 77076; Mengla, Menglun, bought on the local market, 16 July
1990, J. -G. Shuai 1, HKAS 22668; the same locality, bought on the local market, 5 Aug.
2003, M. Li & T. -Z. Wei, W03-8, HMAS 77075. India: Andra Pradesh, Prakasam District,
Kansukur, on termite hills, Nov. 1980, C. -P. Roo, K(M) 94757; Tamil Nadu, Madras,
Chepauk, Madras University Campus, on termite nest, 8 Nov. 1977, K. Natarajan, KN129,
K(M) 94755 (holotype of T. heimii Natarajan). Malaysia: Selangor, Serdang, University
Patonian, symbiosis with Odontotermes sp., 9 July 1990, M. Vanhaecke T3, K(M) 16528.
Pakistan: Daska, on termite nests, 6 Aug. 1980, Ahmad 27757, K(M) 94753; Islamabad,
on termite nests, 6 Aug. 1977, Ahmad 27462, K(M) 94647.

All these collections share the same characters of T: heimii, as indicated by examination
of the type of the species. The morphological characters described for T. longiradicatus
by Sathe & Daniel (1981) and confirmed by the present study are within the range of
variation of T’ heimii.

Termitomyces heimii was originally described from Madras, Tamil Nadu, India
(Natarajan 1979) and is widely reported from tropical Southeast Asia (Natarajan &
Raman 1983, Purkayastha 1985, Pegler & Vanhaecke 1994, Turnbull & Watling 1999)
and southern China (Wei & Yao 2003). It is recognized by its large, smooth, white (grey
or brownish grey at the centre), subumbonate pileus and persistent annulus (Natarajan
1979, Pegler & Vanhaecke 1994). The large, white-cream (dark at the center), umbonate
pileus and the thick, persistent, broad, double-ringed annulus (Sathe & Daniel 1981, and
this study) make T: longiradicatus identical with T: heimii. Therefore, they are considered
conspecific here and T: longiradicatus is a later synonym of T. heimii Natarajan in
Mycologia 71: 853 (1979).

Most collections of T: heimii examined here were collected in July and August in
China and Malaysia, while the collections from India, including the holotype, were
made in November. There is another record of T: heimii from China, which was made
in the late season of the year (Yunnan, Mengla, Menglun, bought on the local market,
12 Nov. 1989, Z. -L. Yang 984, HKAS 22118), but with the stipe enlarged at the position
of annulus (Yang 1990). The late season in China and the enlarged stipe make the
collection very interesting for further study to compare with other material of the
species from India and other countries of Asia.

Termitomyces poonensis Sathe & S. D. Deshp. in MACS Monograph No. 1. Agaricales
(Mushrooms) of South West India (Pune): 36 (1981) [as 1980]. Figs 3 & 4

Pileus 6.0-7.8 cm diam., plano-convex with a prominently rounded perforatorium,
margin incurved with radially-arranged fine grey striae and spots; surface dark brown at
the centre, brown or orange brown elsewhere, smooth. Lamellae free, up to 4.0 mm wide.
Stipe over 9.5 cm long, 0.4-1.0 cm diam., central, cylindric at upper part, thickening
downward up to 1.8 cm diam. at ground level; surface grey, becoming orange brown
downwards, smooth and glabrous. Pseudorhiza over 3.5 cm long, tapering downward;
surface black. Annulus absent. Context fleshy, of inflated, hyaline, thin-walled hyphae,
3.0-25 um diam. Basidiospores 7.0-9.0 x 4.0-6.0 um, ellipsoid, subhyaline and thin-
walled. Basidia 15.0-20 x 7.0-12.0 um. Lamella-edge heterogenous. Cheilocystidia 21-54
x 17.0-25 um., obovoid to pyriform, hyaline, thin-walled Pleurocystidia 25-46 x 13.0-
28 um, pyriform, hyaline, thin-walled. Hymenophoral trama regular, 40-60 um wide,
of hyaline, thin-walled hyphae, 2.5-15.0 um diam. Subhymenial layer 10.0-15.0 um
wide, of branched hyphae, 2.0-5.0 um diam. Pileipellis an epicutis of dense, radially
parellel, repent hyphae, 2.0-5.5 um diam.

Specimen examined—India: Poona, in groups, on termite nests, sine date, sine collector,

AMH 4479 (holotype).

The color of basidiomata was observed from the herbarium specimen of the holotype,
whilst the color of the pileus was described as ‘smoke gray when young, becoming
platinum blonde with age; the stipe as ‘white’ and the pseudorhiza as ‘black in the
protologue, possibly based on fresh material.

Sathe & Deshpande (1981) proposed this new species on account of its ‘perforatorium
prominent and darker than pileus, monomorphic cheilocystidia, conidial elements
on pileus: However, the glabrous, exannulate stipe and the black pseudorrhiza are
reminiscent of T. eurhizus. Termitomyces eurhizus is a species with a wide distribution

Se
Se
Si ace @

C D

Figs 1-6. Photographs and line drawings of Termitomyces spp. from India. Figs 1-2. Termitomyces
longiradicatus (AMH 4522, holotype). Fig. 1. Habit. Fig. 2. A. Basidiospores; B. Basidia;
C. Pleurocystidia; D. Cheilocystidia. Figs 3-4. Termitomyces poonensis (AMH 4479, holotype).
Fig. 3. Habit. Fig. 4. A. Basidiospores; B. Basidia; C. Pleurocystidia; D. Cheilocystidia.
Figs 5-6. Termitomyces quilonensis (AMH 4546, holotype). Fig. 5. Habit. Fig. 6. A. Basidiospores;
B. Basidia; C. Pleurocystidia; D. Cheilocystidia.

(Saccardo 1887, Pegler & Rayner 1969, Pegler 1977, Samajpati 1981, Pegler & Piearce
1980, Piearce 1987, Wei & Yao 2003), and its pileus color and form are variable. The
color varies from grayish brown to dark brown and often darker in the center than
elsewhere. The perforatorium is obtusely conical to mucronate (Pegler & Vanhaecke
1994) and often prominent (Singer 1949, Purkayastha & Chandra 1975, Samajpati 1981,
Pegler 1986). The cheilocystidia are obovoid to pyriform (Pegler 1977, 1986, Pegler
& Vanhaecke 1994) or usually pyriform (Purkayastha & Chandra 1975, Purkayastha
1985). There have been quite a few synonyms for this species, e.g. T. cartilagineus (Berk.)
R. Heim (Pegler & Rayner 1969, Pegler 1977) and Agaricus sparsibarbis Berk. & Broome
(Pegler & Vanhaecke 1994). Termitomyces albiceps S. C. He, based on some collections
from Guizhou, China, was also suspected to be a synonym of T. eurhizus (Pegler &
Vanhaecke 1994). The monomorphic cheilocystidia (Sathe & Deshpande 1981) of
T. poonensis might be due to limited material examined, as the cheilocystidia of T. albiceps
were also described as pyriform (He 1985). The ‘transversely septate’ cheilocystidia in
the original description of T. poonensis were not found in the holotype by the present
authors. The conidial elements on pileus, mentioned in the protologue, are possibly
accidentally produced and have not been reported elsewhere for Termitomyces. Species
of Termitomyces can produce sporodochia bearing conidiophores in the fungus garden
within termite nest and the conidia produced by the conidiogenous hyphae were often
similar in size and form (Botha & Eicker 1991b). The conidial elements mentioned in
the protologue of T: poonensis are not a stable character and have never been used to
distinguish species in the genus. Judged from the morphology of basidiomata observed
from the holotype, T: poonensis is here considered a synonym of T. eurhizus (Berk.)
R. Heim in Arch. Mus. Hist. Nat. Paris, Sér. 6, 18: 140 (1942).
To confirm the above determination, the following collections of T: eurhizus were

also examined for comparison.

India: Bishnupur, Shillong, Meghalaya, 3 July 1984, R. -N. Verma, M107, K(M) 94642.

China: Yunnan, Mengla, Menglun, Xishaungbanna Tropical Botanical Garden, 8 Aug.

2003, G. -R. Hu & T. -Z. Wei, W03-27, HMAS 88326; the same locality and date, G. -R.

Hu & T. -Z. Wei, W03-21, HMAS 84723; the same locality, 4 Aug. 1988, Z. -L. Yang 262,

HKAS 21785; Yunnan, Simao, bought on the local market, 10 Aug. 2003, T. -Z. Wei &

Q. -B. Wang, W03-30, HMAS 85229; Sichuan, Chengdu, bought on the local market,

30 Aug. 2002, B. Wang 200252, HMAS 84529. Malaysia: Selangor, Serdang, Malesysen,

Universitat Pertanian, 7 July 1990, M. Vanhaecke, T9, K(M) 16525. Sri Lanka: Kandy

District, Peradeniya Botanic Garden, alt. 1600ft, 23 Oct. 1974, D. N. Pegler 2062, K(M)

94646.

Termitomyces quilonensis Sathe & J. T. Daniel [as ‘quilonesis’| in MACS Monograph No. 1
Agaricales (Mushrooms) of South West India (Pune): 103 (1981) [as 1980].
Figs 5 & 6

Pileus 3.3-6.5 cm diam, convex or up-turned, with an obtusely conical perforatorium,
slightly inflexed at the margin; surface dark brown at the centre and becoming paler
toward the margin. Lamellae free, up to 3.0 mm wide. Stipe 5.0 x 0.2-1.0 cm, cylindrical,
enlarged at ground level and forming a globose bulb up to 1.6 cm diam. below ground;
surface dark brown to almost black, smooth; solid. Pseudorrhiza over 3.0 cm long,
tapering abruptly downward below the bulb, solid; surface black. Annulus absent. Context

fleshy, of inflated, hyaline, thin-walled hyphae, 3.0-8.0 um diam. Basidiospores 8.0—9.0
x 4.5-5.5 um, ellipsoid, subhyaline and thin-walled. Basidia 17.5-30 x 6.0-8.5 um,
subhyaline, thin-walled, clavate, tetrasporic. Lamella-edge heterogenous. Cheilocystidia
25-41 x 12.0-27 um, pyriform to inflated pyriform, hyaline, thin-walled. Pleurocystidia
28-52 x 14.5-28 um, rare, broadly clavate or pyriform to inflated pyriform, hyaline.
Hymenophoral trama regular, 50-60 um wide, ofhyaline, thin-walled hyphae, 2.5-15.0 um
diam. Subhymenial layer 10.0-15.0 «um wide, of branched hyphae, 2.0-5.0 um diam.
Pileipellis an epicutis of dense, radially parellel, repent hyphae, 2.0—5.5 um diam.
Specimens examined: India: Kerala State, Quilin, solitary, on termite nest, sine date, sine
collector, AMH 4546 (holotype).

The color of pileus, stipe and pseudorhiza in the above description was taken from
the dried material of the holotype. In the protologue, the pileus was described as ‘gray
towards margin, brownish gray towards center’ the stipe as ‘white’ and the pseudorhiza
as ‘brownish black’ possibly from fresh material.

According to Sathe & Daniel (1981), T: quilonensis differs from T: poonensis in the
absence of conidia and in having bulbous base in the stipe. However, the stipe base of
T. poonensis is also enlarged slightly in the holotype as observed by the present authors.
As conidia are not a useful character to distinguish species in the genus (see above in
the remark for T. poonensis), absence of conidia cannot make T: quilonensis a distinct
species from T. poonensis. Further, as discussed above, Termitomyces poonensis is a
synonym of T. eurhizus. In fact, T: eurhizus is a species variable in morphology, but
can be easily recognized by its black-brown encrusted and cartilaginous pseudorhiza
(Heim 1942, Pegler 1977, 1986, Pegler & Vanhaecke 1994). The stipe of T. eurhizus
often expands at the base before attenuating into an elongate pseudorhiza (Pegler &
Rayner 1969, Pegler 1977), often but not always with a bulbous base (Pegler 1986).
The brownish gray pileus and the black pseudorhiza of T. quilonensis closely resemble
T. eurhizus, and the microscopic characters are all within the range of those of
T. eurhizus. Thus, T. quilonensis is considered as another synonym of T. eurhizus.

Discussion

The above three species of Termitomyces were proposed based on minor morphological
characters, e.g. cystidia, conidial elements, and the length or form of stipe or pseudorhiza
(Sathe & Deshpande 1981). Cystidia may be absent or present in Termitomyces species
(Van Der Westhuizen & Eicker 1990), and they could be found as either monomorphic
or polymorphic based on different materials examined (Pegler 1977, Pegler & Vanhaecke
1994). Conidia are asexual spores produced in termite combs or in cultures. The size
and form of conidia are similar in cultures, except for T: microcarpus which lacks
conidiophores and conidia (Botha & Eicker 1991a) and the presence of conidia on the
pileus surface might be accidental (Botha & Eicker 1991a). As the form of basidiomata
in Termitomyces depends very much on the symbiosis, especially the identity and
behaviour of the host termites (Piearce 1987), the length of pseudorhiza can vary with
the depth of the termitaria. The swollen stipe base is present in several species of the
genus, such as T. umkowaani (Cooke & Massee) D. A. Reid, T: bulborhizus T. Z. Wei et
al. and T. sagittiformis (Kalchbr. & Cooke) D. A. Reid. However, the bulbous base is not
stable in some species as discussed above in T. eurhizus.

100

Among the eight new taxa of Termitomyces described from India, two are well
recognized, i.e. T. heimii with a wide distribution in Asia (Pegler & Vanhaecke 1994,
Wei & Yao 2003) and T: microcarpus f. santalensis in India (Pegler & Vanhaecke 1994).
However, in addition to T. indicus (=T. microcarpus f. santalensis, see Pegler & Vanhaecke,
1994), three more have been proved to be synonyms of other species in the genus by the
present study, i.e. T) longiradicatus, T. quilonensis and T. poonensis. For the remaining
two, T. albidolaevis and T. radicatus, they also need further examination. Termitomyces
albidolaevis was proposed based on silvery white color of the pileus, considered
close to T! mammiformis f. albus R. Heim but different in the absence of conical
perforatorium and in having larger basidiospores (7.5-10.0 x 5.0-7.0 um, Dhancholia
et al., 1991), although the pileus was contradictorily described as ‘umbonate’ in the same
publication. In fact, T’ albidolaevis can be easily distinguished from T: mammiformis f.
albus by the absence of the annulus and the size of basidiospores (6-8 x 3.5-4.5 um
in T: mammiformis f. albus, see Pegler 1977) according to the original description and
illustration. Termitomyces albidolaevis is somewhat unique for its relatively large, white
pileus (11-16 cm), the whitish pseudorhiza and large basidiospores. Termitomyces
citriophyllus R. Heim is the most close species to T. albidolaevis in terms of the size of
pileus (9-10 cm) and of basidiospores (9-11x 6.7—7.7 um), but differs in the dark colored
(ochreous gray) pileus, and much larger basidia (30-49 x 12-15 um, compared with
17.0-27.5 x 5.0-7.5 um in T. albidolaevis), although the surface color of pseudorhiza
was never mentioned (Heim 1942a, 1977). Re-examination of the type material of
T. albidolaevis may confirm its status. Termitomyces radicatus is distinguished from
other species with small basidiomata, such as T. microcarpus, T. medius R. Heim &
Grassé and T. tylerianus Otieno, by the dark colored spiniform perforatorium, a short
pseudorhiza and the absence of pleurocystidia and cheilocystidia (Natarajan 1977).
However, the pseudorhiza were found terminating at a sclerotized disk and scattered
hymenial cystidia were detected in some material of T. radicatus from India and
Pakistan (Pegler & Vanhaecke 1994). Termitomyces radicatus was also considered by
Pegler & Vanhaecke (1994) to resemble T: clypeatus but much smaller and to differ from
T. microcarpus mainly in the presence of a short pseudorhiza. The differences among
T. radicatus, T. medius and T. tylerianus are also not very significant. Termitomyces
radicatus was distinguished from the other two by the pseudorhiza termitnating at a
sclerotized disc (Pegler & Vanhaecke 1994), but a disc-like structure in the base of the
pseudorhiza was also observed in other species, such as T. reticulatus Van der Westh. &
Eicker (Van der Westhuizen & Eicker 1990), although the latter is much larger in size.
Observation of such a structure depends much upon the intactness of the collection.
The terminal structure in the pseudorhiza of Termitomyces species may have been
destroyed in most collections because the pseudorhiza is connected with the nest of
termite. Detailed study of Termitomyces species with small basidiomata is required to
reveal the relationships of those species. A molecular systematic study of these species
is undergoing in this laboratory.

Acknowledgements

The authors are grateful to Drs Tobias Froslev and Zhu-Liang Yang for serving as pre-submission
reviewers and for their valuable comments and suggestions, to Drs Alaka Pande and Sanjay K. Singh
of AMH for the loan of Termitomyces specimens. This project is supported by the National Hi-Tech

101

Research and Development Plan (2004AA227100) from the Ministry of Science and Technology,
the National Science Fund for Distinguished Young Scholars (30025002) from National Natural
Science Foundation of China, and the Key Research Direction of Innovation Programme (KSCX2-
SW-101C) and the scheme of Introduction of Overseas Outstanding Talents, operated by the
Chinese Academy of Sciences.

Literature Cited

Aanen DK, Eggleton P, Rouland-Lefévre C, Froslev TG, Rosendah S, Boomsma JJ. 2002. The
evolution of fungus-growing termites and their mutualistic fungal symbionts. Proceedings of
the National Academy of Sciences of the United States of America 99: 14887-14892.

Botha WJ, Eicker A. 1991a. Cultural studies on the genus Termitomyces in South Africa. I. Macro-
and microscopic characters of basidiome context cultures. Mycological Research 95: 435-443.

Botha WJ, Eicker A. 1991b. Cultural studies on the genus Termitomyces in South Africa. I. Macro-
and micromorphology of comb sporodochia. Mycological Research 95: 444-451.

Dhancholia S, Bhatt JC, Pant SK. 1991. Studies on some Himalayan Agarics. Acta Botanica Indica
19: 104-109.

Froslevy TG, Aanen DK, Lzssge T, Rosendahl S. 2003. Phylogenetic relationships of Termitomyces
and related taxa. Mycological Research 107: 1277-1286.

Gomez LD. 1994 (1995). Una nueva especie neotropical de Termitomyces (Agricales:
Termitomycetaceae). Revista de Biologia Tropical 42: 439-441.

Greuter W, Mcneill J, Barrie FR, Burdet H-M, Demoulin V, Filgueiras TS, Nicolson DH, Silva
PC, Skog JE, Trehane P, Turland NJ, Hawksworth DL. 2000. International Code of Botanical
Nomenclature (St Louis Code). Koeltz Scientific Books, Kénigstein, Germany.

He SC. 1985. Taxonomic studies of Termitomyces from Guizhou Province of China. Acta Mycologica
Sinica. 4: 103-108.

Heim R. 1942a. Les champignons des termitiéres. Nouveax aspects d’un probleme de biologie et de
systématique générale. Revue Scientifique 80: 69-86.

Heim R. 1942b. Nouvelles Etudes sur Les Agarics Termitophiles dAfrique Tropicale. Archives du
Muséum National d’Histoire Naturelle, Séries. 6, 18: 1-60, pls 9-12.

Heim R. 1948. Nouvelles réussites culturales sur les Termitomyces. Comptes Rendus Hebdomadaires
des Séances de l’'Académie des Science 226: 1488-1491.

Heim R. 1951. Les Termitomyces du Congo Belge recueillis par Medame M. Goossens-Fontana.
Bulletin du Jardin Botanique de l’Etat 21: 205-222.

Heim R. 1952. Les Termitomyces du Cameroun et du Congo francais. Neue Denksehriften der
allgemeinen Schweizerschen Gesellschaft fur die gesammten Naturwissenschaften. 80: 1-29.

Heim R. 1958. Termitomyces. Flore Iconographique Champignons du Congo 7: 139-151,
pl. 23-25.

Heim R. 1977. Termites et Champignons. Société Nouvelle Des Editions Boubée, Paris.

Kirk PM, Cannon PF, David JC, Stalpers JA. 2001. Dictionary of the Fungi. 9th edn. CAB
International, Wallingford, UK.

Moncalvo JM, Lutzoni FM, Rehner SA, Johnson J, Vilgalys R. 2000. Phylogenetic relationships
of agaric fungi based on nuclear large subunit ribosomal DNA sequences. Systematic Biology
49: 278-305.

Mossebo DC, Amougou A, Atangana RE. 2002. Contribution a létude du genre Termitomyces
(Basidiomycétes) au Cameroon: écologie et systematique. Bulletin de la Société Mycologique
de France 118: 195-249.

Natarajan K. 1975. South Indian Agaricales I. Termitomyces. Kavaka 3: 63-66.

102

Natarajan K. 1977. A new species of Termitomyces from India. Current Science 46: 679-680.

Natarajan K.1979. South Indian Agaricales V: Termitomyces heimii. Mycologia 71: 853-855.

Natarajan K, Raman N. 1983. South Indian Agaricales. A list of species of Agarics and Boletes
reported earlier from South India. New Delhi: International Books and Periodicals Supply
Service: 169-182.

Otieno NC. 1964. Contributions to a knowledge of termite fungi in East Africa: the genus
Termitomyces Heim. Proceedings of the East African Academy 2: 108-120.

Otieno NC. 1968. Further contributions to a knowledge of termite fungi in East Africa: the genus
Termitomyces Heim. Sydowia 22: 160-165.

Pegler DN. 1977. A Preliminary Agaric Flora of East Africa. Kew Bulletin. Additional Series
Ol =o:

Pegler DN. 1986. Agaric Flora of Sri Lanka. Kew Bulletin. Additional Series 12: 251-258.

Pegler DN, Piearce GD. 1980. The edible mushroom of Zambia. Kew Bulletin 35: 475-491.

Pegler DN, Rayner RW. 1969. A contribution to the Agaric flora of Kenya. Kew Bulletin
23: 347-412.

Pegler DN, Vanhaecke M. 1994. Termitomyces of Southeast Asia. Kew Bulletin 49: 717-736.

Piearce GD. 1987. The genus Termitomyces in Zambia. The Mycologist 21: 111-116.

Purkayastha RP. 1985. Manual of Indian Edible Mushrooms. New Delhi: India Today & Tomorrow's
Printers and Publishers, pp.121-125.

Purkayastha RP, Chandra A. 1975. Termitomyces eurhizus, a new Indian edible mushroom.
Transactions British Mycological Society. 64: 168-170.

Reid DA. 1975. Contributions from the Bolus Herbarium 7: Type studies of the larger Basidiomycetes
described from Southern Africa. pp.1-255.

Rouland-Lefevre C, Diouf MN, Brauman A, Neyra M. 2002. Phylogenetic relationships in
Termitomyces of ITS: a first approach to elucidate the evolutionary history of the symbiosis
between fungus-growing termites and their fungi. Molecular Phylogenetics & Evolution
22: 423-429.

Saarimaki T, Harkénen M, Mwasumbi L. 1994. Tanzanian mushrooms and their use 3. Termitomyces
singidensis, sp. nov. Karstenia 34: 13-20.

Saccardo PA. 1887. Sylloge Fungorm 5: pp.1-1146.

Samajpati N. 1981. Some tropical edible mushrooms from India. Mushroom Science 11: 45-54.

Sathe AV, Daniel J. 1981 [as 1980] . Maharashtra Association for the Cultivation of Science (MACS),
Monograph No. 1: Agricales (Mushrooms) of south west India (Pune): 75-108.

Sathe AV, Deshpande S. 1981 [as 1980]. Maharashtra Association for the Cultivation of Science
(MACS), Monograph No. 1; Agaricales (Mushrooms) of South West India (Pune): 9-42.

Singer R. 1945. New genera of fungi-II. Lloydia 8: 139-144.

Turnbull E, Watling R. 1999. Some records of Termitomyces from old world rainforests. Kew
Bulletin 54: 731-738.

Van der Westhuizen GCA, Eicker A. 1990. Species of Termitomyces occurring in South Africa.
Mycological Research 94: 923-937.

Wei T-Z, Yao Y-J. 2003. Literature review of Termitomyces species in China. Fungal Science
22: 39-54 (in Chinese).

Wei T-Z, Yao Y-J, Wang B, Pegler DN. 2004. Termitomyces bulborhizus sp. nov. from China, with a
key to allied species. Mycological Research 108: 1458-1462.

Yang Z-L. 1990. A delicious tropical mushroom-Termitomyces heimii occurring in Yunnan, China.
Edible Fungi of China 9: 28. (in Chinese).

Zhang Z-F, Ruan X-Y. 1986. A new species of Termitomyces—Termitomyces macrocarpus Zhang et
Ruan sp. nov. Edible Fungi 5: 10-13. (in Chinese).

MYCOTAXON

Volume 94, pp. 103-110 October-December 2005

A review of the genus Gyromitra
(Ascomycota, Pezizales, Discinaceae) in Mexico

ROSARIO MEDEL

medelr@ecologia.edu.mx
Instituto de Ecologia, A.C. Unidad de Micologia
Km 2.5 antigua carretera Xalapa-Coatepec No. 351
Congregacion El Haya, 91070, Xalapa, Veracruz, México

Abstract—Gyromitra has three species in Mexico: G. ambigua, G. esculenta and G.
infula, of which G. ambigua is recorded for the first time. The three species are widely
distributed primarily in forest of Abies and Pinus-Quercus and rarely in cloud forests.
Some considerations of the G. esculenta complex are presented and a key to the
recognized species is provided.

Key words—taxonomy, species complex

Introduction

According to Kirk et al. (2001), the genus Gyromitra Fr. is composed of nearly fifteen
species. Usually, it has been considered to be closely related to three genera: Discina (Fr.)
Fr., Neogyromitra S. Imai and Pseudorhizina Jacz. These genera have a common excipular
structure, four nuclei per spores and paraphyses that are very similar; differences in
spore shape and ornamentation, ascoma shape and presence of a stipe are considered
quantitative (Harmaja 1969a, 1973). The relationships among these and other genera
are not clear (Harmaja 1969a). Gyromitra was placed first in the family Helvellaceae
Dumort. (Saccardo1889; Seaver 1928; Raitviir 1965; Dennis 1978, Korf 1972, Kimbrough
et al., 1990, Kimbrough 1991). However, O'Donnell et al. (1997) moved Gyromitra to
the family Discinaceae Benedix emend. N.S. Weber, Trappe & O’Donnell, and they
pointed out the necessity of doing phylogenetic studies within the genera of this family,
including Gyromitra and argued, in agreement with Harmaja (1969a), that Gyromitra
and Discina are congeneric (Eckblad 1968; Abbott and Currah 1997). Information on
the position of the genus Neogyromitra (Harmaja 1969a) is still wanting. Gyromitra also
needs a detailed survey to establish relationships among species. It may be composed of
two (Harmaja, 1973) or more subgenera (Mcknight and Batra 1974; Abbott and Currah
41997),

Gyromitra sensu lato, that is including Discina, comprises species with inamyloid
asci, elliptical, smooth ascospores, apothecia that are stipitate and bilobate or brain-like,
as well as those species with subfusiform to fusiform ornamented ascospores, apothecia
that are discoid, sessil or subsessil and medullary excipulum of textura intrincata. This
is the generic concept presented by Harmaja (1969a, 1973) and Pfister (1980). In Mexico

104

only the stipitate, bilobate or brain-like species have been found to date. G. esculenta is
variable in spore form and | follow Harmaja’s (1969a) spore types in the discussion
below to distinguish within this complex.

Gyromitra was recorded in Mexico for the first time by Herrera and Guzman (1961),
based on G. infula (as “Helvella infula Fr:’), growing in coniferous forests in the State of
Mexico and Federal District. There it has been known as an edible fungus, after being
boiled and the water being discarded. Later G. esculenta was recorded from Nuevo
Leén by Castillo et al. (1979). A third species Gyromitra melaleuca (Bres.) Donadini
(as Discina melaleuca Bres.) was reported from Jalisco State by Guzman-Davalos et al.
(2001).

Materials and methods

Eighty five specimens from the following herbaria were considered in this study:
ENCB, FCF, FCME, FH, H, IBUG, ITCV, K and XAL. Acronyms follow Holmgren et al.
(http://sciweb.nybg.org/science2/ih/searchih.html) with the addition of ITCV (Instituto
Tecnoldgico de Ciudad Victoria) and FCF (Facultad de Ciencias Forestales, Universidad
Auténoma de Nuevo Leon). Microscopic observations were made on sections mounted
in 10% KOH, for measurements of hymenial elements, and Melzer reagent and cotton
blue in lactophenol for observation of spore ornamentation and apiculi.

Results

Gyromitra in Mexico comprises three species: G. ambigua, G. esculenta and G. infula. G.
ambigua has not previously been reported in Mexico. The report of Gyromitra melaleuca
(as Discina melaleuca, Guzman-Davalos et al., 2001) is based on a misidentification.
Study of reference material (Tamayo & Gonzalez s.n., from Nevado de Colima mountain,
in Jalisco, IBUG), showed a superficial similarity to G. melaleuca, i.e. apothecium
discoid, with margin unevenly revoluted, and a short, nut-brown stipe; and spores 20-
22 x 10-12 um, with short spines and paraphyses 5-8 um wide and clavate. Nevertheless,
when mounted in Melzer reagent a positive reaction of the asci is observed indicating
it is a member of the family Pezizaceae. It is worth note that the record of G. melaleuca
from North America (Seaver 1928) is doubtful. Abbott and Currah (1997) suggest the
collection from the United States represents a different species since they consider
G. melaleuca to be restricted to Europe from where it was described.

Key to the recognized species of Gyromitra in Mexico

la. Apothecium gyrose or brain-like or rarely bilobate, thick, vinaceous brown,
reddish or violaceous, spores elliptical to fusoid 18-25 (-27) x (8-) 10-12.5 um

ue yetaG esculenta

1b. Apothecium saddle shape or rarely gyrose and narrow, brown orange or reddish-
DEOWIL pata: ten ae deat uke ems, oe een Og ioe ee oe ee ee ee ee

2a. Spores elliptical, walls without thickened poles, 17.6-25 x 7.2-10 um :. . . G. infula

2b. Spores elliptical-fusoid, (23-) 25-33 x (8-)10-12 um walls thickened at the poles
formins apiculi upto 2-5 jimi thick 2) 4ae see) 2 en eeeGuambicua

105

Gyromitra ambigua (P. Karst.) Harmaja, Karstenia 9: 17. 1969. Fig. 1-2
= Helvella ambigua P. Karst., Meddelanden af Societas pro Fauna et Flora Fennica 5: 53.
1879.

= Gyromitra infula var. apiculatispora Raitv., Eesti NSV Teaduste Akadeemia Toimetised
(Bioloogiline Seeria) 14 (3): 322. 1965 (fide Abbott and Currah, 1997)

The lobed or rarely brain-like, dark red-orange apothecia and fusoid spores, (23-) 25-33 x
(8-) 10-12 um, with thicker poles, as apiculi 2.5 um high, are the diagnostic features. The
ascoma of this species is very similar to G. infula, although the shape of some material
studied resembles G. esculenta. We studied the holotype material and found the spores to
measure 30-33 x 10-12 um, with apiculi of 2 um. Notes with the type material described
spores up to 40 um, but I have not seen spores longer than 33 um. Mexican material has
spores of (23-) 25-33 x (8-)10-12 um, with longer apiculi (up to 2.5 um) than as noted
in the type specimen. ‘The species was described in detail by Abbott and Currah (1997)
and Harmaja (1969b) from the United States and Europe. These collections represent
the first record of G. ambigua from Mexico. This species grows in soil or wood in Abies
religiosa and Pinus hartwegii forests, at altitudes of around 2900 m.

Studied material: MEXICO. Michoacan. Villa Madero Municipality, Cerro Cruz Gorda,
highway Patzcuaro-Tacambaro, 23/X/1979, Sanchez 8 (XAL). MORELOS. Lagunas de
Zempoala, road to Chalma, 12/X/1965, Diaz y Carmona s.n., (XKAL, ENCB). CANADA.
Prince Edward Island, Herb Ellis (FH). FINLAND. Tammela, 30/VII/1866, Karsten 3289
(holotype of H. infula var. similis, H). UNITED STATES. Michigan, /IX/1979, Beardslee
ne Fe).

Gyromitra esculenta (Pers.: Fr.) Fr., Summa VegetabiliumScandinaviae 2: 346. 1849.
Fig. 3-4
= Helvella esculenta Pers.:Fr., Commentarius Schaefferi icones pictas p. 64. 1800.
= Gyromitra bubakii Velen., Ceske houby p. 893. 1922 (fide Abbott and Currah, 1997).

The brain-like apothecia with vinaceous brown, reddish or violaceous tones are typical
of this species. There is a great deal of variability, as reported by Harmaja (1979a), in
G. esculenta, including hymenium folding, apothecial margins, color of the hymenium
and stipe. Harmaja attributes this variation primarily to environmental factors and
maturity of the material. He considered there to be three spores types within this group:
type I (G. esculenta s. str.), spores 18-23 (-25) x 10-12.5 um, elliptical to fusiform with
apiculi up to 0.5 um; type II (without any taxon assigned), spores 20-25 x 10-12.5 um,
subfusiform, apiculi up to 1 um, and type II (G. splendida and G. bubakii?), spores 22-30
x 10-12.5 um, fusiform, apiculi 0.6-1.2 um.

I regard G. esculenta to be a species complex that includes G. bubacii, G. esculenta s.
str., G. longipes Harmaja and G. splendida Raitv. All of these have very similar morphology
and spore size. Raitviir (1974) described G. splendida with deep violaceous tones in the
hymeniun and stipe, with a stipe longer than in G. esculenta, and subfusiform spores

23-28 x 11.5-13.5 um, with a perisporium thickened up to 2 um. This author pointed out
that the long stipe and not so broad cap were different than G. esculenta, but in the field
these species were indistinguishable. Harmaja (1979b) considered G. longipes to differ
from G. esculenta s. str., in its darker pileus and long stipe with violaceous tones and in
its fusiform spores 20-25 x 9-10 um, with apiculi up to 2 um. Huhtinen and Ruotsalainen
(2004), studying specimens from Finland, suggested the conspecificity of G. splendida

106

Table 1. Characters of the species G. esculenta complex

gyrose, vinaceous
0.5um

brown, reddish to
violaceous tones
stipe more or less
20-25
i o-1

G. esculenta (III) yea
= G. splendida, fusiform «10-125 0.5-1.5um
G. bubakii?
lightly gyrose, dark 30-25
G. longipes color with violet subfusiform Bo iG 1-2um
tones, long stipe

long*
ee

‘long = 2/3 of the total length of the ascocarp
and G. longipes. In fact, regarding morphological characters and measurements of
spores (type III of Harmaja), G. longipes and G. splendida seem to be the same (see Table
1). G. bubakii (Velenovsky, 1922) has smaller fruitbodies, longer stipes (2/3 of the total
length) and bigger spores 30-34 um than G. esculenta. The type of G. bubakii was study
by Moravec (1986), Abbott and Currah (1997) and Huhtinen and Routsalainen (2004).
For the former G. bubakii is a variety of G. esculenta, while for Abbott and Currah it is
conspecific with G. esculenta, and Huhtinen and Routsalainen considered it different
from G. esculenta. Moravec (1986) showed a continuous wall on the spore, but not in the
apiculi. The loss of apiculi is attributed to preservation in formaldehyde (Huhtinen and
Rouatsalainen 2004), but Kempton and Wells (1973) have suggested that spores of G.
esculenta four weeks old, lose their apiculi. Spores of G. esculenta seems to vary widely
in size. Most of the material studied from Mexico has elliptical to subfusiform spores
18-20 x (8-) 10-12.5 um, which correspond to type I. Nine of the studied specimens
presented subfusoid spores of 20-25 (-27) x 10-12.5 um with apiculi up to 1 um (type IT)
and only one specimen (Medel 11, XAL) had very large fusoid spores, 27-33 x 11.8-13.5
um, with apiculi of more than 1 um. Mexican material shows great variability in ascoma
shape, length and width of the stipe, but not in ascoma color. This variability was similar
to that found in the materials from Canada, England, Finland and the United States. To
understand this variability it will be necessary to study more material of G. esculenta
from the whole geographical range, particularly in order to judge the importance of
spore size in the taxonomy of the group. Regarding Mexican materials G. esculenta s.
str. is considered to have the following characters: spores of 18-20 (-27) x (8-)10-12.5
um, folded brain-like hymenia that are vinaeous brown, reddish or violaceous tones,

18-23 (-25)

G. esculenta (1) x 10-12.5

ellipsoid-

gyrose, dark- brown
to almost black with
violet tones, long
stipe

23-28
xl 1h5-13:5

107

a stipe, elliptical spores, and apiculi up to 1 um. This measurement falls in both spore
type I and II of Harmaja and coincides with the measurements cited by diverse authors
(Boudier 1905, Dennis 1978, Kempton and Wells 1973, De la Torre 1977, Weber 1988,
Abbott and Currah 1997). Moravec (1986) found that the spores in G. esculenta have
a wide continuous range of variation up to 29.5 um. I have not seen Mexican material
with spores longer than 27 um. Among the studied specimens, one of the collections
(Medel 11, XAL) could represent another taxon, because of the subfusiform spores 27-
33 x 11.8-13.5 um with apiculi of 1-1.5um.

At present there is no consensus about G. esculenta spore size. Moravec (1986)
suggested that the original description of G. esculenta by Persoon was based on
immature specimens. Harmaja (1979a) noted that the original concept of Helvella
esculenta needed clarification and he mentioned several names that he thought were
synonyms of G. esculenta. Abboth and Currah (1997) mentioned the type specimen is
unknown, and so a neotype should be selected. Full descriptions of G. esculenta can be
found in De la Torre (1977), Abbott and Currah (1997), Kempton and Wells (1973) and
Weber (1988). The species is humicolous and lignicolous, and grows in Abies religiosa,
Pinus, Pinus-Quercus and rarely in cloud forest at 2500-3600 m.

Studied material: MEXICO. COAHUILA. Arteaga Municipality, Las Carolinas, 27/
VII/1986, Garcia s.n. (ITCV); Arteaga Municipality, La Siberia, 19/X/2001, Medel s.n.
(FCF). DURANGO. Highway Durango-Mazatlan, 28/VII/1984, Garcia 434 (ITCV).
ESTADO DE MEXICO. Los Saucos, deviation to Valle de Bravo, highway Toluca-
Temascaltepec, 15/VIII/1982, Chac6n 345 (ENCB); National Park Lagunas de Zempoala,
highway to Chalma, 1/VII/1982, Chacén 287 (ENCB); Villa de Allende Municipality,
San Cayetano N of Agua Escondida, 5/IX/1982, Gonzalez 42 (ENCB); West side Paso de
Cortés, Popocatepetl Volcano, 26/IX/1986, Chacon 570 (ENCB); Escualango, East side
of San Rafael Atlixco, 7/X/1983, Hernandez 136 (ENCB). GUERRERO. Chilpancingo de
los Bravo Municipality, Cerro Palo Hueco, Omiltelmi, 14/8/1984, Gutierrez s.n., (FCME);
Km 2.5 desviation to Puerto del Gallo, 27/VIII/1983, Tapia s.n., (FCME). HIDALGO.
National Park El] Chico Sierra de Pachuca, 31/10/1981, Ramos s.n. (ENCB); El Chico
13/8/1965, Salas s.n., (ENCB). MICHOACAN. Zinapécuaro Municipality desviation to
Eréndira, San Pedro Jacuaro, Hernandez y Villegas 924 (FCME).TLAXCALA. National
Park La Malinche, 15/IX/1970, Rodriguez-Martinez 43 (ENCB). VERACRUZ. Xico
Municipality, Los Gallos, East side Cofre de Perote, Rico 951 (XAL); Xico Municipality,
near El Llanillo road Las Vigas-Tembladeras North side Cofre de Perote, Bandala 2654
(XAL); Calcahualco Municipality, near Tlacoteopa, road La Jicara Medel 891, 892, 893,
894, 895 (XAL); Cofre de Perote region, road Valle Alegre Park to Tembladeras, Ramirez-
Guillén 222 (XAL); IV Exposicién de Hongos del INIREB, 31/VIII/1986, Medel 11
(XAL); Cofre de Perote region, Valle Alegre Park, 13/VIII/2003, Guzmdn 35515 (XAL).

Gyromitra infula (Schaeff.: Fr.) Quél, Enchiridion Fungorum 272, 1886. Fig. 5-6

= Helvella infula Schaeff.: Fr.. Fungorum qui in Bavaria et Palatinatu nascuntur icones
4:105. 1774.
= Helvella friesiana Cooke, Mycographia seu icones Fungorum 1: 195, 1878.

The bilobate or saddle-shape, brown-orange apothecia and elliptic non-apiculate spores,
17.6-25 x 7.2-10 um, are characteristic of G. infula. This species has the widest distribution
of all the species reported in Mexico and is morphologically close to G. ambigua. Spore
size and the lack of apiculi are diagnostic features. Our material has spores of 17.6-20

108

[ 10 um

Figs. 1-6. Figs. 1-2. Gyromitra ambigua. 1: ascoma; 2: spores (showing apiculum). Figs. 3-4. G.
esculenta. 3: ascoma; 4: spores (with a short apiculum). Figs. 5-6. G. infula 5: ascoma; 6: spores

(-25) x 7.2-10 um. This is smaller than reported in the neotype specimen of G. infula
(designated by Harmaja, 1969b) that is also the lectotype of H. friesiana at K, in which
the spores reach a size of 20-25 x 8-10 um, according to my observations. Additional
descriptions of this species can be found in Abbott and Currah (1997), Kempton and
Wells (1973), De la Torre (1979) and Weber (1988). The species grows on wood, humus
or on burned soil, in forests of Abies religiosa, Pinus, and Pinus-Quercus and rarely in
cloud forests, at 2700-3500 m.

Studied material. MEXICO. COAHUILA. Arteaga Municipality, La Siberia,
15/8/1973, Guzman 11248, 11251 (ENCB), 21/IX/1980, Chacén 98 (ENCB).
DISTRITO FEDERAL. El Ajusco, near Pico del Aguila, 25/IX/1966, Fagoaga
15c (ENCB). DURANGO. Pueblo Nuevo munipality, El Mil Diez, Garcia 3470
(ITCV). ESTADO DE MEXICO, highway Toluca-Temascaltepec, deviation
to Valle de Bravo, 23/X/1986, Santillan 540 (ENCB); Texcoco Market, 8/
IX/1973, Velasquez 832 (ENCB); El Capulin, highway to Sultepec, Nevado de
Toluca, Nacional Park, 25/9/1983, Gonzalez 458 (ENCB); Nevado de Toluca,
highway to Sultepec, 2/IX/1983, Col6n 358 (ENCB); Nevado de Toluca, cerro El
Calvario, 24/IX/1983, Colén 378-A, 382 (ENCB); Villa Nicolas Romero Market,
17/10/1976, Baca s.n. (ENCB); Laguna de Ojotongo, highway Zempoala-

109

Chalma, 15/VII/1963, Guzmdn 5086, (ENCB); Rio Frio near Llano Grande,
highway México-Puebla, 13/VII/1968, Diaz 9, Guzman 1538 (ENCB); Temoaya
Municipality, Las Navajas, Kong-Luz 54 (ENCB) GUANAJUATO. El Zamorano,
near Tierra Blanca, 27/VIII/2000, Landeros 7-10B (XAL). MORELOS. Lagunas
de Zempoala, Rocha 10 (ENCB); Huitzilac Municipality, Lagunas de Zempoala
National Park, 26/7/1982, Aguilar s.n. (FCME). GUERRERO. Chichihualco
Municipality, between Carrizal and Puerto del Gallo, 12/7/1980, Lugo s.n., 12/
VII/1980, Villarias 52, 20/VIII/1983, Perez-Ramirez 467, Herrera s.n. (FCME);
Chilchihualco Municipality, between El Carrizal and Atoyac, Lugo 18 (FCME),
Chilpancingo de los Bravo Municipality, Palo Hueco, Omiltelmi, 14/8/1984,
Gutierrez s.n. (FCME). MICHOACAN. Ciudad Hidalgo Municipality, National
Park Cerro Garnica, 18/8/1983, Arrieta s.n. (FCME). MORELOS. Cuernavaca,
region of the Lagunas of Zempoala, 19/VIII/1982, Mora 429, Chacon 3613
(XAL). NUEVO LEON. Zaragoza Municipality, La Encantada, Garcia 2414, 8195
(ITCV); Zaragoza Municipality, El Viejo Hill, Garcia 2583 (ITCV): OAXACA.
Highway Tuxtepec-Oaxaca, between La Esperanza and Oaxaca, 25/VII/1977,
Pérez-Ortiz 695, (ENCB). PUEBLA. Chiautzingo Municipality, San Juan Tetla,
Cafiada Chamier, 27/10/1982, Gauzin s.n. (ENCB); South of Hidalgo, Medel
680 (XAL). VERACRUZ. Municipality de Xico, West side Cofre de Perote, Los
Gallos near El Rosario, Rico 934, 949, Montoya 240, Bandala 465, Pérez-Moreno
397, 477, Villarreal 1334, 2191, 2618, 2580, 2562, 2618 (XAL); Xico Municipality,
El Rosario near El Revolcadero, Montoya 330-A, 381, Bandala 357, 406,464,
Villarreal 631-A, 646,664, 1465, 1546, 2251 (XAL), Calcahualco Municipality near
Tlacoteopa, La Jicara road, 10/X/1998, Medel 890 (XAL). SWEDEN. Uppsala (ex
Herb. Berkeley lectotype of H. friesiana, K).

Acknowledgements

The author expresses her thanks to the following: Dr. Gast6n Guzman (Instituto de Ecologia at
Xalapa), Dr. Donald Pfister and Dr. Karen Hansen (Farlow Herbarium, Harvard University) for
critical reading the manuscript. Dr. Francisco Lorea and Donald Pfister improved the English,
Juan Lara Carmona helped in work in the Herbarium, Manuel Escamilla made the drawings and
Maricruz Peredo for the edition of plates. CONACYT provided financial support through a grant.
L also benefited from a stay at the Farlow Herbarium Harvard University where I was supported by
a fellowship provided by the Friends of the Farlow. Also I express my thanks to the Curators of the
following Herbaria: ENCB, FCF, FCME, FH, H, ITCV and K for the loan of specimens for study.

Literature cited

Abbott SP, Currah S. 1997. The Helvellaceae: Systematic revision and ocurrence in Northern and
Northwestern North America. Mycotaxon 62: 1-125.

Boudier E. 1905. Icones mycologicae ou iconographies des champignons de France, Paris.

Castillo J, Garcia J, San Martin FE. 1979. Algunos datos de la distribucion ecoldgica de los hongos
principalmente micorricicos, en el centro del Estado de Nuevo Leon. Bol. Soc. Mex. Mic. 13:
229-237.

_ Dela Torre M. 1977. Aportacion al estudio del genero Gyromitra Fr. em. Harmaja en Espafia. Bol.
Estacion Central de Ecologia 19: 33-38

Dennis RWG. 1978. British Ascomycetes. Cramer, Vaduz. 585 pp.

Eckblad FE. 1968. The genera of the operculate Discomycetes: A re-evaluation of their taxonomy,
phylogeny and nomenclature. Nyt. Mag. Bot. 15: 1-191.

110

Guzman-Davalos L, Ramirez O, Sanchez-Jacome MR, Chacon S. 2001. Ascomycotina conocidos
de Jalisco. Boletin IBUG 9: 11-23.

Harmaja H. 1969a. A wider and more natural concept of the genus Gyromitra Fr. Karstenia
9: 9-12.

Harmaja H. 1969b. A neglected species Gyromitra ambigua (Karst.) Harmaja n. comb. and G. infula
s. str. in Fennoscandia. Karstenia 9: 13-19.

Harmaja H. 1973. Amendments to the limits of the genus Gyromitra and Pseudorhizina, with the
descriptions of a new species Gyromitra montana. Karstenia 13: 48-58.

Harmaja H. 1979a. Notes on Gyromitra esculenta and G. recurva, a noteworthy species on western
North America. Karstenia 19: 46-49.

Harmaja H. 1979b. Studies on vernal species of Gyromitra and Pseudombrophila syn. Nannfeldtiella.
Ann. Bot. Fennici 16: 159-162.

Herrera T, Guzman G. 1961.Taxonomia y ecologia de los principales hongos comestibles de
diversos lugares de México. Ans. Inst. Biol. UNAM. 32: 33-135.

Huhtinen S, Ruotsalainen J. 2004. Notes on the taxonomy and ocurrence of some species of
Gyromitra in Finland. Karstenia 44: 25-34

Kempton PE, Wells VL. 1973. Studies in the fleshy fungi of Alaska VI. Notes on Gyromitra.
Mycologia 65: 396-400.

Kimbrough J, Chi-Guang W, Gibson JL. 1990. Ultrastructural observation on Helvellaceae
(Pezizales, Ascomycetes) IV. Ascospore ontogeny in selected species of Gyromitra subgenus
Discina. Can. J. Bot. 68: 317-328.

Kimbrough J. 1991. Ultrastructural observations on Helvellaceae (Pezizales, Ascomycetes). V. Septal
structures in Gyromitra. Mycol. Res. 95: 421-426.

Kirk PM, Cannon PF, David JC, Stalpers JA. 2001. Ainsworth & Bisby’s Dictionary of the Fungi.
9a. Ed., CABI Biocience, Surrey, 655 pp.

Korf RP. 1972. Synoptic key to the genera of Pezizales. Mycologia 64: 937-994.

Mcknight KH, Batra L. 1974. Scanning electron microscopy in taxonomy of gyromitroid fungi.
The Michigan Botanist 13: 51-64

Moravec J. 1986. A revision of the type of Gyromitra bubaci and the problem of ascospore size of
Gyromitra esculenta (Discomycetes). Ceska Mykologie 40: : 11-18

O’Donnell K, Cigelnik E, Weber N, Trappe J. 1997. Phylogenetic relationship among ascomycetous
truffles and the true and false morels inferred from 18s and 28s ribosomal DNA sequence
analysis. Mycologia 89: 48-65.

Pfister DH. 1980. On Peziza melaleucoides, a species of Gyromitra from the western United States.
Mycologia 72: 614-619.

Raitviir A. 1965. Taxonomical notes on the genus Gyromitra. Eesti NSV Teaduste Akadeemia
Toimetised (Bioloogiline Seeria 14(3): 320-324.

Raitviir A. 1974. A new species of Gyromitra from Estonia. Folia Cryptogamica Estonica 4: 25-32.

Saccardo PAM. 1889. Sylloge Fungorum VII. Discomycetae. J. Edwards, Ann Arbor. Michigan,
1143 pp.

Seaver FJ. 1928. The North American Cup-Fungi (Operculates). Reiprint, 1978. Lubrecht & Cramer,
Monticello, 377 pp.

Velenovsky J. 1922. Ceske houby 4-5: 633-650.

Weber NS. 1988. A morel hunter’s companion. A guide to the true and false morels of Michigan.
Michigan Natural Resources Magazine. Two Peninsula Press, Lansing 208 pp.

MYCOTAXON

Volume 94, pp. 111-125 October-December 2005

A new species and a new record of Lepiota
occurring in the Gulf of Mexico area

LETICIA MONTOYA & VICTOR M. BANDALA

montoya@ecologia.edu.mx bandala@ecologia.edu.mx
Biodiversidad y Sistematica, Instituto de Ecologia
PO. Box 63, Xalapa, Veracruz 91000, Mexico

Abstract — Two species of Lepiota are described from material collected in the central
area of Veracruz State, viz. L. trichroma, a new species proposed here, and L. hemisclera,
an unreported species from Mexico. Samples of both taxa were found in the cloud forest
(mesophytic or subtropical forest) surrounding Xalapa. Descriptions and discussions,
including illustrations of macro- and microscopic morphology of both taxa based on the
Mexican collections are provided. Microscopical observations after studying the lectotype
of Agaricus hemisclerus from Cuba, as well as material of Lepiota subcitrophylla from
Japan are included.

Key words — Agaricaceae, Stenosporae

Introduction

During recent fieldwork to monitor the macromycetes in the central region of Veracruz
state, several collections of two species of Lepiota, previously unrecorded in the region,
were found. One of these species, L. trichroma, presents a combination of macro- and
micromorphological characters that places it in an undescribed taxon belonging to the
group of spurred-spored species close to L. bichroma E. Horak, L. subcitrophylla Hongo,
and L. citrophylloides Sathe & S. M. Kulk. The other species corresponds to L. hemisclera
of which the present collections document the information of its morphological variation
and distribution range. The two Lepiota species studied were found at Santuario del
Bosque de Niebla (cf. Parque Ecolégico Fco. J. Clavijero in previous publications)
and the native wooded area of the Botanical Garden Francisco Javier Clavijero,
both corresponding to a cloud forest (subtropical or mesophytic forest according to
Rzedowsky 1978) protected by the Instituto de Ecologia (Xalapa), consisting of a mixed
association dominated by Quercus spp., Carpinus caroliniana Walter, Clethra mexicana
DC., Ostrya virginiana (Mill.) K. Koch and Liquidambar styraciflua L. var. mexicana
Oersted, which has been visited weekly throughout the year since 2002.

Materials and Methods

Macroscopic descriptions are based on the study of fresh material. Alphanumeric color
codes indicated in the descriptions refer to Kornerup and Wanscher (1967) and Munsell

112

(1994) (bold codes). Microscopic structures are described from hand sections of revived
tissues mounted in 3% KOH and Congo Red 1% aqueous solution. Measurements
and colors of the structures were observed in 3% KOH. The basidiospores were
measured in side view, 30 spores randomly selected from hymenophoral tissues were
evaluated in a single element per collection. When estimating spore dimensions part
of the recommendations by Heinemann and Rameloo (1985) were used. The first range
reported in the descriptions describes the variation within the collections and extreme
values are indicated in brackets (highest values of mean +2 SD in each sample). The
means of spore length, width and quotient Q (ratio of basidiospore length/basidiospore
width) were calculated in each collection, then x corresponds to the range of means
of length and width, and Q to the range of the mean values of Q of n collections. Line
drawings were made with the aid of a drawing tube. Herbarium acronyms are according
to Holmgren et al. (1990).

Taxonomy

Lepiota trichroma Montoya & Bandala sp. nov.
FIGURES 1-3

Pileus 8-35 mm, convexus vel plano-convexus, interdum tenui umbonatus, pallide
flavovirens, caerulescens, saepe rubigineomaculatus, subglaber vel minute subsquamulosus
(sub lente), squamulis obscurioribus. Lamellae liberae, confertae vel subdistantes,
flavidae, saepe rufomaculatae, caerulescens. Stipite 22-70 x 1-4 mm, cylindricus, pileo
concolor, caerulescens et rufomaculatus, fibrillosus vel minute subsquamulosus, squamulis
obscurioribus, ad basim interdum rhizomorphis rubescens observatis. Cortina fibrillosa,
mox destituta, interdum fibrillis apud annulus zonis instructo, raris ad pileus margin. Caro
flavidae, caerulescens, rufo maculatae (stipite). Basidiosporae 6-8.5 (-9) x 3-4 (-4.3)
um, elongatae, leves, calcaratae. Pleurocystidia nulla. Cheilocystidia 13.5-30 x 6-12 um,
clavata, ventricosa, vel utriforme. Pileipellis ex hyphis cilindraceis cutem formantibus,
elementa terminalis clavata, decumbentes vel ascendentibus, dispersus, in squamules saepe
inflata pileocystidia similis, 7-40 x 8-25 um, cumulus formantibus. Fibulae presentes.
MEXICO, Veracruz, Xalapa Co., km 2.5 via Xalapa-Coatepec, Instituto de Ecologia, Santuario
del Bosque de Niebla, 3 July 2003, Bandala 3776 (XAL Holotypus).

Etymology: Because of the yellow basidiomes which stain reddish and blue.

Pileus 8-35 mm diam., convex to plane-convex, sometimes weakly umbonate,
occasionally depressed at center, at first faintly tomentose, becoming variably minutely
squamulose (under lens) especially in the center, smooth or slightly rugulose, dry, pale
yellow (2A4, 4B5), lemon-yellow (1-2A4, 30A4-5), or sulphur-yellow (2B5, 30A3-4) (SY
8/6-8), caerulescent (especially on handling), with pale pinkish tinges, finally with red
or orange-oxide scattered stains, squamules brownish on yellow ground, these in groups
giving a dark (brown) coloration to the disc center; margin straight, entire or somewhat
eroded in age, obscurely striate, occasionally in parts bearing minute, fine fibrillose veil
remnants. Lamellae close to subdistant, rounded-free or faintly adnate, at times rather
seceding, subventricose, 3-4 (-5) mm broad, yellow (2A2, 3A4-B7) to sulphur-yellow
(30A3-A4), caerulescent, frequently with red or orange-oxide stains, finally stained dark
brown, edge entire, somewhat paler than the surfaces; lamellulae up to 4 different lengths.

113

Fig. 1. Lepiota trichroma. Basidiomes (Bandala 3776). Bar = 17 mm.

Stipe 22-70 x 1-4 mm, cylindric, straight, often slightly curved downwards, yellow (2A2-
2B5, 3A4, 4B4), concolorous with pileus, often with a brighter sulphur-yellow color near
lamellae attachment, commonly stained blue (or when handling), whilst other areas
irregularly stained red or reddish-brown to orange-oxide, finally becoming brownish
or dark brownish spotted; apex pruinose, fibrillose to minute squamulose downwards
(under lens), squamules scattered, darker; partially fistulose, filled with whitish fibers;
base concolorous, at times stained orange-oxide, more or less strigose by the presence
of white to pale yellowish mycelium, this often forms moderately coarse rhizomorphs.
Veil fibrillose, soon disappearing with age, occasionally as scant fibrils remaining at
annular zone or rarely at pileus margin. Context yellow, hygrophanous, caerulescent,
stained reddish-brown or reddish mainly in the inferior two thirds of stipe including the
rhizomorphs. Odor to rotten potatoes or herbs. Taste mild.

Basidiospores 6-8.5 (-9) x 3-4 (—4.3) um; x = 7.1-7.6 x 3.3-3.5 um, Q = 2.1-2.2, elongate,
spurred on lateral view and with a dorsal depression, pale yellowish-green to hyaline,
wall slightly thick, dextrinoid. Basidia 15-25 x 5-6.5 um, clavate, bi- or tetrasporic,
thin walled, hyaline. Pleurocystidia absent. Cheilocystidia 13.5-30 x 6-12 um, clavate,
broadly clavate or more or less narrowly utriform, often somewhat ampulliform, hyaline,
thin walled, numerous. Pileipellis a cutis composed of interwoven, cylindric hyphae
4-7 um broad, often ramified, clamped, at times ending in a projected or periclinally
oriented claviform element, often the scales with mounds of compactly arranged clavate,

114

NQO00 UU
ee a VZ

= —<——— SSS
SAIS

ase 5

richroma. habe eal ‘Rolie and scales
elements (Bandala 3 a Bas

DiS

Fig. 3. Lepiota trichroma. Cheilocystidia (Bandala 3776). Bar = 10 um.
broadly clavate or sphaeropedunculate pileocystidia-like elements, 7-40 x 8-25 um, 4-
7 um diam. at base, some more or less disposed in chains of 2-3 subisodiametric cells,
all terminal elements with yellowish wall and with yellowish-brown contents, slightly
thick walled (up to 0.5 um thick), at times with incrustations. Context hyphae 4-13
um diam., yellowish to yellowish-brown, thin walled, clamped. Hymenophoral trama
subregular, hyphae 2.5-18 um diam., cylindric to inflate, broad or sausage shape. Stipe
trama with somewhat parallel hyphae 5-8 um diam., thin or somewhat thick walled,
yellowish in KOH, clamped. Stipitipellis a cutis of hyphae 4-8 um diam., at times ending
in a sphaeropedunculate element 19-40 x 8-12 um or a subisodiametric cell up to 30

um diam., other hyphae with short lateral outgrowths, clamped. Clamp connections
present. A yellow sap is dissolved in KOH slides.

Habitat. Solitary to gregarious, at times caespitose, in small troops, on soil or among fallen
leaves or grass, near Carpinus caroliniana, at 1300 m.

SPECIMENS EXAMINED — MEXICO. Veracruz: Xalapa Co., km 2.5 old road Xalapa-
Coatepec, Instituto de Ecologia, Santuario del Bosque de Niebla, 26.V1.2002, Corona
68; 21.X.2002, Bandala 3714; 25.X.2002, Montoya 3958; 14.X1.2002, Corona 125;
26.VI.2003, Corona 263, 264; 3.V1I.2003, Bandala 3776 (Holotype, XAL). Instituto de
Ecologia, Botanical Garden Francisco J. Clavijero, native wooded area, 4. VII.2002 Montoya
3837, 3838; 27.1X.2002, Montoya 3922; 13.VII.2005 Bandala 3981 (all at XAL).

116

Other material studied — Lepiota subcitrophylla. JAPAN. OosHim1zu, Ibuki-sho, Shiga
Pref., on soil in Pinus densiflora-Quercus serrata forest, 1.[X.1973, leg. Z. Sugiyama
(TMI 1458); Kokoge, Tottori City, Tottori Pref., on soil in mixed Wood of Camellia,
Cinnamomum, Aphananthe, Phyllostachys, etc., 12.X1.1974, leg. E. Nagasawa (TMI
1847).

Remarks. Lepiota trichroma is readily recognized by its yellow, caerulescent basidiomes
developing pale pinkish, red or orange-oxide stains, the spurred spores, broadly clavate
or ventricose cheilocystidia and pileipellis irregularly covered with subisodiametric or
sphaeropedunculate terminal elements forming the scales of the pileus. The microscopic
characteristics (pileipellis structure, basidiospores, cheilocystidia) in combination
with color variation of the basidiomes, taxonomically separate L. trichroma from
phenotypically similar taxa in Section Stfenosporae (J. Lange) Kiihner (Bon 1981;
Candusso & Lanzoni 1990; Vellinga & Huijser 1993).

The blueing of the basidiomes is a characteristic rarely found among the species of Lepiota
with spurred spores (Akers et al. 2000; Horak 1980). Lepiota subcitrophylla described
from Japan (Hongo 1956) and depicted in Imazeki and Hongo (1983) iconography,
superficially recalls L. trichroma. The distinctive reddish colors of the basidiomes as
observed in the Mexican taxon, however were not described for L. subcitrophylla
(Hongo 1956; Imazeki and Hongo 1983) and there are also taxonomically important
morphomicroscopical differences. A re-examination of two Japanese collections of this
latter species (one of them, TMI 1458, determined by Hongo), revealed a pileipellis of
a trichodermis kind, composed of a disrupted layer of elongated (narrowly claviform,
subcylindric or narrowly lageniform) terminal elements 35-145 (-—160) x 6-14 (-16)
um, slightly bigger basidiospores [7-10 (-11) x 3-4 (-4.5) um, x = 8.7 x 3.3 um, Q =
2.67] and lamellae edges lacking cheilocystidia (fig. 4). Hongo (1956) reported, however,
cheilocystidia crowded, clavate to subcylindric or somewhat fusoid, 19-31 x 6-14 um
and dermatocystidia cylindric to clavate, 35-70 x 9.5-16 um.

When describing the Australian L. bichroma, Horak (1980) observed a resemblance
between it and L. subcitrophylla. The basidiomes of L. bichroma, as emphasized by Horak,
are not caerulescent, instead they are distinguishable by the deep lilac colors produced by
minute squamules or wart-like squamules of the pileus and stipe, respectively, on a pale.
yellow-orange background, therefore differing macroscopically from the Japanese taxon
and the Mexican L. trichroma. Furthermore, microscopically L. bichroma differs from L.
trichroma in its longer basidiospores (9-12 x 3-4 um) and the pileipellis characteristics
(a palisade of clavate to subfusoid elements 30-80 x 5-16 um, having a pale brown
encrusting and plasmatic pigment) (Horak 1980). Another species close to L. trichroma
is L. citrophylloides described from India (Sathe and Kulkarni 1980). Regrettably, it has
not been possible to study the holotype housed at AMH. Based upon descriptive data
provided by Sathe and Kulkarni (1980) L. citrophylloides can be separated from the
Mexican taxon by its apparently not caerulescent basidiomes lacking reddish tinges and
the umbonate pileus with olivaceous brown scales, white veil, crowded lamellae and
cylindric to narrowly clavate cheilocystidia 21-27 x 6-7.5 um.

The monitoring developed in a square plot of 640 m? in the cloud forest of Santuario
de Niebla showed that during 2002 to 2003 the basidiomes of this taxon occurred in 6

Fig. 4. Lepiota subcytrophylla. a-b: basidiospores; c-d: pileipellis elements (a, c: TMI 1847;
b, d: TMI 1458). Bar a-b = 10 um; c-d = 20 um.

118

subsquares (each of 1 m2), growing from solitary to moderately gregarious. It presented a
summer fruiting pattern, at times reaching the fall. Although the monitoring continued
throughout 2004-2005, it was recorded again until September 2005, only in the Botanical
Garden area.

Lepiota hemisclera (Berk. & M.A. Curtis) Sacc., Syll. Fung. 5: 66, 1887.
= Agaricus hemisclerus Berk. & M.A. Curtis, Jour. Linn. Soc. Bot. 10: 283, 1868
FIGURES 5-8

Pileus 40-75 mm diam., subglobose to subhemispheric when young, gradually convex,
becoming plane-convex or plane, moderately umbonate, at times finally almost plane-
concave, dry, somewhat hygrophanous, surface weakly wavy, with darker lines arranged
in a striking reticulate pattern on all the surface, the paler ground areas yellow-brown
to straw or wood yellow color (10YR8/6; 7/6), with the reticulum brownish, brownish-
orange or grayish-orange (5C5-6, 5B5); surface covered with abundant pyramidal to
echinate, blackish-brown, detersile scales, located often inside the mesh and distributed
in a more or less concentric pattern throughout the pileus, with the pileus expansion
they are more persistent towards the disc center where the mesh is denser, then this
area appears more uniformly brownish-orange or at least darker; the darker lines
glabrous in appearance but under lens faintly minutely fibrillose; margin at first more
or less inflexed, becoming straight, often undulate (especially in very expanded pilei),
not striate, at times minutely appendiculate in parts by veil remnants. Lamellae free,
crowded, initially arcuate in unexpanded pileus to subventricose, at times rather linear,
moderately narrow, 4-5 mm broad, some forked, with lamellulae of different size, whitish
or yellowish-white, edge concolorous, somewhat irregular. Stipe 45-80 x 7-12 mm,
cylindric, at times slightly widened towards the base, this latter often subbulbous, surface
faintly striate in the area below point of lamellae attachment, appressed squamulose
at half or two thirds of its inferior length, glabrescent upwards, whitish or yellowish-
white, the area above and below the ring pinkish-brown to brownish-orange (5AB4);
squamules brownish (5AB5); initially solid, with age becoming stuffed or fistulose;
base with white, somewhat coarse rhizomorphs. Veil pendant, superior, membranous,
double, whitish, more or less cottony-arachnoid below, persistent or partially persistent.
Annulus attached or semi-moveable, persistent, thick, with coarse, flattened, brown or
brownish, cremallation-like protuberances. Context whitish, unchanging, with yellow-
brown stains at stipe base, hygrophanous, fleshy-fibrous. Odor fruity. Smell mild.

Basidiospores 5-8.5 x 2.5-3 um; X = 7.1-7.7 x 2.7-2.8 um; Q = 2.7-2.8 [in the lectotype
6-8 (—8.5) x (2=) 2.5—3 (—3.5) um, x = 7.3 x 2:8 um, Q = 2.7], cylindric, somewhat
basally truncate, with a faint suprahilar depression, attenuated and slightly curved
towards the apex, hyaline to pale hyaline-greenish in KOH, yellowish in mass, at times
with dense and weakly refractive contents, smooth, thin to slightly thick walled (up to
0.5 um thick), dextrinoid or not dextrinoid. Basidia 13-16 x 5-6 um, bi- or tetrasporic,
clavate, thin walled, hyaline. Pleurocystidia absent. Cheilocystidia 14— 48 x 9-26 um
(28-63 x 7-17.5 um in the lectotype), clavate to broadly clavate or broadly utriform, at
times pedicellate, apically rounded and some appearing capitate, other at times nodulose,
occasionally mucronate, projecting beyond the hymenial layer, hyaline to yellowish,
frequently with dense, at times granulose, yellowish-brown contents (often appearing

119

Fig. 5. Lepiota hemisclera. Basidiomes and doce up (below) of the annullus (Bandala 3626).
Bar = 20 mm.

as a circular or irregular apically located vacuole), with some floating, refringent,
crystal-like elements, wall up to 1 um thick, numerous, clamped; apex at times with
mucilaginous remnants as a hyaline incrustation. Pileipellis a loose trichoderm of
approx. 450 um thick, consisting of interwoven hyaline, hyphae 3-5 um broad, thick-
walled (0.5-1 um thick), yellow-brown to yellow-green, clamped, at times there are some
intercalar rows of subisodiametric, clavate or subcylindric clamped elements, which
are similar to those forming the scales; pyramidal scales built of chains of versiform
elements (subisodiametric, ventricose, pyriform, subellipsoid, mucronate), 10-63 x
7-13 um, clamped, thick-walled (1-1.5 um), yellow or yellowish-brown, the wall clearly

a
S
y_
[2

Fig. 6. Lepiota hemisclera. a-b: basidiospores; c: elements of the scales on pileus; d: cheilocystidia
a, c: Bandala 3626; b, d:

121

appears more yellow than the contents or almost yellowish-green. Context hyphae 2-10
um diam., thin walled; with abundant sphaerocyte-like elements towards the hymenial
region, these of 15-40 um diam. Hymenophoral trama more or less regular, hyphae 2-16
um diam., with sphaerocyte-like elements towards the connection with the context. Veil
built by cylindric hyphae 2-12 um diam., thin or thick-walled (0.5-1 um thick), more
or less hyaline, with a slight greenish tint, similar to that of the pileipellis elements. Stipe
context with yellowish, somewhat parallel hyphae 4-16 um diam., thin or somewhat
thick-walled (< 1 um thick), clamped. Stipitipellis a loosely arranged tissue, composed
of hyphae 3-4 um thick, septate, curled, branched, clamped, at times ending in a more
or less clavate element of 6-7 um diam. at apex. Clamp connections present.

Habitat. Gregarious, on soil, among leaf debris, at times among dead leaves and
Selaginella, near Platanus, at forest edge, at 1300 m.

SPECIMENS EXAMINED — MEXICO. VERACRUZz: Xalapa Co., km 2.5 old road Xalapa-
Coatepec, Instituto de Ecologia, Botanical Garden Francisco J. Clavijero, native wooded area,
3.VII. 2002, Montoya 4008, Bandala 3626; 30.V1. 2003, Bandala 3768, 3769 (all at XAL).

Other material studied — CUBA. On logs, July 27 (year not mentioned), J. Wright 120
(Lectotype of Agaricus hemisclerus, K).

Remarks. This Lepiota species macroscopically can be recognized by the entirely
reticulate aspect of the pileus surface bearing pyramidal detersile scales, the persistent
thick, superior, cog-wheel-like annulus, pendant veil, and the appressed squamulose
inferior half of the stipe surface. These characteristics in combination with the cylindric
basidiospores and both swollen cheilocystidia and elements of pileipellis, taxonomically
distinguish L. hemisclera.

The diagnosis of this taxon is complemented with the above macro- and microscopic
data recorded on fresh collections gathered in Xalapa, as well as those observed after
re-examination of the lectotype of Agaricus hemisclerus. Two specimens collected in
Cuba by Ch. Wright (no’s 57 and 120) were cited in the original description (Berkeley
and Curtis 1868), one of them (120) selected later by Pegler (1987) as the lectotype.
The Mexican specimens are indistinguishable from specimen Wright 120, this latter
however, presents somewhat collapsed lamellae edges making difficult the study of
cheilocystidia, which more or less recover when mounted in KOH (cf. figs. 6-8). It is
also remarkable that the dextrinoid reaction of basidiospores is not always consistent
in both the lectotype and Mexican samples. In the brief original description, based
on the data recorded in fresh collections by Ch. Wright, Berkeley and Curtis (1868)
described the annulus as “..amplo reflexo...”” and with regard to the pileus surface
they recorded it as “.. sometimes prettily clouded..”. The pileus of the lectotype, like
that of Mexican collections, is certainly reticulate, the dry sample still exhibits a faint,
wide mesh produced by paler and darker areas (it also presents scattered, pyramidal
‘to echinate, detersile dark scales). The stipe bears a well preserved thick annulus (this
holding a membranous-cottony almost pendant veil) which on its outer side presents
brown, coarse, teeth-like protuberances. It should be pointed out that these two striking
macroscopic features unique for L. hemisclera were not mentioned in subsequent cites
after diagnosis of the species (Morgan 1906; Murrill 1911, 1914) including a more

Fig. 8. Lepiota hemisclera. a: basidiospores; b: cheilocystidia; c: elements of the scales on the
pileus (Wright 120). Bar a-b = 10 um, c = 20 um.

124

modern re-description (macro- and microscopic) of the taxon provided by Pegler (1983
as Cystolepiota, Pegler). A species with remarkable morphological similarities is Lepiota
aspera (Pers.: Fr.) Quél., which indeed differs macroscopically by its pileus lacking a
mesh, its pendant veil directly attached to the stipe (without an annulus unlike that
of Lepiota hemisclera), and the stipe bearing squamulose veil remnants (Horak 1980;
Candusso & Lanzoni 1990).

The information on L. hemisclera provided by Ovrebo (1996), Mata (1999) and Halling
and Mueller (2005) based on Costa Rican collections, and that by Lodge (www.cortland.
edu/nsf/lodlepi.html) on Puerto Rican samples agree very well with the Mexican and
Cuban (lectotype) specimens. The species is also known from Bolivia and Colombia
(Halling and Mueller 2005). These data indicate that L. hemisclera has a noticeable
distribution in the Neotropic through tropical and subtropical forests from the central
area of the Gulf of Mexico to the Caribbean, Central and middle South America. In the
cloud forest sites under observation near Xalapa, however, L. hemisclera, contrary to L.
trichroma above discussed, is a rarely encountered agaric.

Acknowledgements
We appreciate the collaboration of curators from K and TMI herbaria in the loan of specimens and
the help of Bidls. D. Jarvio and J.C. Corona during field explorations. We express our thanks to Drs.
A. Batista Pereira (Universidade Luterana do Brazil) and V. Migliozzi (Gruppo Micol. Bresadola
Trento-Roma) for reviewing the manuscript and providing suggestions. We appreciate suggestions
made by Dr. Lorelei Norvell (Mycotaxon Editor-in-Chief) during the press process, which also
helped to improve this paper.

Literature Cited

Akers BP, Angels SA, Kimbrough JW. 2000. Leucoagaricus viridiflavoides, a new species from
Florida, with notes on related taxa. Mycotaxon 76: 39-50.

Berkeley MJ, Curtis MA. 1868. Fungi Cubenses (Hymenomycetes). Jour. Linn. Soc. Bot. 10:
280-341.

Bon M 1981. Cle mongraphique des Lepiotes D’Europe (=Agaricaceae, tribus Lepiotaceae et
Leucocoprineae). Doc. Mycol 11: 1-77.

Candusso M, Lanzoni G. 1990. Lepiota s.]. Fungi Europaei 4. Saronno.

Halling R, Mueller G. 2005. Common mushrooms of the Talamanca mountains, Costa Rica. Mem.
New York Bot. Gard. 90: 1-195.

Heinemann, Rammeloo J. 1985. De la mesure des spores et de son expression. Agarica 6: 366-
380.

Holmgren PK, Holmgren NH, Barnett LC (eds.). 1990. Index Herbariorum. Part I. The herbaria of
the world, ed. 8. New York, 693 p.

Hongo T. 1956. Notes on Japanese larger fungi (8). Journ. Jap. Bot. 31: 144-149.

Horak E. 1980. On Australasian species of Lepiota S.F. Gray (Agaricales) with spurred spores.
Sydowia 33: 111-144.

Imazeki R, Hongo T. 1983. Colored illustrations of fungi of Japan vol. 1. Hoikusha Publ. 27" ed.,
Osaka, 181 pp.

Kornerup A, Wanscher JH. 1967. Methuen handbook of colour. 2nd ed., Methuen, London.
Mata, M. 1999. Macrohongos de Costa Rica. INBio, Santo Domingo de Heredia, 253 pp.

he)

Morgan AP. 1906. North American species of Lepiota. Jour. of Mycology 12: 195-203.’

Murrill WA. 1911. The Agaricaceae of tropical North America II. Mycologia 3: 79-91.

_ Murrill WA. 1914. Agaricaceae. North American Flora 10: 1-76.

Munsell soil color charts. 1994. Macbeth, New York, 4 p. + 9 color charts.

Ovrebo CL. 1996. The agaric flora (Agaricales) of La Selva Biological Station, Costa Rica. Rev. Biol.
Trop. 44 (Suppl. 4): 39-57.

Pegler DN. 1983. Agaric Flora of The Lesser Antilles. Kew Bull. Add. Ser. 9 HMSO, Kew, UK.

Pegler DN. 1987. A revision of the Agaricales of Cuba 1. Species descibed by Berkeley & Curtis.
Kew Bull.42: 501-585.

Rzedowski J. 1978. Vegetacién de México. Limusa, México, D.F.

Sathe AV, Kulkarni SM. 1980. Agaricales (mushrooms) of Karnatake State. Maharashtra Association
for the cultivation of Science, Monograph no. 1 Agaricales (mushrooms) of South West India:
43-73.

Vellinga EC, Huijser H. 1993. Notulae ad Floram Agaricinam Neerlandicam XXI, Lepiota section
Stenosporae. Persoonia 15: 223-240.

» ‘pei neta ancy h rye,
lant its «8 ots eadbeane acto 4
Ried? 00 eA da ’ geen ren gh
«sh gy oA 0 in, Kitueatietts Vet ihntnbd ont iii
det mine nab Vielernaeadawenbie .
i" oad eae, hsv een ie oxen oA, ?
vg (at us nicer Mae Sa nh Cetiiel wint wide Suullt heer - we fn

7 a an

Ty |
4 - i Bo nibble: nib brine 7 ‘ bine iy Amie wy ppalt ese |
a ‘ fortd aes 4 Aiewihie? crea Si
a Tey) eis J“ eae anya wa pt ‘ if gihountens - cy
ae : a . u | ce 7 . te i. Lea" ie 7 "7 7) t ot = es a : 2 Ji “f

7 , - f — 5 , * a we s ‘ i 2 he =
al _ is thal © ine a ’ We ciibedgerne vy 44 “ay y since |
we ut oo) Mipeh ply aga Vidor tlitiep aan ail sr ah Hh ove R ati 4 Mit eto Wt “apa re pen whee sad i.

opel 1 1 SoA ant RRL pity Bg viclib aes rl detizsy hold wxpleayttions, We bagueny oat fu ibe te Le

ti 5 q " in witet ay ‘ ,.
v TO MO i ie a taker’ cma} vi i Mig! wa Meuse via! Hirnsedets
om ai . a : — . 7
ih ‘rs P br - ho tae ae he Soe ere OTD te. a(n tat’ y we ing 4 ath, cc Vee a(>! ote sripgeite < apt
= . bie hae Ler Marte) seer“ Ae alae Maier) uring than A Swe . ea Le es
: ee ; ’ é , ‘ . evi oe. : ve. : a) : f :
we a. i se a : wi | Wi ’ : ‘ meen 21 ’ : Pw Kip ees i
u = j aL 7 7%
, p , A ‘i! ¥ 4 - Aa
cil : Litorathin Coca ar
y \ : »d , a ’ ' , Mr
" P14 12 : ie ‘ ih : 9 *| 7 os iis { fe + ps ents it. ya wei "i y Wer) N rm i a AAP war FUR: 7
y : Pints wsithae (Newey Mele. Rie dane Te Pen) ns
Preehdbne Mi), fsa ray Pea) Se i, Pel ¢ aafeny, era wires #4 » wih hat MGret Susi: Mat. 1¢s,
oS if * } as i % sibs J ;
; es ‘ Aine cn : ° "te ri ti a - y
me : ie ne “4
q - : f ‘ oe . j a fiia ’ i _
oh i eal APA ‘ yy) } a : aN Aba tree it 1% ary } “over | aye jit ay ity iA non Hae, mre ys ; '
: wl) F oa 7 A " ~ q * re vo i = +
7 : AX | ee Ai) eee a) By Patiae yc, € a ay w t/a oT Es 7
eg ih PLAIN Tee odes | vs ; ae: ue
>. We re ‘ rh ¥ a Mh th Af yar ay, bepih Bue 1. 4eu a he f ny o + : a
7 ‘ ay J ; 7
ne ‘eh tons yar rt Cy 8, ceed tot Say cee ai “n ra exch Ls, @ oes oh a Oy
, a 7 A rn
. ’ ' = a st
| Mey _ fit Did bs leer aa '%¢ no af, @ " ag. pl 7 a i é J Les, shee . 4
j Zz “| ) Zaye pe * P . iN .
ee ae iat > aiatt din nae oe al a aap rites the unten ty Sei) ) ¥
ie awe ° ) eh or a ts " pase “7 ‘ey ay
4 oy an) ] jasy as @ 1 7 ;

ne pi a Pe hes a P
i Me ia A ifs vaste sacl aN ‘haat ‘ yeni uct te herb af my i
. a sale a " Ae pa Ve ee an “Nia be Wes " Drea" ues, pee
“ ff om We ‘Mow ett one Sr a nai: oe vee iv a) : 7 “th 2 |
ae | a 7 ree eee ton a oN ¥

B98 ot > a
A

alee mprinalt ies tun te nai mt pee aay
nn vty cea a Fes ri ean! be : ey ; “i,

MYCOTAXON

Volume 94, pp. 127-132 October-December 2005

The connection of Dothidotthia aspera
(Botryosphaeriaceae) to a hyphomycetous anamorphic fungus,
Thyrostroma negundinis

ANNETTE W. RAMALEY

awramaley@yahoo.com
7 Animas Place
Durango, CO 81301 USA

Abstract—Dothidotthia aspera was believed to have a coelomycetous anamorph.
However, cultures of the fungus from several substrata, including species of Fendlera,
Acer, Euonymus, Symphoricarpos, and Robinia, were indistinguishable from cultures
of the Stigmina hyphomycete from the same substrata. This hyphomycete, Stigmina
negundinis, is transferred as Thyrostroma negundinis.

Key words—coelomycete, teleomorph

Introduction

Dothidotthia Hohn. is a member of the Pleosporales, Botryosphaeriaceae (Barr 1987),
a family comprising genera with immersed ascomata becoming erumpent to nearly
superficial on woody twigs, large-celled pseudoparenchymatous peridia, broad cellular
pseudo-paraphyses, and broad, bitunicate asci. Species of Dothidotthia were compiled and
described by Barr (1989), and a key to seven North American representatives provided.
Extensive synonymy was cited with species originally described in Amphisphaeria,
Dibotryon, Didymosphaeria, Gibbera, Gibberidea, Herpotrichia, Leptosphaeria,
Microthelia, Neodeightonia, Otthia, Parodiella, Plowrightia, Pseudotthia, and Valsaria.
Dothidotthia was known only in North America at that time. Redisposition of some
species inappropriately placed in Didymosphaeria (Aptroot 1995) extended the range
of Dothidotthia celtidis (Ellis & Everh.) M. E. Barr to Britain, and D. ramulicola (Peck)
M. E. Barr to numerous hosts and many locations in both hemispheres.

Anamorphs for the Botryosphaeriaceae are described as coelomycetous when known
(Barr 1987), and for Dothidotthia as associated coelomycetous Diplodia-like states
(Barr 1989, Kirk et al 2001). Cultures of Dothidotthia ramulicola (Barr 1989) produced
conidiomata with brown, mostly 1-septate conidia similar to those found in conidiomata
resembling and intermixed with ascomata on the substratum. Ascomata on the type
specimen of D. aspera (Ellis & Everh.) M. E. Barr are associated with conidiomata bearing
brown, mostly 3-septate conidia with an occasional longitudinal septum in one cell. For
the present study, specimens of Dothidotthia were collected from Fendlera rupicola A.
Gray, Symphoricarpos rotundifolius A. Gray, Euonymus alatus (Thunb.) Siebold, Robinia
neomexicana A. Gray, and Acer negundo L.

128

Following Barr’s present concept of the genus, all these collections represent D. aspera. A
few conidiomata with brown, 3-septate conidia similar to those described by Barr (1989)
on the D. aspera type, were present on the Symphoricarpos collection. Interestingly, a
different coelomycete with conidia having most of these traits was abundant on the
Robinia collection, anda third coelomycete with brown, aseptate conidia was abundant on
collections of Acer negundo. Of even greater interest, perhaps, ascomata on all collections
were accompanied by a hyphomycete bearing nearly identical conidia. Ascomata on
Fendlera, Robinia, Euonymus, and Acer were sometimes in the middle of hyphomycete
growth. These ascomata were young and vigorous, not being overgrown. Conidia in all
collections resembled those illustrated by Ellis (1971) and Hughes (1955) and others,
as well as that pictured by Shoemaker (1963) in his discussion of Griphosphaerioma
kansensis and Gibbera andersonii, a synonym of D. aspera. The hyphomycete, a species
of Stigmina s. lat., has large, brown, 2-septate, ellipsoid conidia born on percurrently
proliferating conidiogenous cells.

Stigmina Sacc. is a genus broadly interpreted by Ellis (1959, 1963) with species having
widely varying traits. To begin to resolve this situation, Sutton and Pascoe (1989)
proposed two groups, each comprising species within a range of similarities. Their
first group, Stigmina sensu stricto, includes those species that are foliicolous, associated
with stomata, with both immersed and superficial mycelium, and brown, distoseptate
conidia, born on percurrently proliferating conidiogenous cells, characters shared with
the lectotype. The second group they propose includes those Stigmina species nearly
exclusively restricted to stems, with pulvinate stromata, and brown, multiseptate
to dictyoseptate conidia born on conidiogenous cells that proliferate percurrently.
Thyrostroma Hohn. was offered as a suitable genus for species with these traits presently
in Stigmina. Hohnel (1911) established Thyrostroma for Coryneum compactum Sacc.,
a species with the above characters and the brown, dictyoseptate conidia specified in
the generic description. In addition, T. kosaroffi (Briosi) Héhn. was removed from
Steganosporium.

This study was undertaken to identify the anamorph of Dothidotthia aspera if it were
present among any of the three coelomycetes in the collections from Symphoricarpos,
Acer, and Robinia, or the hyphomycete present in all collections.

Materials and Methods

Anamorphs were cultured by placing conidia in a drop of sterile tap water in a Petri
plate of commercial potato dextrose agar (PDA, Difco) and spreading the droplet with a
sterile glass rod. Germinated conidia were transferred to PDA tubes. Conidia from the
Symphoricarpos collection were obtained from a tiny bit of mycelium abutting an ascoma.
At the time of transfer, each germling was examined with the compound microscope to
be certain it originated from a conidium and not a stray ascospore. However, all the
resulting cultures lacked vigor and grew very little. A second attempt to culture the
hyphomycete from a later collection from the same site yielded one healthy-appearing
colony from a single conidium. Teleomorphs were cultured by opening an ascoma in a
drop of sterile tap water, rinsing asci and groups of asci in three consecutive droplets of
sterile tap water, and isolating individual asci onto Petri plates of PDA. All cultures were

maintained on PDA in tubes at room temperature (RT, 18-22 C) in incident daylight
on a table top.

Results

Colonies of Dothidotthia and the associated hyphomycete originating from each
substratum showed small differences from such isolates from any other substratum.
In contrast, the ascomycete and hyphomycete isolates from any one substratum were
identical. Conidium production was rare in plates or tubes, but a few conidia were found
in at least one culture of Dothidotthia and one culture of the associated hyphomycete
from each substratum. Those conidia from the cultured hyphomycete and ascomycete
on a particular substratum were identical to one another. Neither colonies nor conidia
in cultures of the three associated coelomycetes with brown conidia resembled colonies
or conidia of Dothidotthia from any of the substrata.

Discussion

The slight differences among cultures from the different substrata as well as the similarity
of cultures from the hyphomycete and ascomycete on each substratum strongly
suggested the two are anamorph and teleomorph of the Dothidotthia species involved.
The connection was confirmed by production of hyphomycete conidia in cultures from
asci of the ascomycete from each substratum.

Four Stigmina s. lat. species which Sutton and Pascoe (1989) suggested could be
included in Thyrostroma have stout, 2-septate, smooth conidia resembling those on the
hyphomycete associated with all the above collections of Dothidotthia. These species
are S. trimera (Sacc.) B. Sutton from Robinia pseudoacacia, S. negundinis (Berk. & M. A.
Curtis) M.B. Ellis from Acer negundo, S. hartigiana (Sacc.) M.B. Ellis from Acer campestre,
and S. pallida (Ellis & Everh.) M.B. Ellis from Rhus, Malus, Cydonia, and Salix. Stigmina
pallida is based on Exosporium pallidum Ellis & Everh. for which E. rhoinum Dearn. &
Barthol. is considered a later name, and cited as a synonym of Sciniatosporium pallidum
(Ellis & Everh.) Morgan-Jones, an illegitimate name (Sutton 1972) proposed for many
Stigmina species (Morgan-Jones 1971) including S. pallida. Although found on an Acer
species, Stigmina hartigiana is an unlikely candidate for the Dothidotthia associate on
Acer negundo. The species is not reported from the U.S. (Farr et al 1989), and though
conidial size varies among collections, conidia of the Dothidotthia associate are broader
and longer than any conidia of S. hartigiana (Ellis 1959). The other three species are
problematic. Hughes (1955) treated these fungi as species of Coryneum and concluded
that study of collections and cultures from the different substrata were necessary as
these taxa were more readily identified by substrata than by their slight morphological
differences, that they might even represent a single species.

Cultures and collections used in the present study tend to support Hughes’ idea.
Comparison of conidial dimensions from all the substrata used in this study, all
associated with the same teleomorph, shows no clear separation from any substratum
or from conidial dimensions from the literature for Stigmina negundinis, S. trimera, and
S. pallida (Table 1). This lack of conidial size distinction as well as the broad distribution
of Dothidotthia aspera suggests these all represent a single species in agreement with

130

Table 1. Conidial size (um) for the Dothidotthia aspera associate and similar Stigmina

s.l. species

Fungus Substrate Reference
Stigmina pallida

39-48 X 16-19 Rhus toxicodendron Ellis, 1976

35.5-55 X 15.5-19.5 Rhus glabra Hughes, 1955

28-42 X 13-19 Rhus glabra Ellis & Everhart, in Hughes, 1955
Stigmina trimera

32.5-42 X 17.5-21 Robinia pseudoacacia Hughes, 1955

25-45 X 15-18 Robinia pseudoacacia Sydow, in Hughes, 1955
Stigmina negundinis

27-39 X 13-18 Acer negundo Hughes, 1955

25-38 X 12-18 Acer negundo Bilis 1971

26-33 X 13-16 Acer negundo Dennis, in Hughes, 1955
Dothidotthia associate

25.5-44 X 13-19 Euonymus alatus Ramaley 0411

29-41 X 14.5-19 Robinia neomexicana Ramaley 0412

35-47 X 16-21.5 Fendlera rupicola Ramaley 0403

28-37 X 13.5-17.5 Acer negundo Ramaley 0414

28-42 X 14.5-18.5 Acer negundo Ramaley 0415

28-40 X 13.5-17.5 Symphoricarpos rotundifolius | Ramaley 0418

Hughes’ observations and suggestion. The collections from Acer negundo necessitate
the anamorph of Dothidotthia aspera be designated Thyrostroma negundinis (=Stigmina
negundinis), the name with priority.

In Table 1, Stigmina trimera measurements are from Robinia pseudoacacia, not
R neomexicana, the species in this study. If D. aspera were found on R. pseudoacacia, and
ascus cultures were identical to those from conidial cultures of S. trimera, this Stigmina
species would be synonymous with Thyrostroma negundinis as suggested by Hughes
(1955) and supported by the information in Table 1. Similar studies with isolates from
any substratum of S. pallida would also place that species in synonymy. Dothidotthia
aspera is found on Rhus in British Columbia (Barr, personal communication) making
the synonymy of T: negundinis and T. pallida even more probable. However, T. pallida
is not included in the synonymy quoted here because more than one Thyrostroma-
like fungus may be present on Rhus species making cultures necessary for convincing
evidence. Kirk et al (9/25/04) list eighteen records for the genus Thyrostroma. Two
other species are considered synonyms of names included in this listing. None of the
sixteen descriptions which were obtained was identical to T: negundinis. Substrata were
different for any known for T. negundinis, and in all cases, conidia were multiseptate and
regularly dictyoseptate, characters specified in the generic description for Thyrostroma.
T. negundinis conidia are not dictyoseptate, but the species shares the other important
Thyrostroma traits suggested by Sutton and Pascoe (1989)—type of substratum, pulvinate
stromata, large, septate, brown conidia, and percurrently proliferating conidiogenous
cells.

LSI

Taxonomy

Most of the synonymy is quoted from Ellis (1959).

Thyrostroma negundinis (Berk. & M. A. Curtis) A. W. Ramaley comb. nov.

Basionym: Coryneum negundinis Berk. & M. A. Curtis in Berkeley, Grevillea, 2: 153.
1874.

Exosporium negundinis (Berk. & M. A. Curtis) Héhn., Mitteil. Botan. Inst. Tech. Hochsch.
Wien 6: 41. 1929.

Thyrostromella negundinis (Berk. & M. A. Curtis) Hughes, Canad. J. Bot., 31: 619. 1953.

Stigmina negundinis (Berk. & M. A. Curtis) M.B. Ellis, Mycol. Pap. 72: 44. 1959.

Sciniatosporium negundinis (Berk. & M. A. Curtis) Morgan-Jones, Canad. J. Bot. 49:
993=1009. 1971.

Helminthosporium subcuticulare Ellis & Everh., J. Mycol., 4: 114. 1888.

Coryneum negundinis Ellis & Everh., Bull. Torrey Bot. Cl. 24: 292. 1897.

Coryneum septosporioides Sacc. & P. Syd, Sylloge Fungorum 14: 1022. 1899.

Teleomorph—Dothidotthia aspera (Ellis & Everh.) M. E. Barr

Specimens examined: USA. CO: La Plata Co, ca 1.75 mile up Carbon Junction Trail,
dead twigs of Fendlera rupicola, 11.V.04, AW Ramaley 0403, BPI 871821; Durango, 7
Animas Place, dead twigs of Euonymus alatus, 29.V1.04, AW Ramaley 0411, BPI 871820;
beside Hwy 550 across from Animas View Drive, dead twigs of Robinia neomexicana,
6.VII.04, AW Ramaley 0412, BPI 871822; between Animas Place and Animas River,
dead twigs of Acer negundo, 8.VI1I.04, AW Ramaley 0414, BPI 871819; between Animas
Place and Animas River, dead twigs of Acer negundo, 12.VII.04, AW Ramaley 0415, BPI
871825; San Juan Co, ca 0.5 mile up Engineer Mountain Trail from turnoff at mile 52.5,
Hwy 550, dead twigs of Symphoricarpos rotundifolius., 24.V1.04, AW Ramaley 0410, BPI
871823; ca 0.5 mile up Engineer Mountain Trail from turnoff at mile 52.5, Hwy 550,
dead twigs of Symphoricarpos rotundifolius., 24.V1I.04, AW Ramaley 0418, BPI 871824.
Ascus cultures from 0403, 0410, 0411, 0412, and 0414 to CBS.

Acknowledgements

I thank Margaret Barr for her many contributions—sharing of her recent considerations of
Dothidotthia species, her report of D. aspera on Rhus, as well as her helpful review of this
manuscript. I also thank Keith Seifert for his input, editorial insertions, and suggestions about
Thyrostroma/Stigmina considerations, and Phyllis Kroupa, ILL librarian extraordinaire, for tracking
down elusive references.

Literature cited

Aptroot A. 1995. Redisposition of some species excluded from Didymosphaeria (Ascomycotina).
Nova Hedwigia 60: 325-379.

Barr ME. 1987. Prodromus to Class Loculoascomycetes. Published by the author. Amherst, MA.
168 p.

Barr ME. 1989. The genus Dothidotthia (Botryosphaeriaceae) in North America. Mycotaxon
34; 517-526.

Ellis MB. 1959. Clasterosporium and some allied Dematiaceae-Phragmosporae. II. Mycological
Papers 727 b=/>.

Ellis MB. 1963. Dematiaceous Hyphomycetes IV. Mycological Papers 87: 1-42.

Ellis MB. 1971. Dematiaceous Hyphomycetes. Kew. CAB International Mycological Institute.
608 p.

Ellis MB. 1976. More Dematiaceous Hyphomycetes. Kew. CAB International Mycological Institute.
207 Dp:

Farr DE, Bills GE Chamuris GP, Rossman AY. 1989. Fungi on Plants and Plant Products in the
United States. The American Phytopathological Society, 3340 Plot Kob Road, St. Paul,
Minnesota 55121, USA. 1252 p.

Héhnel F von. 1911. Fragmente zur Mykologie no 718, Uber Thyrococcum Sirakoffii Bubak. Sber.
Akad. Wiss. Wien 120: 470-473.

Hughes SJ. 1955. Microfungi II. Thyrostromella Hohn. and Thyrostromella Syd. Canad. J. Bot.
33: 341-349.

Kirk PM, Cannon PF, David JC, Stalpers JA. 2001. Ainsworth & Bisby’s Dictionary of the Fungi,
9 ed. Wallingford, UK. CABI Bioscience, CAB International. 655 p.

Kirk PM et al. - www.indexfungorum.org,- 9/25/04.

Morgan-Jones G. 1971. Sciniatosporium Kalchbr., and its synonyms Marcosia Syd., Stigmina Sacc.,
Thyrostroma Hohn., and Thyrostromella Syd., non Hohn. Canad. J. Bot. 49: 993-1009.

Shoemaker RA. 1963. Generic correlations and concepts: Griphosphaerioma and Labridella. Canad.
J. Bot. 41: 1419-1423.

Sutton BC. 1972. Sciniatosporium Kalchbr. Trans. Br. mycol Soc. 58: 164-167.

Sutton BC, Pascoe IG. 1989. Reassessment of Peltosoma, Stigmina and Batcheloromyces and
description of Hyphothyrium gen. nov. Mycological Research 92: 210-222.

———

MY COTAXON

Volume 94, pp. 133-135 October-December 2005

A new species of Pertusaria from Western Australia

ALAN W. ARCHER

alanw.archer@bigpond.com
National Herbarium of New South Wales
Mrs Macquaries Road, Sydney, N.S.W. 2000, Australia

JOHN A. ELIx

John. Elix@anu.edu.au
Department of Chemistry, Faculty of Science, Australian National University
Canberra, A.C.T. 0200, Australia

Abstract—Pertusaria subarida from Western Australia is described as new to science.
It is distinguished by asci with eight small ascospores and the presence of planaic acid
and 4,5-dichlorolichexanthone as major lichen substances.

Key words—lichens, taxonomy

Introduction

The lichen genus Pertusaria (Pertusariaceae, lichenized Ascomycota) in Australia is
reported to contain 128 species (Archer 1997) of which eight are found in Western
Australia. The only depsides occurring as major compounds in the Western Australian
species are 2’-O-methylperlatolic acid and subconfluentic acid present in P. gibberosa
Mill. Arg., 2’-O-methylperlatolic acid in P trachyspora A.W. Archer, and 2-O-
methylperlatolic acid, 2,2’-di-O-methylstenosporic acid, glomelliferic acid or confluentic
acid in P. trimera (Miill. Arg.) A.W. Archer. Our examination of recent collections from
Western Australia led to the discovery of an un-named species of Pertusaria containing
the depside, planaic acid as a major compound.

Planaic acid is uncommon in the genus Pertusaria. Hanko (1983) did not find this
compound in any European species and Dibben (1980) only reported planaic acid as
a trace accessory present with other C,-orcinol depsides in three taxa, viz: Pertusaria
neoscotica I. M. Lamb, P. paratuberculifera Dibben and possibly P sinusmexicani
Dibben.

Materials and Methods

The specimens studied are deposited in PERTH and CANB. The morphology of the
lichen specimens were examined using a Zeiss Stemi 2000C stereo microscope, and a
Zeiss Axiolab compound microscope. Chemical constituents were identified by thin
layer chromatography (Culberson 1972; Culberson et al. 1981; Culberson & Johnson
1982; Elix & Ernst-Russell 1993), high performance liquid chromatography (Elix et al.
2003) and comparison with authentic samples.

134

Taxonomic Description

Pertusaria subarida A.W.Archer & Elix, sp. nov.
Similis Pertusaria planaica A. W. Archer sed ascosporis minoribus differt.

Etymology: The specific epithet derives from the subarid habitats occupied by this
species.

Type: AUSTRALIA. Western Australia, Wotto Nature Reserve, First North Road, 21
km by road NE of Eneabba, 29°42’29"S, 115°24’37”E, 275 m, Eucalyptus woodland with
Melaleuca and laterite rocks, on Melaleuca, J. A. Elix 28871, 5 May 2004; holo: PERTH,
iso: CANB.

KEY CHARACTERS — ‘Thallus corticolous, off-white to pale fawn, surface smooth and dull,
somewhat rimose, lacking isidia and soredia. Apothecia verruciform, conspicuous,
scattered, sometimes confluent, flattened hemispherical, sometimes constricted at the
base, 0.7-1 mm diam. Ostioles inconspicuous, black, punctiform, 1 to 4 per verruca.
Ascospores 8 per ascus, hyaline, smooth-walled, 1-seriate, 40-65 um long, 18-32 um
wide. Chemistry — planaic acid (major), 4,5-dichlorolichexanthone acid (minor),
+2,4,5-trichlorolichexanthone (trace), +4-chlorolichexanthone (trace), +4,5-dichloro-
6-O-methylnorlichexanthone (trace), _+2’-O-methylperlatolic acid (trace), +2-O-
methylperlatolic acid (trace).

DISTRIBUTION — At present this species is known from three localities in subarid areas of
south-western Western Australia.

EcoLocy — ‘This species is corticolous on Melaleuca and Acacia. Common associated
species include Flavoparmelia rutidota (Hook. f. & Taylor) Hale, Haematomma
eremaeum R. W. Rogers, Hafellia tetrapla (Nyl.) Pusswald, Imshaugia subarida (Elix)
Elix, Parmeliopsis macrospora (Elix & J. Johnst.) Elix, Pertusaria gibberosa, P. trimera,
Physcia jackii Moberg, Ramalina inflata subsp. australis G. N. Stevens, Ramboldia
brunneocarpa Kantvilas & Elix and Usnea scabrida Taylor subsp. scabrida.

COMMENTS — Pertusaria subarida is a rare species characterized by asci with 8 relatively
small ascospores and the presence of 4,5-dichlorolichexanthone and planaic acid as the
major lichen substances. Planaic acid occurs as a major compound together with 4,5-
dichlorolichexanthone in three other Pertusaria species, P. leucothelia Mill. Arg. (Miiller
1895), P. planaica A.W. Archer & Elix (Archer & Elix 1992) and the recently described
P. siamensis Jariangprasert (Jariangprasert & Anusarnsunthorn 2005). However, P
leucothelia is characterized by the presence of 4 rough-walled ascospores per ascus and
is thus quite distinct from P. subarida. The new species is distinguished from P. planaica
and P. siamensis by its smaller ascospores; P. planaica has 8 smooth ascospores per ascus,
80-100 um long, and P. siamensis has 2-3 ascospores per ascus, 90-174 um long.
SPECIMENS EXAMINED — AUSTRALIA. Western Australia, Gwambygine Nature Reserve,
11 km S of York, 31°58'24”S, 116°48°38”E, 245 m, Acacia acuminata woodland with
scattered Melaleuca on river flats, on twigs of Melaleuca, J. A. Elix 31754, 22 April 2004
(CANB); Western Flora camp area, 20 km N of Eneabba, 29°37730”S, 115°13’30”E, on
branch of Acacia, E. McCrum WF257, 4-6 June 2005 (CANB, PERTH).

bags)

Acknowledgements

We thank the Western Australian Department of Conservation and Land Management for
- permission to collect lichens in Western Australia and our peer reviewers, Dr G. Kantvilas and Dr
Patrick M. McCarthy, for helpful amendments to the draft manuscript.

Literature Cited

Archer AW. 1997. The lichen genus Pertusaria in Australia. Bibliotheca Lichenologica 69: 1-249.

Archer AW, Elix JA. 1992. Further new species and new reports of Pertusaria (lichenised
Ascomycotina) from Australia. Mycotaxon 45: 417-431.

Culberson CE. 1972. Improved conditions and new data for the identification of lichen products by
a standardized thin-layer chromatographic method. Journal of Chromatography 72: 113-125.

Culberson CE, Culberson WL, Johnson A. 1981. A standardized TLC analysis of B-orcinol
depsidones. Bryologist 84: 16-29.

Culberson CE, Johnson A. 1982. Substitution of methyl tert.-butyl ether for diethyl ether
in the standardized thin-layer chromatographic method for lichen products. Journal of
Chromatography 238: 483-487.

Dibben MJ. 1980. The chemosystematics of the lichen genus Pertusaria in North America north of
Mexico. Milwaukee Public Museum, Publications in Biology and Geology, number 5: 1-162.

Elix JA, Ernst-Russell KD. 1993. A Catalogue of Standardized Thin Layer Chromatographic
Data and Biosynthetic relationships for Lichen Substances (2"* Edition). Australian National
University, Canberra.

Elix JA, Giralt M, Wardlaw JH. 2003. New chloro-depsides from the lichen Dimelaena radiata.
Bibliotheca Lichenologica 86: 1-7.

Hanko B. 1983. Die Chemotypen der Flechtengattung Pertusaria in Europa. Bibliotheca
Lichenologica 19: 1-296.

Jariangprasert S, Anusarnsunthorn V. 2005. Additional new taxa in the lichen genus Pertusaria
(Lichenised Ascomycota) from Thailand. Mycotaxon 91: 279-292.

Miiller J. 1895. Lecanoreae et Lecideeae Australienses novae. Bulletin de l'Herbier Boissier
3: 632-642.

MYCOTAXON

Volume 94, pp. 137-147 October-December 2005

Molecular evidence for the taxonomic status of
Metarhizium taii and its teleomorph, Cordyceps taii
(Hypocreales, Clavicipitaceae)

Bo HUANG’, CHUNRU LI’, RICHARD A. HUMBER’,
KATHIE T. HoDGE?, MEIZHEN FAN! & ZENGZHI Lr!

zzli@ahau.edu.cn
' Anhui Provincial Key Laboratory for Microbial Pest Control,
Anhui Agricultural University, Hefei 230036, China

? USDA Plant, Soil & Nutrition Laboratory
Tower Road, Ithaca, NY 14853, USA

> Department of Plant Pathology, Cornell University
Ithaca, NY 14853, USA

Abstract—ITS1-5.8S-ITS2 rDNA was amplified, cloned and sequenced from the
stroma of Cordyceps taii, mycelium of Metarhizium taii and cultures of M. anisopliae
var. anisopliae from China. Analysis of integrated data of different strains and varieties
of M. anisopliae and M. flavoviride from GenBank showed that Metarhizium taii should
be treated as a synonym of M. anisopliae var. anisopliae. The ITS1-5.8S-ITS2 rDNA
sequences of C. taii and M. taii are identical, indicating that the teleomorph of M.
anisopliae var. anisopliae is Cordyceps taii.

Key words—molecular systematics, anamorph-teleomorph connection, synonymy
Cordyceps brittlebankisoides

Introduction

Concern about adverse effects of chemical insecticides in the environment and
the growing problem of insecticide resistance has led to considerable interest in the
use of biological agents for control of insect pests (Leal et al. 1997). Many species of
entomogenous fungi play important roles in pest management in many countries.
Metarhizium anisopliae var. anisopliae (abbreviation: M.a. anisopliae) is one of the
most important entomogenous fungi, and has been used to control pests in America,
Brazil, Australia and China, with distinct economic and social benefits.

_ Green muscardine disease, one of the most common fungal diseases of insects, is
caused by several taxa in the clavicipitaceous anamorphic genus Metarhizium. Since
this genus was established, several new species or varieties have been described based
on seemingly minor morphological differences from M. anisopliae, the type of the
genus. These similarities have led some to believe that the taxonomy of this genus was

* Author for correspondence

138

badly confused (Milner et al. 1994). Rombach et al. (1986) recognized three species:
M. anisopliae (Metschn.) Sorokin, M. flavoviride W. Gams & Rozsypal, and M. album
Petch. Tulloch (1976) segregated the type species of the genus into two varieties, M. a.
anisopliae and M. anisopliae var. majus (J.R. Johnst.) M.C. Tulloch (abbreviation: M.a.
majus) primarily based on conidial length, and she accepted M. flavoviride. Rombach
et al. (1986) segregated M. flavoviride into the varieties M. flavoviride var. flavoviride
(abbreviation: M.f. flovoviride) and, by virtue of its smaller conidia, M. flavoviride
var. minus Rombach et al. (abbreviation: M.f’ minus). Rath et al. (1995) suggested —
(but did not validly publish) the ‘variety’ M. anisopliae var. frigidum based on the
ability of conidia to germinate at low temperatures and on patterns of hydrocarbon
utilization. The isolates assigned to this variety were found by Driver et al. (2000) to
be taxonomically heterogeneous and were characterized based on ITS sequences as
belonging in two clades of M. flavoviride. Guo et al. (1986) described three new species,
M. pingshaense Q.T. Chen & H.L. Guo, M. guizhouense Q.T. Chen & H.L. Guo and M.
cylindrosporae Q.T. Chen & H.L. Guo. Metarhizium biformisporae A.Y. Liu et al. (1989)
should be treated as a heterotypic (facultative) synonym of M. cylindrosporae. Liu et al.
(1989) described two types of conidia being produced by M. cylindrosporae - an ability
not noticed by Guo et al. (1986) - and it appears that the description of M. biformisporae
is best treated as an amplified description of M. cylindrosporae. In any event, the latter
species was transferred into the genus Nomuraea, another clavicipitaceous anamorphic
genus, by Tzean et al. (1993). Liang et al. (1991) named M. taii isolated from the new
species, Cordyceps taii Z.Q. Liang & A.Y. Liu, and postulated a connection between C.
taii and M. taii based on microcyclic conidiation. Liu et al. (2001) collected a single
specimen and described it as a new species, Cordyceps brittlebankisoides Zuo, Y. Liu et
al., whose anamorph (confirmed by the identical ITS sequences from the teleomorphic
stroma and in vitro culture) was identified as M. a. majus.

Recently developed molecular techniques, and particularly DNA sequencing, provide
valuable tools for studying phylogenetic relationships and clarifying the taxonomic
position of confusing species. Molecular techniques have been used by several authors
to study genetic variation and taxonomy of Metarhizium. Liu et al. (1994) determined
partial sequences for selected regions from small (18S) and large (28S) subunit rRNAs of
species of Metarhizium. Curran et al. (1994) sequenced PCR products from ITS1-5.8S-
ITS2 rDNA regions of 31 strains of Metarhizium, and found 19 kinds of ITS1-5.8S-ITS2
rDNA regions. Rakotonirainy et al. (1994) sequenced the D1 and D2 expansion region
of 28S rDNA from 42 strains of Metarhizium. The above results collectively confirmed
(i) the monophyly of the genus Metarhizium; (ii) the separation of M. anisopliae and
M. flavoviride; and (iii) the need to subdivide M. anisopliae into several varieties or
species. |

Driver et al. (2000) partially resolved the taxonomy of Metarhizium using sequence
data and RAPD patterns; ITS sequence data were recognized as the most important
taxonomic criterion. Based on distinctive ITS sequences, M. flavoviride and M. anisopliae
were recognized to include five and four clades, respectively. In addition to recognizing
M. album as a distinct species, the classification of Driver et al. (2000) divided M.
anisopliae into four varieties and M. flavoviride into four named varieties plus one other
clade not treated as taxonomically distinct. The four species of Metarhizium described
from China (Guo et al. 1986, Liang et al. 1991) have apparently not been deposited in

189

readily accessible culture collections and, therefore, were not included in the molecular
analyses by Driver et al. (2000).

During investigation of the Cordyceps resources in China, a C. taii specimen was
collected in the Dabeishan Mountains, and its presumptive anamorph, M. taii, was
isolated from the specimen. The relationship between Cordyceps and Metarhizium was
originally determined by comparison of microcyclic conidiogenesis and ascospores
(Liang et al. 1991), but this important result needed more proof. The aim of this study
was to providegenetic verification of the connection between C. taii and M. taii and to
clarify the taxonomic status of M. taii by comparison of its ITS sequences with those of
other Metarhizium isolates already included in GenBank.

Materials and methods

Fungal isolates—A specimen of M. taii (HS00060501) occurring as a pathogen of a
noctuid (lepidopteran) larva was collected from Huoshan County, Western Anhui,
China. A culture originally identified as M. taii (RCEFO772) was isolated from its
ascospores discharged onto glass slides. A culture of M.a. anisopliae (RCEF0386) was
isolated from a noctuid larval cadaver collected in Yuxi County, Western Anhui, China.
Those isolates that are included in this study only by means of sequence data obtained
from GenBank are listed in Table 1.

DNA preparation and amplification—A portion of a stroma from the field-collected
specimen and from cultured mycelia of M. taii (isolated from discharged ascospores)
were each finely ground under liquid nitrogen, and genomic DNA was extracted by use
of benzyl chloride according to the method of Zhu et al. (1994). The extracted DNA was
stored in 100 ul TE buffer (10 mM Tris-HCl, pH 8.0; 1 mM EDTA) at 4°C, and DNA
solutions were diluted 10-fold with TE for use in PCR reaction.

The nuclear ITS1-5.8S-ITS2 regions were amplified with the primer pair described
by Mavridou & Typas (1998). The PCR reactions were performed in 50 ul volume with
the following components: 10 mM Tris-HCl (pH 8.3), 50 mM KCI, 2mM MgCl, 0.001%
gelatin, 200 uM of each dNTP, 20-100 ng genomic DNA, 12 pmole of each primer, and
2.5 units Tag DNA polymerase (Sangon, China). The reactions were prepared on ice in
500 ul microcentrifuge tubes, overlaid with 20 ul mineral oil, and placed in a thermal
cycler (Techine, UK). Cycling parameters were programmed as following: an initial
denaturation at 95°C for 3min, followed by 35 cycles of denaturation at 94° for 1 min,
annealing at 54°C for 1 min and extension at 72°C for 2 min, with a final extension at
72°C for 10 min. Efficiency of amplification was monitored by running 8 ul of each
product through 1.2 % agarose gels using TAE buffer and visualizing PCR products with
ethidium bromide.

Amplification products were purified by use of a Wizard™ PCR Preps DNA
Purification System Kit (Promega Co., France) and methods provided by the company.

DNA cloning and sequencing of amplified its region—Purified ITS PCR products
were cloned into T-Vectors, which we prepared from SK plasmids. These vectors were
used to transform Escherichia coli XL1-Blue, and the plasmid DNA was extracted using
an alkaline lysis method (Sambrook et al. 1989).

The primers T7/T3 (forward and reverse) were used to sequence both strands using
the dideoxy-nucleotide chain termination on an ABI 3700 automated sequencer at

140

Shanghai Genecore Biotechnologies Company. Sequence data of C. taii (HS00060501),
M. taii (RCEF0772) and M.a. anisopliae (RCEF0386) have been deposited in the
GenBank genome sequence database with accession numbers AF348393, AF348394
and AF348395, respectively.

Table 1. Previously deposited GenBank sequences used in this study.*

Ae ed Ui TT LA STi ET TD ona
AF134150 1027 M.a. anisopliae Oxya multidentata / Orthopt. Pakistan
AF135210 1029 M.a. anisopliae Schistocerca gregaria / Orthopt. Eritrea
AF135211 1031 M.a. anisopliae Teleogryllus commodus / Orthopt. Australia
AF135212 1034 M.a. anisopliae Patanga succincta / Orthopt. Thailand
AF135213 1045 M.a. anisopliae Dermolepida albohirtum / Coleopt. Australia
AF135214 1091 M.a. anisopliae Teleogryllus commodus / Orthopt. Australia
AF135215 1114 M.a. anisopliae Soil, Maquarie Island Australia
AF135216 1156 M..a. anisopliae [immunocompromised human] Australia
AF136375 163 M.a. anisopliae Kalotermes sp. / Isopt. Australia
AF136376 203 M.a. anisopliae Inopus rubriceps / Dipt. Australia
AF136928 208 M.a. anisopliae Phaulacridium vittatum / Orthopt. Australia
AF137054 114 M.a. anisopliae Antitrogus parvulus / Coleopt. Australia
AF137055 23 M.a. anisopliae Aenolamia albofasciata / Hemipt. Mexico
ree i New
AF137056 700 M.a. anisopliae Costelytra zealandica / Coleopt. Zealand
AF137057 328 M.a. anisopliae Inopus rubriceps / Dipt. Australia
AF137058 SW) M.a. anisopliae Inopus rubriceps / Dipt. Australia
AF137059 775 M.a. anisopliae cane ob Copiers: Australia
AF137062 987 M.a. acridum Ornithacris cavroisi / Orthopt. Niger
AF137065 147 M.a. lepidiotae Lepidiota consobrina / Coleopt. Australia
AF137061 389 M.a. majus Oryctes rhinoceros / Coleopt. Indonesia
AF138270 38 Mf. flavoviride Adoryphorus couloni / Coleopt. Australia
AF138272 72 M.f. minus Niliparvata lugens | Homopt. Philippines
AF139853 «1125 alia, Soil Australia
zealandicum
AF139850 1D M.f. pemphigi Pemphigus treherni / Homopt. UK
AF137067 MaF M. album Nephotettix virescens / Homopt. Philippines
AJ309332 eo el Scarabaeidae / Coleoptera China

brittlebankisoides
*The fungal taxonomy follows that of Driver et al. (2000). FI = CSIRO collection of entomopathogenic fungal
cultures (Canberra, Australia). M.a. = Metarhizium anisopliae; M.f. = Metarhizium flavoviride. Note that FI-1029
is derived from the neotype specimen of M. anisopliae.
Alignments and analysis—DNA sequences generated by us and downloaded from
GenBank were aligned using Clustal X 1.81 (Thompson et al. 1997), and the alignment
was refined by eye. Beauveria bassiana (Bals.-Criv) Vuill, a related clavicipitacean
anamorph, was used as an outgroup. Parsimony analysis was performed in PAUP*
version b10 (Swofford 2002) using a heuristic search. A starting tree was obtained via
a “closest” addition sequence, tree-bisection-reconnection was used as the branch-
swapping algorithm, and MULTREES was off. Gaps were treated as missing data, and
112 ambiguously aligned characters were excluded from the analysis. Bootstrap values
were calculated based on 100 replicates of a heuristic fast stepwise addition search.

141

Bayesian analysis was carried out using MrBayes 3.0b4 (Huelsenbeck 2000,
Huelsenbeck et al 2001). We used a six parameter model to run four chains for 500,000
generations, saving a tree every 100 generations. The first 500 trees were discarded
(burn in), and the remaining trees were saved to a file. A 50% majority rule consensus
tree (Fig. 3) was then calculated using PAUP*.

Results

Characterization of specimen HS00060501 and its isolate, RCEF0772—The host is
covered with yellow mycelium. Three stromata emerge from the head of the host, they
are cylindric, 38 x 3.5-6 mm broad at stalk, with a yellowish fertile head of 20-35 x 2-5
mm. Perithecia flask-shaped with curved neck, obliquely immersed, 810-(950)-1120 x
230-380 um. Asci cylindric, 300-490 x 3.4-5.7 um, with ascus cap 3.1 um in diameter.
Part ascospores cylindrical, 20.0-(28.6)-34.6 x 1.4-(2.5)-3.1 um.

Figures 1-2. Cordyceps taii. Lepidopteran larvae from Anhui Province, China, bearing ascigerous
stromata (immature in Fig. 2) without its associated Metarhizium anamorph.

Colonies on Czapek’s agar attaining a diameter of 35-43mm with 14 days at 25°C,
flat, with little aerial mycelium, dull gray green, reverse center deep green, subcenter
to margin light sandy yellow. Cylindrical conidiogenous cells with short neck, 7.2-
(14.4)-21.6 x 1-(1.4)-1.8 um, borne in a palisade on mycelium or conidiophore. Conidia
cylindric, (5.0-)7.0-9.0(-10.0) x 2.4-(2.8)-3.2 um, two-celled conidia absent.

Based on the long part spores and other important morphological characters, the
Cordyceps specimen (HS00060501) from Huoshan County was identified as Cordyceps

142

taii. The morphological characters of the conidiogenous structures and conidia arising
from the part spores agree with the original description of M. taii (Liang et al. 1991).
Two more recently collected specimens of Cordyceps taii collected in Anhui Province are
illustrated in Figures 1 and 2.

Clarification of taxonomic position of Metarhizium taii—Regions of the 5.88 rRNA
and the complete internal transcribed spacer (ITS) regions from M. taii (GenBank
AF348394) and M.a. anisopliae from China were sequenced; their total sizes were 449
and 451 nucleotides, respectively. These sequences and ITS sequences obtained from
GenBank for 20 strains and 4 varieties of M. anisopliae were subjected to phylogenetic
analysis (Fig. 3). The aligned sequences of the new Chinese isolates of M. taii and
M. anisopliae showed a high degree of similarity with those of the 17 strains of M. a.
anisopliae from Driver et al. (2000). There are 22 mutations in total, half of which were
transitions (7 C/T and 4 A/G); the remaining mutations included three C/A, two T/G,
one A/T as well as five putative insertions or deletions. The nature of these mutations
suggests that these sequences may have diverged only recently. Among these mutations,
11 occurred in ITS1 and 11 in ITS2; the sequences of the 5.88 rRNA gene among
these 18 isolates of M. a. anisopliae (a set of sequences including that from FI-1029,
which was derived from the IMI ex neotype culture for M. anisopliae) and that of M.
taii were identical. Divergence in 5.8S rRNA gene sequences between M. taii and other
Metarhizium species or varieties varies from 0-1.8% (Tab. 2).

The parsimony search found 2864800 equally parsimonious trees, each of 376 steps
and with CI=0.811 and RI=0.808. Of the 683 included characters, 465 were constant,
and 106 were parsimony-informative. The strict consensus tree is shown in Fig. 3. The
tree resulting from the Bayesian analysis has an identical topology.

The large number of trees obtained via the parsimony approach reflects a lack of
variation among isolates of a single variety. In general, the ITS locus provided little
resolution at the varietal level, but did provide support for the recognition of all but one
of the varieties (M.a. majus). The Bayesian analysis generally agreed with the parsimony
consensus tree in that each of the varieties described by Driver et al. (2000) was supported
by tree topology except for M.a. majus. Metarhizium taii groups with all strains of M.a.
anisopliae with 99% bootstrap support; if the 85" character of the alignment is excluded,
then strain FI379 is included in this clade with 99% bootstrap support. Furthermore,
all varieties of M. anisopliae recognized by Driver et al. (2000)-M.a. anisopliae, M.a.
majus, M.a. lepidiotae Driver & Milner, and M.a. acridum Driver & Milner-—cluster
together in a clade with 100% bootstrap support and differ distinctly from M. album
and from all described varieties of M. flavoviride. These results suggest that M. taii
should properly be treated either as a variety of M. anisopliae or as being taxonomically
indistinguishable from M.a. anisopliae.

Table 2 shows that the range of variation in nucleotide divergence among M. taii and
18 isolates of M.a. anisopliae from ITS1, ITS2 and both combined falls within the scope
of variation among M.a. anisopliae isolates, and is distinctly greater than that among
M. taii, M.a. lepidiotae and M.a. acridum. The range of variation among M. taii and 18
isolates of M.a. anisopliae from ITS1+ITS2 regions is a little less than among M.a. majus
and 18 isolates of M.a. anisopliae.

143

Table 2. Nucleotide divergence within and among species for isolates of M. anisopliae
[M.a.] anisopliae, M.a. lepidiotae, M.a. acridum, M.a. majus and M. taii.*

: Nucleotide di Of
Isolates being compared ucleotide divergence (%)

5.88 ITS1 ITS2 ITS1+ITS2
M. taii, 18 isolates of M.a. anisopliae 0 0.7-3.0 1.1-2.8 1.0-2.3
M.a. anisopliae isolates 0 0-4.4 0-2.8 0.3-2.6
M. taii, FI-1029 (ex type of M.a. anisopliae) 0 1.6 ZS 2.0
M. taii, M.a. lepidiotae, M.a. acridum 0-0.6 9.6-20.5 9.1-10.6 9.3-15.1
M. tati, M.a. majus 0 3.0 7 KG.
M.a. majus, 18 isolates of M.a. anisopliae 0 2.2-4.4 0.6-2.3 1.3-2.5

*Genetic divergence (%) = (number of substitutions/total base pairs) x 100.

Relationships between C. taii and M. anisopliae var. anisopliae (RCEF0772)—The
total size of the ITS1-5.8S-ITS2 region (449 bp) for C. taii (GenBank AF348393) was
identical to that of M.a. anisopliae (RCEF0772). The sizes of ITS1, 5.88 and ITS2 in the
ITS1-5.8S-ITS2 region are 134 bp, 158 bp, 167 bp, respectively. The alignment showed
that C. taii and M.a. anisopliae isolated from this Cordyceps specimen had identical
(completely congruent) ITS1-5.8S-ITS2 sequences. This suggests that C. taii and M.a.
anisopliae are genetically identical. We suggest that Cordyceps taii and M.a anisopliae are
the teleomorphic and anamorphic phases of a single organism.

Discussion

The new varieties M.a. acridum and M.a. lepidiotum Driver & Milner were recognized
on the basis of their distinctive ITS sequence data (Driver et al. 2000). The ITS1 and
ITS2 sequence data were the only characters included in their Latin diagnoses; therefore,
until morphological or other characters are correlated with these genotypes, the only
means to identify varieties of Metarhizium anisopliae within the classification is with
sequence data (Driver et al. 2000).

In the phylogenetic tree, Cordyceps brittlebankisoides falls in the Metarhizium
flavoviride clade. However, its purported anamorph M.a. majus belongs to the
Metarhizium anisopliae clade. Liu et al. (2001) concluded that C. brittlebankisoides is the
teleomorph of M.a. majus based on the morphological characteristics of its phialides
and conidia; they did not compare the [TS sequences of their fungus with those of other
Metarhizium taxa. These authors also noted that the spore sizes and cultural color of
their fungus were similar to those of M.f. flavoviride (Liu et al. 2001). Based on the
overall genetic evidence, we believe that C. brittlebankisoides is not the teleomorph
of M.a. majus, but may instead be the teleomorph of a still undescribed variety of M.
flavoviride. Such a genetically-based reclassification within Metarhizium echoes the
genetically-based decision to transfer grasshopper- and locust-pathogenic isolates
originally identified on morphological and cultural bases as M. flavoviride to a new
variety in a different species as M.a. acridum (Driver et al. 2000).

The taxonomic status of M. taii as a species has remained both uncertain and
unverified since its description. Because the nucleotide divergence between M. taii
and the ex type isolate for M. anisopliae falls within the range of variation among M.a.
anisopliae isolates, and very little divergence was found in the ITS1 and ITS2 sequences

144

between M. taii and 18 isolates of M.a. anisopliae, we propose that M. taii is a synonym
of M.a. anisopliae; there is not even enough distinctive genetic variation between M. taii
and M.a. anisopliae to justify treating M. taii as a new variety of M. anisopliae. Tulloch
(1976) separated the varieties of M.a. anisopliae and M.a. majus mainly by the shape
and lengths of their conidia, (3.3-)5.0-8.0(-9.0) um and (9.0-)10.0-14.0(-18.0) um,
respectively. The anamorph of Cordyceps taii was recognized as a new species mainly
based on the dimensions of its conidia [(4.8-)7.8-9.6(-14) um] and the (apparently very
infrequent) formation of two-celled conidia (Liang et al. 1991). In this study, the conidia
of our M. taii strain (RCEF0772) are clearly within the limits of M.a. anisopliae defined
by Tulloch: the conidia of the strain isolated by Liang fell partly in the range of M.a.
anisopliae. Longer than usual conidia in M.a. anisopliae have been described previously
in strains from China with lengths of 7.5-8.0 um (Guo et al. 1986) and in strains from
Australia at 8-9 um (Yip et al. 1992). The lengths of conidia from M. taii fall between
those of M.a. anisopliae and M.a. majus, but in view of the high genetic similarity
demonstrated here the slight difference between M.a. anisopliae and M. taii, and in
conidial length between M.a. anisopliae and M.a. majus, can be regarded as differences
among strains. Liang et al. (1991) found differences in the ability to form synnemata
and two-celled conidia compared with other species or varieties of Metarhizium.
Comparable morphological differences among isolates of other fungal entomopathogens
have not been treated as taxonomically significant. For example, isolates of many diverse
entomopathogenic species of Paecilomyces may or may not form synnemata, with the
ability to do so varying on an isolate-by-isolate basis. Similarly, Li et al. (2001) reported
on an isolate of Beauveria bassiana able to produce large synnemata, a behavior not
generally known from other isolates of this globally distributed species. The combined
molecular and morphological evidence presents compelling support for the conclusion
that M. taii cannot be retained as an independent taxon at either the specific or varietal
level and that it must be synonymized with M.a. anisopliae.

Some studies have characterized the range of variation in nucleotide divergence
in ITS1 and ITS2 regions from different strains in the other fungal groups. Epicoccum
nigrum and Phoma epicoccina are synanamorphs of the same biological species, and but
the ranges of divergences in the sequences of their ITS1 and ITS2 genes have been found
to be 0-2.8% and 0-2.6%, respectively (Arenal et al. 2000). As a standard for comparison,
other studies have found infraspecific variability in ITS1 sequences for Hymenoscyphus
ericae, Trichoderma harzianum, and Ganoderma lucidum, to be 1.2%-3.5%, 0-2%, and
0-4%, respectively (Egger & Sigler 1993, Grondona et al. 1997). Even higher infraspecific
divergence has been found for other fungi such as Gaeumannomyces graminis, with 1.5-
12.0% for ITS1 and 0-2.9% for ITS2 (Bryan et al. 1995); and Colletotrichium acutatum
with 0-6% in the ITS1 (Sreenivasaprasad et al. 1994).

M.a. anisopliae is one of the most commonand important species of entomopathogenic
fungi. Like other such globally distributed and very important entomopathogens as
Beauveria bassiana and Beauveria brongniartii, the teleomorph of this hyphomycete has
remained uncertain or unknown. Schaerffenberg (1959) claimed that the teleomorph
of M. anisopliae belonged to the order Sphaeriales (Ascomycota), but this hypothesis
was never well supported either by Schaerffenberg or by any subsequent workers.
Liang et al. (1991) provided the first credible evidence that the teleomorph of any
Metarhizium species is a clavicipitaceous fungus belonging in the genus Cordyceps;

100

100
100

100

145

MV.album
M.f.novozealandicum
M.iminus
M.f.pemphigi
N.f.flavovirides
C.britlebankisoides
AF135212
AF137059
AF135215

AF 134150
M.a.a. ex type
AF 135214
AF136376
AF137055
AF136928
AF137054
AF137057
AF135213
AF135211
AF135216
AF137056
M.tali
M.a.majus
AF348395
AF136375
AF137058
M.a.lepidiotae
M.a.acridum

B.bassiana

Figure 3. Strict consensus of 2864800 equally parsimonious trees based on ITS region sequence
data from Metarhizium spp. Values above the branches indicate bootstrap support; posterior
probabilities resulting from the Bayesian analysis are shown below the branches.

146

this connection was based on studies of secondary (microcyclic) conidiogenesis by
discharged part spores. The data presented here show that M. taii cannot be maintained
as an independent species and that the most reasonable treatment for this species is as a
facultative (heterotypic) synonym of M.a. anisopliae:

Metarhizium anisopliae (Metschn.) Sorokin var. anisopliae, [Plant Parasites of Man and
Animals as Causes of Infectious Diseases] 2: 267 (1883) [in Russian]
Synonym: Metarhizium taii Z.Q. Liang & A.Y. Liu, Acta Mycol. Sinica 10: 260 (1991).

Because the present molecular and cultural evidence confirms unambiguously that the
teleomorph of Metarhizium taii is Cordyceps taii, it must also now be recognized that the
teleomorph of M. anisopliae var. anisopliae is C. taii.

Acknowledgments

We are grateful to Drs. Wenying Zhuang and Yijian Yao for reviewing the manuscript. This work
was supported partly by the National Natural Science Foundation of China (Grant No. 30300004,
30330500), the Key Laboratory of Systematic Mycology and Lichenology (Grant No. 912.), the
Anhui Provincial Science Foundation for Excellent Youth and program for “NCET”.

Literature cited

Arenal F, Platas G, Monte E, Pelaez F. 2000. ITS sequencing support for Epicoccum nigrum and
Phoma epicoccina being the same biological species. Mycol Res 104: 301-303.

Bryan GT, Daniels MJ, Osbourn AE. 1995. Comparison of fungi within the Gaeumannomyces-
Phialophora .complex by analysis of ribosomal DNA sequences. Appl Environ Microbiol
61: 681-689.

Curran J, Driver F, Ballard JWO, Milner RJ. 1994. Phylogeny of Metarhizium: analysis of ribosomal
DNA sequence data. Mycol Res 98: 547-552.

Driver F, Milner RJ, Trueman WHA. 2000. Taxonomic revision of Metarhizium based on a
phylogenetic analysis of rDNA sequence data. Mycol Res 104: 134-150.

Egger K N, Sigler L. 1993. Relatedness of the ericoid endophytes Scytalidium vaccinii and
Hymenoscyphus ericae inferred from analysis of ribosomal DNA. Mycologia 85: 219-230.

Grondona I, Monte E, Garcia-Acha Y, Sutton B. 1997. Pyrenochaeta dolichi: an example of a
confusing species. Mycol Res 101:1405-1408.

Guo HL, Ye BL, Yue YY, Chen QT, Fu CS. 1986. Three new species of Metarhizium. Acta Mycol
Sinica 5: 177-184.

Huelsenbeck JP. 2000. MrBayes: Bayesian inferences of phylogeny (software). New York: University
of Rochester.

Huelsenbeck JP, Ronquist F, Nielsen ES, Bollback JP. 2001. Bayesian inference of phylogeny and its
impact on evolutionary biology. Science 294:2310-2314.

Leal SCM, Bertioli DJ, Butt TM. 1997. Amplification and restriction endonuclease digestion
of the Pr1 gene for the detection and characterization of Metarhizium strains. Mycol Res
101: 257-265.

Li ZZ, Li CR, Huang B, Fan MZ. 2001. Discovery and demonstration of the teleomorph of Beauveria
bassiana (Bals.) Vuill., an important entomogenous fungus. Chinese Sci Bull 9: 751-753.

Liang ZQ, Liu AY, Liu JL. 1991. A new species of the genus Cordyceps and its Metarhizium
anamorph. Acta Mycol Sinica 10: 257-262.

Liu AY, Liang ZQ, Cao L. 1989. Study on the identification of Metarhizium biformisporae. J Guizhou
Agr Univ 2: 27-31.

147

Liu ZW, Guo HL, Kurtzman CP. 1994. Phylogeny of Metarhizium species as determined by partial
ribosomal RNA sequences. Acta Mycol Sinica 13: 139-151.

Liu ZY, Liang ZQ, Whalley AJS, Yao YJ, Liu AY. 2001. Cordyceps brittlebankisoides, a new pathogen
of grubs and its anamorph, Metarhizium anisopliae var. majus. J Invert Pathol 78: 178-182.
Mavridou A, Typas MA. 1998. Intraspecific polymorphism in Metarhizium anisopliae var. anisopliae
revealed by analysis of rDNA gene species complex and mtDNA RFLPs. Mycol Res 102: 1233-

1241.

Milner RJ, Driver F, Curran J, Glare TR, Prior C, Bridge PD, Zimmermann G. 1994. Recent
problems with the taxonomy within the genus, Metarhizium, and a possible solution. Abstracts,
6" Internat. Colloq. Invertebr Pathol Microb Control, (Montpellier, France), vol. 2, pp. 109-
110.

Rath AC, Carr CJ, Graham B R. 1995. Characterization of Metarhizium anisopliae strains by
carbohydrate utilization (AP150CH). J Invert Pathol 65: 152-161.

Rakotonirainy MS, Dutertre M, Cariou ML, Brygoo Y, Riba G. 1994. Phylogenetic relationships
within the genera Metarhizium based on 28s rRNA sequences and isozyme comparison. Mycol
Res 98: 225-230.

Rombach MC, Humber RA, Roberts DW. 1986. Metarhizium flavoviride var. minus var. nov.,
a pathogen of plant- and leafhoppers on rice in the Philippines and Solomon Islands. Mycotaxon
DG ODE.

Sambrook J, Fritsch EF, Maniatis T. 1989 Molecular Cloning: A Laboratory Manual, 2nd ed. New
York; Cold Spring Harbor Laboratory Press.

Schaerffenberg, B. 1959. Ziir Biologie und Okologie des insektentétendend Pilzes Metarrhizium
anisopliae (Metsch.) Sorok. (Entwicklung, Kultur, Lebensanspruche, Infektionsverlauf,
praktische Bedeutung). Z Angew Entomol 44: 262-271.

Sreenivasaprasad S, Mills PR, Brown AE. 1994. Nucleotide sequence of the rDNA spacer 1 enables
identification of isolates of Colletotrichum as C. acutatum. Mycol Res 98: 186-188.

Swofford D. 2002. PAUP*: Phylogenetic analysis using parsimony (*and other methods), version 4.
Sunderland, Massachusetts: Sinauer Associates.

Tulloch M.1976. The genus Metarhizium. Trans Brit Mycol Soc 66: 407-411.

Thompson JD, Higgins DG, Gibson TJ. 1994. Clustal W: improving the sensitivity of progressive
multiple sequence alignment through sequence weighting, position-specific gap penalties and
weight matrix choice. Nucl Acids Res 22: 4673-4680.

Tzean SS, Hsieh LS, Chen JL, Wu WJ. 1993. Nomuraea cylindrospora comb. nov. Mycologia
85:514-519.

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The Clustal X windows
interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucl Acids Res 24:4876-4882.

Yip HI, Rath AC, Koen TB. 1992. Characterization of Metarhizium anisopliae isolates from
Tasmanian pasture soil and their pathogenicity to redheaded cockchafer (Coleoptera:
Scarabaeidae: Adoryphorus couloni). Mycol Res 96: 92-96.

Zhu H, Qu F, Zhu LH. 1994. Isolation of gnomic DNAs from fungi using benzyl chloride. Acta
Mycol Sinica 13: 41-47.

€

7 Pwil ae a
es ae
ve .
oAe 7

my ew inte adhe Cee eee trary hel wise P tania il "I

Ute Tes schep: Age tare pers A I SES

Srape'h 4

; : oe Seti zing) bieaghia? i rom ey
fe aga aie js sonivasrtanatl bo heatatttuwtowy nil , REL A a mma) 1, crs) woe, Aina. *
; i 1 oh ee ‘Chie Huet eal pi O02 LSA) Mottiallsy averbydoduc. «

antag!) soba, bauble gre oat Aa os : PoE 7 pire Stet iy |
ilened id ret Nod

carn rs o
ihe! ‘ | 7 amt i med ew a Tay ef, trewad fr a ‘.

2-0 eam aay ot Neate Prathe mm bas ad Lochentlogy a er es tha 5
7) caeeayy (Be Me potest am awiasnyati nS Lal Lode a OM dewhngl ie

Pics ai Mi Z patti 24 ome Neate eee HiT ee Sti even

7} _,)>ae e
io } =~ iy ‘<@ a= Re.

ie. Pa, ee mts i, va woe ‘ ah eile vue) + tiie aa 14 dotted: qf MeeeanEe. -.
ae ee ‘i TEs ery Hid abe ifr od
wilh Ve apr ida la Ma's “J fyi Bley gay Hed ay set cad aoe udgedlt esuiltad
Withstand: MRO cenAly 143) TaN) 24 Sot caleRG*, ~
Sy Ser ones Sh AE of v oye be Lertaiec PNY ah qbiystaY shh aa ma
Y TEtSy Ai Chait Io acarase fie bale Pt AA arya ay if Mia FL pergusarvinraid:
; as mt Rein lever (ah! suth “Seated wy Leos hineenpsienaik 7
dors = yo 855 mt , se ad vu i trhite 4s] Bat mi siwplepe Ayaagalyt - meg aed OE AF iitiows? é
7 a yes ats, as Suh cebinye ty ial hres eB ”
ee ae Pr pre ttae ney i 7 A"! oe ei Hah: ai erate Lee % iy ever alli a
vin Peon, ie hate > Ot ite , vine wt i PT ie iy iy Hoe ny a eh gat nl A cal
Yin Sar, em iiss sisi (yeantl yey halts ie tt Lips entire oi ane 5 a ~~

my | aie he sei oe “12 pug An WERE UI ga irae aaa
*, een Matty! ¥ if! atin Pree ati ) i201 Leeuw ft fet Ole teak 2e- one ; as
ia sa Ry ate y hit oes i il Ley i Ws 0 ae ree Ae be ca hae it i

ynkeow 2 fats st) aor T i 7 nényyld} | tity ceiritiesl 7 duneewreh ree cielo, CHS etee cat A cas
Pee ioe tbat, * Petia" susp SBN Tol glide Alc Id a ay
ee ie | -cxo sp) . VER eh be aye ielalans ion f :
wiht sph Sink, diiteewengee leona siaaeuaien rates ONE

wt gee ge Mee ae rT a wiih lity ioe ge toto’ Smee a ‘4 |
mW ostnk TA At we ay Hp Marvy ca Vehhago eh a bl poh
no pe Rene ye sea sunt et mae a reborn, Pac A REA ies. oe
"\ Wao XD tb EY wanna los 2.
Pai 6 Say ain, Gs Piety rt ay (ar hoabinehd ok pies Atlas ,< a

; Ce : Ry ‘iwi. ‘aj ae a TAME apes frgua Chirkas Ss Gull Lay De aoe, ¥, +o
dt ae acy 0 gi Set Drath ea pean greed ante diah to A a
(ls ie An Wes Sl MATAR ol ties Pie re na

a iy MT. ee ey aN aie sehawlie
a at A
ou :

oa La ./

MY COTA XON

Volume 94, pp. 149-154 October-December 2005

Vamsapriya indica gen. et sp. nov.,
a bambusicolous, synnematous fungus from India

Puja GAWAS' & DARBHE JAYARAMA BHAT

*pujabg@yahoo.co.in; **bhatdj@rediffmail.com
Department of Botany, Goa University
Goa-403 206, India

Abstract— Vamsapriya indica gen. et sp. nov. is reported from decaying culms of bamboo,
Bambusa arundinacea (Gramineae or Poaceae), collected at Yellapur, Uttara Kannada,
Karnataka, India. The fungus is unique in producing catenate, phragmosporous conidia
on synnematous conidiophores with non-cicatrized, monotretic conidiogenous cells.
The novel genus is described and illustrated, and compared with two closely resembling
genera, Didymobotryum and Podosporium.

Key words—conidial fungi, tropical biodiversity, hyphomycetes, taxonomy

Introduction

Fungi occurring on monocot plants are fairly well documented (Ju & Rogers 1994; Frohlich
& Hyde 1999; Hyde & Alias 2000; Yanna et al. 2001). Among them, bambusicolous fungi
have been well-studied (Petrini et al. 1989; Eriksson & Yue 1990; Hyde et al. 2002a) with
a special interest on the pathogens (Samajpati 1984; Johnson 1985; Deka et al. 1990) and
saprobes (Hyde et al. 2001; Zhou & Hyde 2002; Hyde et al. 2002b). Presently, more than
110 bambusicolous fungi have been recorded (Shenoy et al. 2005a).

During the course of studies on fungal diversity of Western Ghat forests (e.g. Pratibha
et al. 2005; Shenoy et al. 2005b), we came across a unique, dematiaceous, synnematous
hyphomycetous fungus on decaying culms of bamboo, Bambusa arundinacea (Retz.)
Willd. (Gramineae or Poaceae). On careful examination, we observed a combination
of morphological characters of the genera Didymobotryum Sacc. and Podosporium
Schwein. Both Didymobotryum, lectotypified by D. rigidum (Berk. & Broome) Sacc. and
Podosporium lectotypified by P. rigidum Schwein. are characterized by large synnemata
with a stipe and apical head, branched conidiophores, monotretic conidiogenous cells
and acrogenous conidia. However, the conidia of Didymobotryum are catenate and
1-septate whereas those of Podosporium are solitary and phragmosporous (Ellis 1971).
The unique combination of catenate, phragmoporous conidia in a single fungus, with
the other features of both Didymobotryum and Podosporium warrants placement of the
bambusicolous fungus in a new species and a new genus. Vamsapriya indica gen. et sp.
nov is described and illustrated in this paper.

150

Taxonomic Description

Vamsapriya Gawas & Bhat anam. gen. nov.

Ad fungos conidiales, hyphomycetes. Coloniae effusae, atro brunneae vel nigra. Mycelium
substrato immersum, ex hyphis subhyalinis, septatis, ramosus, laevis. Conidiophora
macronematica, synnematica, atrobrunnea, laevia, septata, ramosa, laxus apicem.
Synnematica erecta, atro brunnea. Cellulae conidiogenae monotreticae, nunquan
cicatricem, integratae vel discretae, terminalae, clavatae. Conidia sicca, catenulata,
acrogenosa, brunnea, cylindrica, vermiformata, rotundata ad duo extremitas,
phragmoseptata, angustus ad septa, acropetalibus.

Etymology: In Sanskrit Vamsa- bamboo; priya- loving.

Conidial fungi, hyphomycetes. Colonies effuse, dark brown to black. Mycelium immersed,
composed of subhyaline, septate, branched, smooth hyphae. Conidiophores distinct,
macronematous, synnematous, dark brown, smooth, septate, branched, wider at the
apex. Synnemata erect, dark brown, composed of compact parallel conidiophores, fertile
in the upper half. Conidiogenous cells monotretic, non-cicatrized, integrated or discrete,
terminal, clavate. Conidia dry, catenate, acrogenous, brown, cylindrical, vermiform,
phragmoseptate, constricted at the septa, developing in acropetal chains.

Type species: V. indica.

Vamsapriya indica Gawas & Bhat sp. nov. Fig. 1-12
Ad fungos conidiales, hyphomycetes. Coloniae effusae, atrobrunneae vel nigra. Mycelium
substrato immersum, ex hyphis subhyalinis, septatis, tremes, laevis, 2.5-3.5 um latis.
Conidiophora macronematica, synnematica, atrobrunnea, laevia, septata, tremes,
laxus, apicem, 3-4.5 um lata. Synnematica erecta, rigidis, atro brunnea, 700- 870 um
longa, 80-90 um lat. ad pessum, 28-42 um lat. ad medius, 110-150 um lat. ad apicem
fertilis ora. Cellulae conidiogenae monotreticae, nunquam cicatricem, integratae vel
discretae, terminaliae, clavatae, leviter curvatae extrinsecus, 4-12 x 2-4.5 um. Conidia
sicca, catenulata, acrogenosa, brunnea, laevia, simplicia, cylindrica, vermiformata,
2-12-septata, 10-80 x 4-6 um, angustus ad septa, acropetalibus; conidia terminalia teres
ad apicem, leviter truncata ad pessum; conidia alia leviter truncata ad duo extremitas.
Holotype: On dead and decaying bamboo twigs, Yellapur, Uttara Kannada, Karnataka,
India, coll. Puja Gawas, 27/9/2005, Herb. No. IMI 393674.

Fungus hyphomycete. Colonies effuse, dark brown to black. Mycelium immersed,
composed of subhyaline, septate, branched, smooth hyphae, 2.5-3.5 um wide.
Conidiophores macronematous, synnematous, dark brown, smooth, septate, branched,
wider at the apex, 3-4.5 um wide. Synnemata erect, rigid, dark brown, composed of
compact parallel conidiophores, 700-870 um long, up to 80-90 um wide at the base,
28-42 um wide in the middle, up to 110-150 um wide at the apical fertile region.
Conidiogenous cells monotretic, non-cicatrized, integrated or discrete, terminal,
clavate, slightly curved towards the exterior, 4-12 x 2-4.5 um. Conidia dry, catenate,
acrogenous, brown, smooth, simple, cylindrical, vermiform, 2-12-septate, constricted
at the septa, 10-80 x 4-6 um, developing in acropetal chains; terminal conidia rounded
at the apex, slightly truncate at the base; other conidia slightly truncate at both ends.

151

Fig. 1-11. Vamsapriya indica. 1. Stereomicroscopic image of the synnemata (bar = 0.5 cm);
2. Fertile apical zone (bar = 200 um), 3,4. Conidiogenous cells showing monotretic conidiogenesis
(bars = 10 um), 5-11. Morphological variation in conidial size and display of catenate nature of the
conidia (bars = 10 um)

152

Fig. 12. Vamsapriya indica. Synnemata, conidiogenous cells and conidia

153

Discussion

Vamsapriya is morphologically similar to Didymobotryum and Podosporium. All
three genera have brown to black rigid synnemata with compactly arranged brown
conidiophores, monotretic, integrated, clavate to cylindrical conidiogenous cells
bearing dry, acrogenous, simple conidia. Didymobotryum differs from Podosporium in
having catenate, ellipsoidal-cylindrical, 1-septate conidia. Podosporium, in contrast, has
solitary, obclavate, multiseptate conidia (Ellis, 1971). Vamsapriya exhibits a combination
of morphological characters of both these genera, bearing catenate, cylindrical to
vermiform, multiseptate (phragmosporous) conidia. The catenate conidia do not
support disposition of Vamsapriya in Podosporium and their phragmosporous character
makes it difficult to accommodate in Didymobotryum.

Acknowledgements

This study was supported by a Special Assistance Programme of the UGC, New Delhi, to the
Department of Botany, Goa University and a research grant from the CSIR, New Delhi to DJB.
PG gratefully acknowledges receipt of a Research Assistantship of the CSIR, New Delhi. We
are thankful to B.D. Shenoy (The University of Hong Kong) for reading the manuscript. We are
grateful to Drs. E-H.C. McKenzie (Landcare Research, Auckland, New Zealand) and B. Kendrick
(University of Victoria, B.C. Canada) for kindly reviewing the manuscript.

Literature cited

Deka PC, Baruah G, Devi M. 1990. A preliminary investigation of disease of bamboo in northeast
region of India. Indian Forester 116: 714-716.

Ellis MB. 1971. Dematiaceous Hyphomycetes. Commonwealth Mycological Institute, Kew, Surrey,
ONS,

Eriksson OE, Yue Jz. 1990. Notes on bambusicolous pyrenomycetes. Mycotaxon 38: 201-220.

Frohlich J, Hyde KD. 1999. Biodiversity of palm fungi in the tropics: are global fungal diversity
estimates realistic? Biodivers. Conserv. 8: 977-1004.

Hyde KD, Alias SA. 2000. Biodiversity and distribution of fungi associated with decomposing Nypa
fruticans. Biodivers. Conserv. 9: 393-402.

Hyde KD, Ho WH, McKenzie EHC, Dalisay T. 2001. Saprobic fungi on bamboo culms. Fungal
Divers. 7: 35-48.

Hyde KD, Zhou D, Dalisay T. 2002a. Bambusicolous fungi: A review. Fungal Divers. 9: 1-14.

Hyde KD, Zhou D, McKenzie EHC, Ho WH, Dalisay T. 2002b. Vertical distribution of saprobic
fungi on bamboo culms. Fungal Divers. 11: 109-118.

Johnson GI. 1985. Rust (Dasturella divina) of Bambusa spp. in Australia. Australas. Plant Pathol.
14: 54-55.

Ju YM, Rogers JD. 1994. Kretzschmariella culmorum (Cooke) comb. nov. and notes on some other
monocot-inhabiting xylariaceous fungi. Mycotaxon 51: 241-255.

Petrini O, Candoussau F, Petrini LE. 1989. Bambusicolous fungi collected in southwestern France
1982-1989. Mycol. Helv. 3: 263-279.

Pratibha SJ, Puja G, Shenoy BD, Hyde KD, Bhat DJ. 2005a. Chalara indica sp. nov. and Sorocybe
indicus sp. nov. from India. Cryptogamie Mycol. 26: 97-103.

Samajpati N. 1984. Decay and chemical changes in the wood of Bambusa arundinacea caused by
Daedalea flavida. Phytopathol. Z. 110: 203-206.

154

Shenoy BD, Jeewon R, Hyde KD. 2005a. Oxydothis bambusicola, a new ascomycete with a huge
subapical ascal ring found on bamboo in Hong Kong. Nova Hedwigia 80: 511-518.

Shenoy BD, Vijaykrishna D, Cai L, Jeewon R, Bhat DJ, Hyde KD. 2005b. Pseudohalonectria
miscanthicola sp. nov. and three interesting fungi from tropics. Cryptogamie Mycol. 26:

123-132.
Yanna, Ho WH, Hyde KD. 2001. Fungal communities on decaying palm fronds in Australia, Brunei

and Hong Kong. Mycol. Res. 105: 1458-1471.
Zhou D, Hyde KD. 2002. Fungal succession on bamboo in Hong Kong. Fungal Divers. 10:

213-227.

MYCOTAXON

Volume 94, pp. 155-158 October-December 2005

Two new species of Hypogymnia (Lecanorales, Ascomycota)
with pruinose lobe tips from China’

XINLI WEI’? JIANGCHUN WEI *”

*wetjc2004@126.com

'Systematic Mycology & Lichenology Laboratory
Institute of Microbiology, Academia Sinica
Zhong-guan-cun, Bei-yi-tiao#13, Beijing 100080, China

?Graduate School of Chinese Academy of Sciences, Beijing 100039, China

Abstract—Two new species of lichens are described from China, viz. Hypogymnia
pseudopruinosa (in Yunnan) and H. subfarinacea (in Sichuan and Yunnan). They are
characterized by means of morphology and secondary chemistry. Latin diagnoses,
English descriptions, and habitus photographs are provided.

Keywords—H. macrospora, H. farinacea, lichen substances

Until recently, forty species of Hypogymnia (Nyl.) Nyl. have been reported from China
(Wei 1991; Chen 1994; McCune & Obermayer 2001; McCune & Tchabanenko 2001;
McCune et al. 2003). During our studies on the lichen flora of China, two new species
of the genus were collected from Yunnan and Sichuan Provinces, which are described
in this paper. The gross morphology and anatomy were examined using the dissecting
microscope (ZEISS Stemi SV 11) and compound microscope (OPTON &). The lichen
substances were detected by colour reagents and thin-layer chromatography (Culberson
& Kristinsson 1970; Culberson 1972; White & James 1985).

Hypogymnia pseudopruinosa X.L. Wei & J.C. Wei, sp. nov. Plate I: A-B
Hypogymniae macrosporae similis, sed sporis minoribus, lobi pruina obductis et atranorina
deest.

Type: China. Yunnan, Dégén county, alt. 4100 m, on dead branches of Sabina sp., X. Y.
Wang, X. Xiao & J. J. Su 7606, 29 August 1981 (holotype, HMAS-L).

Thallus foliose, tightly appressed; with subdichotomously branched lobes of 1-2 mm
wide and 5 mm long; upper surface dark brownish-yellow, partly black, with black
margin, rugose, glossy, lacking isidia, soredia and lobules but with dense layer of pruina
limited to the lobe tips; lower surface black, brown near the apices, rugose, glossy, and
with round perforations at the lobe tips and on the lower surface.

” The project was supported by the National Natural Science Foundation of China (30499340)

156

Upper cortex prosoplectenchymatous, pale yellow, 12-14.5 um thick; algal layer
10-14.5 um thick, consisting of green, subspherical cells of 7.5-9.5 um in diameter; hyphae
in medulla colorless, about 2 um in diameter; lower cortex prosoplectenchymatous, pale
yellow, 10 um thick.

Apothecia rare, 1-3 mm in diameter, stipitate; disc yellow brown or red brown, glossy,
concave at first and then slightly plane with entire and thin margin; epithecium brown,
7-9 um thick; hymenium colourless, 32-36 um thick; asci clavate, 8-14 x 23.5-25 um,
8-spored; spores simple, colourless, ellipsoid to nearly spherical, 3.5-4 x 5.5-7 um;
paraphyses linear, septate, 2 um wide, slightly swollen at the tips; hypothecium
colourless, 27-36 um thick. Pycnidia not seen.

Chemistry. Cortex K-, C-, P-; medulla K+ yellow, C-, P+ orange yellow > orange red;
containing physodalic and physodic acids, and a pale spot in R,class 6 (solvent system
Cy

Comments: The new species resembles H. macrospora (J.D. Zhao) J.C. Wei (Zhao 1964;
Wei 1991) at first sight, but differs by having a dense layer of pruina limited to the tips of
the lobes and smaller ascospores, and by lacking atranorin.

Hypogymnia subfarinacea X.L. Wei & J.C. Wei, sp. nov. Plate I: C-E

Habitu cum Hypogymnia farinacea optime congruens, sed differt lobis pruinosis et acidum
physodalicum continens.

Type: China. Sichuan Province, Nanping County, Jiuzhai Gou, alt. 2151 m, on trunk of
Tsuga sp., 10 June 1983, X. Y. Wang & X. Xiao 10582 (holotype, HMAS-L).

Thallus foliose, loosely appressed, with subdichotomously branched and separated lobes
of 2 mm wide; upper surface gray, dull, slightly rugose to smooth with some pieces
of upper cortex in the old lobes disintegrating, lacking isidia and lobules but bearing
granular soredia coalescent in more or less sacciform structures, with thin layer of pruina
limited to the lobe tips; lower surface black, pale brown near the apices, wrinkled, glossy,
with large, round perforations of 2 mm in diameter.

Upper cortex prosoplectenchymatous, pale yellow, 14.5 um thick; algal layer 20.5-22.5
uum thick, consisting of green and subspherical cells of 3-4 um in diameter; hyphae in
medulla colorless, septate, 1-2 um in diameter; lower cortex prosoplectenchymatous,
pale yellow, 12-14.5 um thick. Apothecia and pycnidia unknown.

Chemistry. Cortex K-, C-, P-; medulla K+ yellow, C-, P+ orange yellow > orange red,
containing physodalic, physodic, 3-hydroxyphysodic (conphysodic), protocetraric
acids, and atranorin.
Other Material Examined: China, Yunnan: Lijiang County, Mt. Yulong shan, alt.
2900 m, on the bark of Quercus sp., 8 August 1981, X. Y. Wang, X. Xiao & J. J. Su 4892

(HMAS-L); alt. 3100 m, on the ground, 8 August 1981, X. Y. Wang, X. Xiao & J. J. Su
6591 (HMAS-L).

Comments: The new species resembles H. farinacea Zopf at the first sight, but differs
by more separated lobes, presence of pruina limited to the lobe tips, and in containing
physodalic acid.

Plate I. A. Hypogymnia pseudopruinosa, Wang et al. 7606 (holotype in HMAS-L),
showing general appearance of thallus. B. H. pseudopruinosa, Wang et al. 7606, showing
the pruina limited to the margin of lobes. C. H. farinacea, Wang et al. 10582 (holotype
in HMAS-L), showing general appearance of thallus. D. H. farinacea, Wang et al. 10582,
showing the pruina limited to the margin of lobes. E. H. farinacea, Wang et al. 10582,
showing the soredia on the upper surface.

A-C: Scale in mm; D-E: Scale bar = 1 mm.

158

Acknowledgements

We are indebted to Prof. Teuvo Ahti and Dr. Harrie Sipman for giving valuable comments on
the manuscript. Special thanks due to Ms. H. Deng for giving considerable assistance during the
studies in HMAS-L. The authors are also grateful to Mr. Q. M. Zhou, and Drs. M. R. Huang and S.
Y. Guo for kind help in taking the pictures.

Literature Cited

Chen JB. 1994. Two new species of Hypogymnia (Nyl.) Nyl. (Hypogymniaceae, Acomycotina). Acta
Mycologica Sinica 13 (2): 107-110.

Culberson CE. 1972. Improved conditions and new data for the identification of lichen products by
a standardized thin-layer chromatographic method. Journal of Chromatography 72: 113-125.

Culberson CF, Kristinsson H. 1970. A standardized method for the identification of lichen products.
Journal of Chromatography 46: 85-93.

McCune B, Martin EP, Wang LS. 2003. Five new species of Hypogymnia with rimmed holes from
the Chinese Himalayas. The Bryologist 106 (2): 226-234.

McCune B, Obermayer W. 2001. Typification of Hypogymnia hypotrypa and H. sinica. Mycotaxon
79: 23-27.

McCune B, Tchabanenko S. 2001. Hypogymnia arcuata and H. sachalinensis, two new lichens from
east Asia. The Bryologist 104 (1): 146-150.

Wei JC. 1991. An Enumeration of Lichens in China. International Academic Publishers.

White FJ, James PW. 1985. A new guide to microchemical techniques for the identification of lichen
substances. British Lichen Society Bulletin 57 (Suppl.): 1-41.

Zhao JD. 1964. A preliminary study on Chinese Parmelia. Acta Phytotaxonomica Sinica 9:
139-166.

MYCOTAXON

Volume 94, pp. 159-173 October-December 2005

Discovery and description of a teleomorph for
Leptographium koreanum

H. Masuya’, J.-J. Kim’, M. J. WINGFIELD?, Y. YAMAOKA4,
S. KANEKO’, C. BREUIL’, & G.-H. Kim?

H_masu@hotmail.com
' Forest Pathology Laboratory, Forestry and Forest Products Research Institute
Tsukuba, Ibaraki 305-8687, Japan

? Department of Wood Science, University of British Columbia
Vancouver, B.C. V6T 124, Canada

° Forestry and Agricultural Biotechnology Institute (FABI)
University of Pretoria, Pretoria 0002, South Africa

* Graduate School of Life and Environmental Science, University of Tsukuba
Tsukuba, Ibaraki 305-8572, Japan

° Division of Environmental Science & Ecological Engineering
Korea University, Seoul 136-701, Korea

Abstract—A Leptographium sp. unknown in Japan was isolated from Japanese red pine
(Pinus densiflora) in this study. Pairing of different strains of the fungus gave rise to
mature perithecia of an Ophiostoma sp. Characteristics of this teleomorph were similar to
those of Ophiostoma piceaperdum, but the fungus had larger ascospores. The anamorph
state had 2 to 3 primary branches, and was similar to Leptographium truncatum, L.
yunnanense, L. pini-densiflorae, and particularly to L. koreanum. Comparisons of
partial actin, -tubulin, and rDNA sequences data showed that the Japanese fungus is
L. koreanum. Pairing of strains from Japan with the ex-type culture of L. koreanum gave
rise to mature perithecia confirming this identification. The teleomorph of L. koreanum
is thus described here as Ophiostoma koreanum.

Key words—biological species, phylogenetic species, ophiostomatoid fungi, blue-stain
fungi, DNA sequences

Introduction

Species of Leptographium Lagerb. et Melin are best recognized as anamorphs of the
ascomycete genus Ophiostoma Syd. et P. Syd. They include economically important
agents of sap-stain as well as tree pathogens (Gibbs 1993, Seifert 1993). Leptographium
wingfieldii M. Morelet and L. wageneri (W. B. Kendr.) M. J. Wingf. have relatively high
levels of virulence, and the three varieties of the latter species are well-recognized root
pathogens in the western United States (Cobb 1998, Solheim et al. 1993, Harrington
1988). These and other Leptographium spp., produce mitospores in slimy masses at the

160

apices of erect conidiophores that are specifically adapted to be carried by arthropods,
particularly bark beetles (Coleoptera, Scolytinae, Jacobs and Wingfield 2001).

A recent monograph on Leptographium included 46 species (Jacobs & Wingfield
2001). The majority of these species occur in Europe and North America and it is well-
recognized that this group of fungi has been poorly sampled in other parts of the world.
This is particularly true for Asia where a large number of bark beetles are known to
infest native conifers. This study represents part of an ongoing effort to catalogue the
Leptographium spp. in Asia, and particularly in Japan.

Recent isolations from pine bark beetles and bark beetle-infested Japanese red pine
(Pinus densiflora Siebold et Zucc.) and other pine species have yielded a Leptographium
spp. that has previously not been collected in Japan. This fungus has 2-3 primary
branches, relatively poorly developed rhizoids, and is morphologically similar to L.
truncatum (M. J. Wingf. et Marasas) M. J. Wingf., L. yunnanense X. D. Zhou et al., L.
koreanum, and L. pini-densiflorae Masuya et M. J. Wingf. (Jacobs & Wingfield 2001,
Kim et al. 2005, Masuya et al. 2000, Zhou et al. 2000, Jacobs et al. 2005). However, unlike
these fungi, isolates of the Japanese Leptographium sp. often produce protoperithecia
in culture (Masuya et al. 1998). Masuya et al.(1998, 1999) have previously noted the
fungus and reported it as an undescribed Ophiostoma sp. This fungus was isolated from
9 out of 13 investigated bark beetle species and appears to be widely distributed in
Japan (Masuya et al. 2001). It was also found to be relatively virulent in inoculations on
Japanese red pine where it produced longer lesions than various other blue-stain fungi
(Masuya et al. 2003). .

The unknown Ophiostoma sp. with a Leptographium asexual state from Japan is
considered to be economically important for Japan thus an appropriate name for the
fungus is required especially since its teleomorph is recognized. The aim of this study is
to establish its identity.

Materials and methods

Fungal isolates

The fungal isolates used for morphological comparisons and mating experiments in
this study are listed in Table 1. Five strains of the Leptographium sp. (MCC206, 214, 217,
364, 365) were used in the DNA sequence analyses. Comparisons of sequence data also
included sequence data of other Ophiostoma and Leptographium species obtained from
Genbank (Table 2).

Morphology

A 5 mm-diam. plug of each isolate used in the morphological comparisons was
placed in Petri dishes containing 2% malt extract agar (MEA, 20 g Difco malt extract,
15 g agar and 1000mL distilled water) and incubated at 20C in dark. After one month,
two autoclaved pine twigs were placed on the surface of the medium to stimulate the
development of fruiting structures. After an additional month of incubation, plates were
inspected for the presence of perithecia. Where these structures were found, they were
mounted on glass slides in 1% lacto-fucsin for microscopic examination. In addition,
perithecia were mounted after having been bleached with Sodium hypochlorite (1%
available chlorine) for detailed observation of the cell arrangement of perithecial

161

‘IOYINL OTUs dy} JO UOTDaTJOo ainyTNd “QO ‘uede{ ‘sadimosay [ed130jorqo13y Jo
aININSUT PEUOTRNY JO UOIDITIOD aanypnD ‘19}Ua_D ssoIMosay MaUAay YAVW Va1oy ‘APISIVATUL) UIIOY, “WOT}DITJOD any[ND Ayssaatuy) va1Oy, ay} ‘ONY ‘uede{ ‘sayUa_D einosayorg NANTY ‘Stustues100191/ Jo
uonraTJoD uedel ‘of epeury ‘uMueqiay [eoZopoodp [EUONRN ‘WOV SLFV YIMOS “eLOJa1g Jo Ayisraatuy) ‘aNNsUT ASopouYpayorg [eNyPNILIsy pur Asarog ‘auruters01g aayeiado-o7F ABopoujeg 921],
dy} JO WONDaTTOD aIMITNI MW SsPUrLAyIAN Hy} GYyIe9A ‘SamMyMo[PUTUNTYDS JOOA NeamnayeesUID JO UOTIaTJOI.21NY[ND aU} ‘SqO “W'S “WoRdaTJOD ainy[nD adAq, UesIaUTY “OO.LV ‘291NOs UOTIeT[OD aNyND)

eulyy) noyZ ax sisuauvuund g uo vpsadiuid ‘], POSSMND asuaupuund *T
uede{ eAnsey “HH vpsadiuid -J, yim paysayut viojfisuap 8SISMIND ‘S980I FAV ‘O8POINOL P6LOOW
uede/ eAnse “H —- vpsadiuad (J, YM pajsayut viopfisuap LSISMWO ‘T980IFATVWN ‘6ZP0IWOL ILOOOW — avuoyfisuap-1uid “T
eaIoy = WY H- Dury {-{ — wpsadiuid ‘], ym paysazut sisuarvsoy gq Z6EVETINOVA ZOLTONM
eIoy WY H- Dg ury {-{ — vpsadiud -], yy paysayut viopfisuap q €6€PE7TWOVA 7LOTONM winuvasoy “T
puryraZ MaN perysurm ‘{ W snqo.js q JO YUNIT, 669SPNANd 0€MWO
eoLyy YINOS paysurm ‘{ W Dpav] J Jo yooy 6608SO0.LV 8STMNO
puryeaz MON peTysurm ‘{ W DIDIPVA ‘q JO YUNAT, 968SPNAUd IZMIWO WNJDIUNA “T
uapams UIP “A /3.19q19BeT *, stajsaajds q SPSOSINAUd ‘LITMWO 67 TSESAO ussaqpuny “T
uede{ eAnseyyl * pido des s {
W'H pioiiaed 4m anasewa i ZI6OIFAAVW ‘9S8T TNO S9SOOW
ee Ache oyjdydvquad ‘rea . =
{ W'H Diojiaued 4 ursyoudsisn sdoSintatt L96OIPAAVW ‘8S8TIWOL PICOOW
uede{ eAnseyy “H vsopfisuap “q Uo vpsadiutd *], 8960IFAAVW ‘O98TTIWOL LITOOW
uede{ eAnsey “H bsopfisuap ‘q uo vpsadiuid ‘J, LOGOIPAAVWN ‘6S8T INO! SIZOOW
uede{ eAnsey “H vsopfisuap ‘q uo vpsadiuid * 1 99601 FATVW ‘FS8IIWOL 96¢EF7E7NOVA PIZOOW
uede{ eAnsey “H vopfisuap “gq Uo vpsadiuid * 1 S96OIFAAVW ‘SS8ITWOL EIZOOW
uede{ eAnseyl “H v4opfisuap “q uo vpsadiuid * I, PI6OTFAAVW ‘ZS8TIWOL LIZOOW
uede/ eAnse H —-baojfisuap snuig uo vpsadiuid snoimo], C9OIPATVW ‘S81 TINO! ‘S6ere7WOVA 90ZOOW ‘ds wnrydos804daT
ON
UISII 109910 201no ‘ON JO ‘4 sotoad
3110 12][0D S «ON 18410 nos pads

‘Apnys sty} UT syUaUTTIodxo SuTjeUr pue suostredusod yes1so[oydsour JOJ pasn sa}e[Os] *[ IqeI,

162

Table 2. Isolates used for molecular comparison.

GenBank No.
Species Isolate No.*! Origin ;
ITS2 & LSU Actin 6-tubulin
Leptographium sp. MCC206 Japan AB222065*? AB222061*? AB222063*?
MCC214 Japan AB222066** AB222062*7 AB222064*7
MCC217 Japan
MCC364 Japan
MCC365 Japan
L. koreanum KUC2072 Korea AY707196 AY707174 AY707183
KUC2102 Korea AY707197 AY707175 AY707184
L. lundbergii CBS352.29 Sweden AY707198 AY707176 AY707185
L. pini-densiflorae MCC071 Japan AY707199 AY707186
MCC194 Japan AY707200 AY707187
L. pyrinum DLS879 USA AY544604 AY544586 AY263185
L. terebrantis C418 USA AY544607 AY544589 AY263191
L. truncatum CMwW21 New Zealand DQ062056 DQ061990
CMW28 South Africa DQ062052 DQ061986
CMW30 New Zealand DQ062054 DQ061988
L. wingfieldii CMW2095 France AY707204 AY707177 AY707190
L. yunnanense CMW5304 China AY707206 AY707179 AY707192
Ophiostoma CMW2199 Japan AY553389
aenigmaticum
CMW2310 Japan AY553390
O. aureum ATCC16936 Canada AY544610 AY544592 AY263187
O. clavigerum ATCC18086 Canada AY544613 AY544595 AY263194
O. huntii UAMH4997 Canada AY544617 AY544599 AY349023
O. laricis CMW 1980 Japan AF343691
O. piceaperdum C274 USA AY707209 AY707182 AY707195
O. robustum CMW668 USA AY544619 AY544601 AY263185

*! Culture collection source: ATCC, American Type Culture Collection, U.S.A; C, Collection of T. C. Harrington, Iowa State
University; CBS, the culture collection of Centraalbureau voor Schimmelcultures, Utrecht, the Netherlands; CMW, culture
collection of the Tree Pathology Co-operative Programme, Forestry and Agricultural Biotechnology Institute, University
of Pretoria, South Africa; DLS, culture collection of D. L. Six; KUC, the Korea University Culture Collection, Korean
University, Korea; MCC, culture collection of the senior author; UAMH, University of Alberta Microfungus Collection and
Herbarium, Devonian Botanic Garden, Edmonton.

*? Accession numbers of the sequences obtained in this study.

necks and outer layers of the peridium. Morphologically characteristic structures were
measured and averages and ranges computed. Fifty measurements for each structure
were made.

Mating experiments

Isolates of the unknown Leptographium sp. were paired in all possible combinations.
In addition, four isolates originating from single ascospores derived from a single
perithecium from a cross between isolates MCC206 and MCC214, were paired with
each other in all possible combinations. We use MCC206 and MCC214 as tester isolates
and try to pair each one with other species listed in Table 1. Negative control mating
experiments also were done.

163

Plugs from 2-wk-old cultures on 2% MEA were excised with cork borer (5mm
diam.) and placed on 2% MEA. Plates were incubated at 15 °C in the dark for 2 weeks.
Two autoclaved pine twigs or sapwood blocks were then placed on the agar surface
and the plates were incubated for an additional 2 weeks. Donor cultures were flooded
with 600ml sterile and deionized water and conidial suspensions were prepared. This
suspension was poured on the twigs in the each recipient culture. Plates were then
incubated at 15 C and these were regularly inspected over a period of two months for
the mature perithecia.

DNA sequence comparisons

Cultures for DNA sequence comparisons were incubated on 2% MEA plates for
four weeks. DNA was extracted using the methods described by Kim et al. (2005).
Oligonucleotide primers used for both amplification and DNA sequencing of the internal
transcribed spacer (ITS) 2 and partial large subunit (LSU) regions of the ribosomal DNA
operon, portions of the actin and f-tubulin genes were the same as those used by Kim et
al. (2005). Methods for amplification and sequencing of each gene or gene region were
also as described by Kim et al. (2005). Both strands of fragments were sequenced and
sequences have been deposited in GenBank (Table 2, Fig. 1).

Obtained sequences were analyzed together with previously published sequences to
provide a sufficiently broad taxon sampling (Table. 2). Overall, the ITS2 and LSUrDNA—
D1 sequence data set included 23 sequences including those derived in this study. The
actin and 6-tubulin gene sequence data set was comprised of 16 and 22 sequences
including those obtained in this study.

Sequences were aligned using Clustal X version 1.81 (Thompson et alai927)):
Alignments were manually adjusted using the program BioEdit version 5.0.9 (Hall 1999).
The aligned data set was analyzed using the program PAUP*4.0 betal0 (Swofford 2002).
A parsimony analysis was carried out using the heuristic search with simple stepwise
addition, MAXTREE option set to 1000, and tree-bisection reconnection (TBR) option
of the program. Gaps were treated as missing data and all characters were equally
weighted. Bootstrap and jackknife values (each 1000 replicates) were also calculated.

Results

Morphology

The unknown Leptographium sp. from Japan was characterized by having mainly
two primary branches and conidia with truncated bases. These characteristics are
commonly found in various species of Leptographium. In particular, L. truncatum, L.
pini-densiflorae, L. koreanum, and the Leptographium anamorphs of Ophiostoma spp.
including L. laricis Van der Westh. et al., L. aenigmaticum K. Jacobs et al., L. huntii
M. J. Wingf. and L. piceaperdum K. Jacobs & M. J. Wingf. have similar characters to
those of the unknown Leptographium sp. from Japan. However, the stipe lengths of the
unknown Leptographium sp. were longer than those of L. piceaperdum, L. laricis and L.
aenigmaticum. Hyphal characteristics of the Japanese fungus were also different from
those of L. huntii, which are typically serpentine, but could not be distinguished from all
other species considered in this study. Primary branches of the Japanese Leptographium
sp. were smaller than those of L. truncatum. Conidia of the Leptographium sp. were the

164

(796) OUEYPUTIH 3 Asrpa{-WOsUTGOY » “(866 T) ‘Te 19 SGOdR{ , (S66) ‘Te 19 UAZINYISAM JOP UA 4 (100Z) PPEYSUIM 29 8qor"{ ,

——= OO ee eee eS

L6X9'6I 89 ae = = Sy 2s C= bee septate: a
IC-3 ~CE-OF Joyno [eleyjtiad jo 9ZIS

podeys Ajrepn3ar [22 pesoduoo yjem

3 a + ~
[PAO 0} d}eSUOTO 0} JeuosAjod —_zayno yersayytsad Jo adeys

SLATE = to AS —y , ¥—c X<11-9 co <S-Pe) SZ2-SV X SOG S aZIs a10dsoosy

; SUITIg poyesuoya ; ayeyjnono

podeys-jey yam pedeys-epy prosdija 0} Suoj;qo podeys-jey apenen a3e adeys a10dsoosy

e 2 6 3 a dij oy} edu
cx le SPV-07 0S-07 Ge-Oc €e—ce (APIM you peRetpLeg

0L-0F OOI-SE 0Z-0S 09-ZE (-0€) GL-CS Boe
ye YJPIM You [edayyag
O7L-OFT OL€-SIT OZET-00F — (0S8-)€09-€0S (-087) 0001-075 (sug Yoeu peIseyytieg
8rP—-087 PS7-7H1 OTES03C — {O0Z€=) 1S-661 (=0Z}) OL€-OFZ WIP [eayyad

a Be = OO) See ee eee
pllquny ‘CE WUNILJYUBIUAD ‘CE gStI140] ‘O puinpsadvaid ‘9 ‘ds uniydvs804daT Jayoereyy

Se ee a ee ee ee

‘satoods reprints Ayfestsojoydiour pure sarsads wniydvs804daT ayy Jo s1a\>e1eyD otydiowoayay, *€ a]qeI,

165

‘pajsa} JOU :.N ‘paonpoad (9¢< u) epayytied :++ ‘paonpoud (9g¢> u) ePayyed :+ ‘paonpoid epayjitied ou -,

ee SS PS SS SS SES I SIE ES IE DPE a TE DED SE LEDS LL LS LIL LE

Ne eLNGe LN GLN: “GLNe) eLN LNG GUN IN : 3 LN IN : LNG LN - p0ESMWNWO asuaupuund *T
LN i = - : : : Nie GN: 5 ; i ‘ ; = : z V6IDOW
IN - - - : : ee Nee EN : - - : - ; : - ILOOOW aviopfisuap-tuid “T
LN a ; a < 5 * LN IN ‘ . - 3 ‘ 3 3 3 0O€MWO
LN ? “ - r i ‘ LN LN ; = 3 . 5 ; ¢ : 8CMWO
IN 2 : 5 2 2 & Fine iN = = - : - = - - IZMWO winqwIUNA “T
LN : : : : : = 4UNy -SLN é : : ; . : : - 6¢7SESAD ussaqpuny *T
TNS etNee INS N= QiN@ GUNG 7 LN® SLN© SLN: = “NS EIN a PINE SIN = ee er 0zon
IN LUNG uNes auN IN LNG LNS EEN IN 5 % LNG aeLN = LN LN + COTCONA

4 ; : - : : : : - - - + - ++ - - - S9EDOW

: : - - - - : - = ++ : - - - ++ : - P9EDOW
IN : - - - : “a - ALN = aL. “ : 3 : 7 + E z LICOOW
IN : 2 - : - See eNO SL - - - = + = ; STCOOW

- - - - - = - : = ++ 2 2 : = + : ++ VICOOW
IN - - - : : > GNee SN : + : Se ee - + - —- €1ZDOW
IN * S - - - sm STN Ge SLN - - = = 2 + 2 : TIIZOOW

: 4 : 5 ‘ : : + + : : rh z ++ 2 - - 9ZDOW ‘ds wniydv180,daT

Jouop

VOESMNO
V6IDOW
TZODOW
0O€MWO
8CMWO
ICMWO
67 TSESAD
CLOTONA
cCOTCONA
S9COOW
VIEOOW
LICOOW
STCOOW
VICOOW
eITOOW
ITCOOW
90TOOW

wee Me ot ee ll ee a i a es Se
yuatdise1
aaa eee ree eee ee ee eee eee eer ee eee rere eee ——eeee

‘ds wmrydes80\da7T oy} Jo yuoutiadxe SueUl Jo INsay "fp 21qRL,

166

same as those of L. koreanum, which are oblong to ovoid and relatively straight and thus,
different to those of other species.

The morphology of the teleomorph structures produced as a result of the pairing
of various strains was similar to those of Ophiostoma piceaperdum (Rumbold) Arx, O.
aenigmaticum K. Jacobs et al., and O. huntii (Rob.-Jeffr.) de Hoog & R. J. Scheff. where
ascospores were hat-shaped and perithecial necks had no ostiolar hyphae. Perithecia
sizes and neck lengths overlapped between species and could not be clearly separated.
However, the ascospores of the unidentified Ophiostoma sp. were larger than those of —
the other species with which it might be confused (Table 3).

Mating experiments

Two isolates (MCC206 and MCC214) of the unidentified Leptographium sp. from
Japan produced protoperithecia in culture, but none of them produced mature perithecia
unless they were paired with other isolates. Pairing of isolates with themselves did not
result in perithecia. The results of the pairing of isolates in all possible combinations
showed that some isolates were able to produce perithecia (Table 4). In addition, an
isolate of the Japanese Leptographium sp. produced perithecia, when it was crossed with
the ex-type strain of L. koreanum (KUC2102), and not when it was paired with other
fungal species such as L. truncatum and L. pini-densiflorae. The result of crosses between
single ascospore isolates showed clearly that the mating behavior of this fungus was
heterothallic with two mating types.

DNA sequence comparisons

Phylogenetic analyses of sequences for the ITS2 and partial LSU of rDNA gene
regions showed that isolates of the unknown Leptographium sp. from Japan is clearly
distinct from O. piceaperdum, O. laricis, O. aenigmaticum and L. pini-densiflorae but
that it reside a monophyletic group with isolates of L. koreanum, L. truncatum, L.
yunnanense and other Ophiostoma spp. and Leptographium spp. (Fig. 1a). This result was
supported by strong bootstrap/Jackknife values (83/78). From a total of 610 characters,
572 characters were constant, 13 variable characters were parsimony uninformative and
25 were informative. The heuristic search gave rise to 390 most parsimonious trees, of
which one was chosen for presentation (Fig. la). The tree had a length of 44 steps with
a Consistency Index (CI) of 0.9091, a Homoplasy Index (HI) of 0.0909, and a Retention
Index (RI) of 0.9565.

Phylogenetic analysis of the ®-tubulin gene sequences resulted in the most
parsimonious tree shown in Fig. 1b. This analysis also showed that the unknown
Leptographium grouped with high bootstrap/Jackknife support (92/82) in the clade
containing L. koreanum, and not with L. truncatum, L. yunnanense, L. lundbergii, O.
piceaperdum, and O. aenigmaticum. From a total of 360 characters, 235 characters
were constant, 19 variable characters were parsimony-uninformative and 106 were
informative. The heuristic search found 87 most parsimonious trees of which one was
chosen for presentation (Fig. 1b). The tree had a length of 221, a Consistency Index (CI)
of 0.8190, a Homoplasy Index (HI) of 0.1810, and a Retention Index (RI) of 0.8987.

The phylogenetic analysis of the actin gene sequences showed that the unknown
Leptographium sp. from Japan resided in a monophyletic group with L. koreanum
(Fig. 1c) with high bootstrap/Jackknife support (99/98). Leptographium yunnanense

(a)

0. robustum CMW868

O, aureum ATCC16936

L. wingfieldii CMW2095

L. pyrinum DLS879

O. clavigerum ATCC18086
L. terebrantis C418

O. huntii UAMH4997

L. fruncatum CMW28

L. truncatum CMW21

L. truncatum CMW30

L. yunnanense CMW5304

L. jundbergii CMW217

O. koreanum MCC217

L. koreanum KUC2072

L. koreanum KUC2102

0. koreanum MCC206

0. koreanum MCC214

O. piceaperdum C274

O, laricis CMW 1980

O. aenigmaticum CMW2199
O. aenigmaticum CMW2310
L. pini-densiflorae CMW5157

L. pin-densifiorae CMW5158

ae 1

(Cc)

83/78

100/99

L. koreanum KUC2102

0. koreanum MCC365
39/89 0. koreanum MCC364
0. koreanum MCC214
2s O. koreanum MCC206
L. koreanum KUC2072
iL. yunnanense CMW5304
uae 87/76 JL. terebrantis C418

O. clavigerum ATCC 18086
54/82 L. wingfieldii CMW 2095

O. robustum CMW668
i. pyrinum DLS879

O. aureum ATCC16936
L. lundbergif CMW217

O. huntii VAMH4997

“

O. piceaperdum C274

(b)

L, koreanum KUC2072
O. koreanum MCC365
O. koreanum MCC364
0. koreanum MCC217
QO, koreanum MCC214
O. koreanum MCC206
L. koreanum KUC2102
L. truncatum CMW28
L. truncatum CMW21
L. truncatum CMW30
L. yunnanense CMW5304
L. fundbergii CMW217
O. hunt UAMH4997
©. piceaperdum C274

L. pyrinum DLS879

Q. aureum ATCC16936

O. robustum CMW668

O. clavigerum ATCC1808

L. terebrantis C418

L. wingfieldii CMW 2085

L. pini-densifiorae CMW5158

L. pini-densiflorae CMW 5157

50/52

400/100

— 10
( d) L. wingfieidii CMW 2095
50; — | 0. fobustum CMW668
84/72 iL. ferebrantis C418
79f76 O. clavigerum ATCC18086 —
100/100

L. pyrinum DLS879
O. aureum ATCC16936
O. huntif UAMH4997
L. koreanum KUC2072

400/99 [0. koreanum MCC214
O. koreanum MCC206
L. koreanum KUC2102
L. yunnanense CMW5304

L. lundbergii CMW217

O. piceaperdum C274

167

Fig. 1. The most parsimonious trees for each of the three nuclear gene datasets.and the combined
datasets: (a) rDNA, (b) f-tubulin, (c) actin, and (d) combined. The tree is unrooted. Bootstrap and
Jackknife values > 50% with 1000 replications are indicated at the left of the branches (bootstrap
value/Jackknife value).

168

appeared in a sister clade to L. koreanum. From a total of 763 characters, 668 characters
were constant, 51 variable characters were parsimony-uninformative and 44 were
informative. The heuristic search gave rise to two most parsimonious trees of which one
(Fig. 1c) is presented. The tree length was 132 with a Consistency Index (CI) of 0.8788, a
Homoplasy Index (HI) of 0.1212, and a Retention Index (RI) of 0.9171.

A combined sequence data set was also produced including 14 sequences representing
the ITS2 and LSUrDNA—D1 domain, and parts of the actin, and B-tubulin genes. As was
true for the analyses of the sequence data for the individual genes or gene regions, the —
phylogenetic analyses (Fig. 1d) showed that the unknown Leptographium sp. from Japan
resided in a monophyletic group with L. koreanum, with a high bootstrap/Jackknife
values (100/99). In this tree (Fig. 1d), L. ywnnanense resided in a sister group to L.
koreanum. From a total of 1728 characters, 1510 characters were constant, 110 variable
characters were parsimony-uninformative and 108 were informative. The heuristic
search found two most parsimonious trees of which one was chosen for presentation.
The tree length was 305 with a Consistency Index (CI) of 0.8659, a Homoplasy Index
(HI) of 0.1344, and a Retention Index (RI) of 0.9014.

Taxonomy

Results of the DNA sequence and morphological comparisons show clearly that the
Leptographium anamorph of unknown Ophiostoma species from Japan is conspecific
with L. koreanum. Furthermore, crosses between isolates of this fungus and those of
L. koreanum have given rise to its Ophiostoma teleomorph. Teleomorph characteristics
are also distinct from other Ophiostoma spp. with Leptographium anamorphs. Thus,
on the basis of the mating behavior, morphological characteristics and DNA sequence
comparisons, we described the teleomorph of L. koreanum as follows:

Ophiostoma koreanum Masuya, J.-J. Kim & M. J. Wingf. sp. nov. Figs. 2-7.
Anamorph: Leptographium koreanum J.-J. Kim & G.-H. Kim, Mycol. Res. 109(3): p. 275,
2005.

Perithecia basi nigra, globosa vel subglobosa, 240—310 um diam, Collum cylindraceum,
curvatum vel rectum, 560—1000 um longum, ad basim 52—75 um latum. ad apicem
25—33 um latum, apice obtusum vel truncatum, hyphis ostioli non praeditum. Asci
evanescenti. Ascosporae hyalinae, aseptatae, aspectu laterali cuculatae, aspectu frontali
triangulatae, vagina hyalina circumdantes, 5.5—10.5 x 4.5—7.5um.

Etymology: Derived from the name of anamorph, Leptographium koreanum.

Perithecia superficial or partly embedded in the substratum and medium. Basal
part black, globose to subglobose, 240—310 (mean 290) tm diam. without hyphal
ornamentation, outer layer of the peridium composed of thick-walled, more or less
isodiametric, polygonal or irregularly shaped cells, 10—22 x 8—21 (mean 18 x 12) um.
Necks dark brown to black, broad at the base, becoming cylindrical or slightly tapered
at the tip, straght or curved, 560—1000 (mean 680) um long, 52—75 (mean 68) um
wide at base, 25—33 (mean 30) um wide near the tip, composed of dark; thick-walled,
squamous cells, 4—10 x 2—4 um, terminating in an obtuse to truncate apex. Ostiolar
hyphae absent. Asci evanescent, clavate when young, subglobose when mature, up to 25
x 20 um. Ascospores, hyaline, one-celled, hat-shaped or cucullate in side view, triangular

169

Fig. 2—7. Ophiostoma koreanum. Fig. 2. Perithecium. Fig. 3. Ascospore. Fig. 4. Ascospores. Fig.
5. Outer layer of the peridium composed of thick-walled, more or less isodiametric, polygonal or
irregularly shaped cells. Fig. 6. Tip of perithecial neck. Fig. 7. Perithecial neck, composed of dark,
thick-walled, squamous cells. Bars: Fig. 2 = 100um, Figs. 3—5, 7 = 10pm, Fig. 6 = 5pm.

170

in front view, 5.5—10.5 x 4.5—7.5 (mean 7.5 x 5.5) um, surrounded by a distinct hyaline
wall, sometimes accumulating in a white mass at the tips of neck.

Morphology of anamorph is as described for L. koreanum (Kim et al. 2005).

Hosts: Pinus densiflora, P. koraiensis Siebold & Zucc. and other Pinus spp.

Isolated from following insects: Tomicus piniperda L., Hylurgops interstitialis
(Chapuis), Hylastes paralleus Chapuis, Hylastes plumbeus Blandford and other bark
beetle species.

Known distribution: Korea, Japan.

CULTURES AND SPECIMENS EXAMINED—HOLOTYPE: DAOM234414, dried
culture derived from the pairing of the cultures KUC2102 (MAT-1) (DAOM234392)
(KOREA. YEOJU: Sawmill, Central Forest Products Processing & Marketing Center,
P. koraiensis log, 10 Aug 2000, J.-J. Kim & G.-H. Kim) and MCC206 (MAT-2)
(DAOM234395, JCM11853, MAFF410963) ( JAPAN. IBARAKI: Tsukuba, T. piniperda
adult, 4 Apr 1995, H. Masuya) on P. contorta Dougl. sapwood block. PARATYPES:
FPH (= TFM) 7605, dried culture from pairing between isolates MCC206 (MAT-2)
(DAOM234395, MAFF410963) and MCC214 (MAT-1) (DAOM 234396, JCM11854,
MAFF410966) ( JAPAN. YAMANASHI: Masuho, T. piniperda adult, 15 May 1996, H.
Masuya) on P. densiflora twigs, FPH (TFM) 7606, dried culture from pairing between
isolates MCC213 (MAT-2) (JCM11855, MAFF410965) (JAPAN. FUKUSHIMA:
Amasakae, T. piniperda adult, 24 Jun 1996, H. Masuya) and MCC214 (MAT-1) on P.
densiflora twigs, FPH (TFM) 7607, dried culture from pairing between isolates MCC365
(MAT-2) (JCM11856, MAFF410962) (JAPAN. IWATE: Matsukawa, H. interstitialis
adult, 1 Jun 2000, H. Masuya) and MCC214 (MAT-1) on P. densiflora twigs. Additional
cultures examined. KOREA. YEOJU: Sawmill, Central Forest Products Processing &
Marketing Center, P. koraiensis log, 10 Aug 2000, J.-J. Kim & G.-H. Kim (KUC 2072, MAT-
1, DAOM 234393, CMW14199). Bongwha: Sawmill, National Forestry Cooperatives
Federation, P. densiflora log, 9 Aug 2000, J.-J. Kim & G.-H. Kim (KUC 2078, MAT-1,
CMW 14201, PREM 58261). JAPAN. IWATE: Ichinoseki, T. piniperda adult, 19 Jun
1996, H. Masuya (MCC211, MAT-1, JCM11857, MAFF410964), HOKKAIDO: Yamabe,
bark of P. sylverstris dead tree, 7 Nov 1996, H. Masuya (MCC215, MAT-2, JCM11859,
MAFF410967), IBARAKI: Tsukuba, T. piniperda adult, 18 May 1995, H. Masuya
(MCC217, MAT-1, JCM11860, MAFF410968), IWATE: Matsukawa, H. interstitialis
adult, 1 Jun 2000, H. Masuya (MCC364, MAT-1, JCM11858, MAFF410961).

Discussion

Results of this study have shown that the unidentified Leptographium sp. commonly
isolated from pine bark beetles and bark beetle-infested Pinus spp. in Japan is
morphologically and phylogenetically identical to L. koreanum. Leptographium
koreanum was originally isolated from Korean (P. koraiensis) and Japanese red (P.
densiflora) pine in Korea and was described as a new species by Kim et al. (2005). This
fungus was frequently isolated from T. piniperda and it appears to be an important
causal agent of blue-stain of conifer timber in Korea.

In this study, we have shown that L. koreanum in Japan is able to form a teleomorph
when sexually compatible isolates are crossed. We have thus described the teleomorph
of the fungus as O. koreanum. This fungus has been known in Japan for more than a
decade where is was reported as an undescribed Ophiostoma sp. by Masuya et al (1998,

171

1999), frequently associated with the pine shoot beetle, T. piniperda. The Japanese
Leptographium strains could be also paired with the ex-type strain of L. koreanum
confirming that these two are biological heterothallic species. The distribution and
ecology of L. koreanum and O. koreanum thus appear to be similar in Korea and Japan.

The teleomorph of L. koreanum described in this study is characterized by hat-
shaped ascospores and long necks without ostiolar hyphae. In this regard it is similar to
that of O. piceaperdum sensu Jacobs et al. (2000) and related species. Taxonomic status
of O. piceaperdum, however, remains questionable. Morphological comparisons of the
dried type specimens led Jacobs et al. (2000) to treat O. europhioides (E. F. Wright &
Cain) H. Solheim and O. pseudoeurophioides (Olchow. & J. Reid) Georg Hausner et al.
as synonyms of O. piceaperdum. However, recent DNA based comparisons by Hausner
et al. (2000) showed that O. europhioides, O. pseudoeurophioides and O. piceaperdum
reside in different clades. This suggests that the species concept of O. piceaperdum
sensu Jacobs et al (2000) deserves reconsideration. Indeed, Olchowecki & Reid (1974)
showed that the Leptographium anamorph of O. pseudoeurophioides has curved conidia,
unlike O. piceaperdum illustrated by Jacobs et al. (2000). Because the ex-type cultures
of O. pseudoeurophioides and O. piceaperdum are no longer available, it is not possible
to consider their morphological characteristics or to make DNA based phylogenetic
comparisons. These studies are required but must await further collections.

Leptographium koreanum does not have curved conidia and its LSU rDNA
sequences do not correspond with those of O. pseudoeurophioides (GenBank accession
No. AF155678). These species are, therefore, clearly different. In addition, our DNA
sequence comparisons have shown that O. koreanum is not related to well-defined
culture of O. piceaperdum. We are thus confident that the new species does not represent
O. piceaperdum.

Ophiostoma aenigmaticum was described by Jacobs et al. (1998) from Japan. This
species had previously been treated as O. europhioides by Yamaoka et al. (1997) but
was differentiated from O. europhioides based on the characteristic of elongated brims
of the ascospores (Jacobs et al. 1998). Because O. koreanum does not have ascospores
with elongated brims and because O. aenigmaticum is homothallic, as opposed to the
heterothallic O. koreanum, these species can easily be distinguished from each other. In
addition, they also differ in their hosts and insect vectors. DNA based comparisons in this
study have also shown that O. aenigmaticum is more closely related to O. piceaperdum
than to L. koreanum.

The heterothallic mating behavior appears to be relatively uncommon in Ophiostoma
with Leptographium anamorphs. While heterothallism has been noted for many
ascomycetes including those from the genus Ophiostoma (Brasier 1993), O. huntii is
the only Ophiostoma with a Leptographium anamorph that has previously been shown
to display this mating behaviour (Jacobs et al. 1998). This is in contrast to species such
as O. piceaperdum sensu Jacobs et al. (2000), O. europhioides, and O. aenigmaticum that
have been reported to be homothallic. The fact that O. koreanum is heterothallic clearly
distinguishes it from related Ophiostoma species with Leptographium anamorphs.

A relatively small number of Leptographium spp. have known teleomorphs and the
majority of these appear to have hat-shaped ascospores (Jacobs & Wingfield 2001). In
some cases such as that of Leptographium wageneri var. ponderosae, perithecia thought
to represent an Ophiostoma state have been found in galleries of beetle vectors but these

have never been found in culture. This makes it difficult to confirm the anamorph/
teleomorph connection. It is not uncommon to discover teleomorph states in fungi
thought to exist only in the asexual form (Kuhls et al. 1996, Hodge et al. 1996, Chaverri
et al. 2001). The discovery of the teleomorph of L. koreanum arising from crosses
between different isolates suggests that some other Leptographium species might also
be heterothallic and might have the ability to produce perithecia in crosses of sexually
compatible isolates under suitable environmental conditions. This is clearly an area of
research worth pursuing.

Acknowledgements

We thank Drs. T. Kubono, Y. Ichihara and M. Nakamura, Tohoku Research Center of Forestry
& Forest Products Research Institute, Japan for technical help; Dr. K. Jacobs, University of
Stellenbosch, South Africa for providing molecular data of several Leptographium species; Drs.
A. Uzunovic, Canadas Wood Products Research Institute, Forintek Canda Corp., Canada and
T. Kiristis, University of Natural Resources and Applied Life Sciences, Austria, for kind review of
this manuscript.

Literature cited

Brasier CM. 1993. The genetic system as a fungal taxonomic tool: Gene flow, molecular variation
and sibling species in the ‘Ophiostoma piceae-Ophiostoma ulmi? complex and its taxonomic and
ecological significance. In Ceratocystis and Ophiostoma. Taxonomy, Ecology and Pathogenicity
(eds. M. J. Wingfield, K. A. Seifert, and J. E Webber), pp. 77-92. The American Phytopathological
Society, St. Paul, Minnesota.

Chaverri P, Samuels GJ, Stewart EL. 2001. Hypocrea virens sp. nov., the teleomorph of Trichoderma
virens. Mycologia 93:1113-1124.

Cobb FW. 1988. Leptographium wageneri, cause of black stain root disease, a review of its discovery,
occurrence and biology with emphasis on pinyon and ponderosa pine. In Leptographium root
disease in conifers (eds. Harrington TC, Cobb FW), pp. 41-62. The American Phytopathological
Society, St Paul, Minnesota.

Gibbs JN. 1993. The biology of ophiostomatoid fungi causing sapstain in trees and freshly cut logs.
In Ceratocystis and Ophiostoma. Taxonomy, Ecology and Pathogenicity (eds. M. J. Wingfield,
K. A. Seifert, and J. F. Webber), pp. 141-152. The American Phytopathological Society, St. Paul,
Minnesota.

Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program
for Windows 95/98/NT. Nucl Acids Symp Ser 41:95-98.

Harrington TC. 1988. Leptographium species, their distributions, hosts and insect vectors. In
Leptographium root disease in conifers (eds. Harrington TC, Cobb FW), pp. 1-39. The American
Phytopathological Society, St Paul, Minnesota.

Hausner G, Reid J, Klassen R. 2000. On the phylogeny of members of Ceratocystis s. s. and
Ophiostoma that possess different anamorphic states, with emphasis on the anamorph genus
Leptographium, based on partial ribosomal DNA sequences. Can J Bot 78: 903-916.

Hodge KT, Krasnoff SB, Humber RA. 1996. Tolypocladium inflatum is the anamorph of Cordyceps
subsessilis, Mycologia 88: 715-719.

Jacobs K, Wingfield MJ, Wingfield BD, Yamaoka Y. 1998. Comparison of Ophiostoma huntii and
O. europhioides and description of O. aenigmaticum sp. nov. Mycol Res 102: 289-294.

Jacobs K, Wingfield MJ, Crous PW. 2000. Ophiostoma europhioides and Ceratocystis
pseudoeurophioides, synonyms of O. piceaperdum. Mycol Res 104: 238-243.

Wp)

Jacobs K, Wingfield MJ, Wingfield BD. 2001. Phylogenetic relationships in Leptographium based on
morphological and molecular characters. Can J Bot 79: 719-732.

Jacobs K, Wingfield MJ. 2001. Leptographium species, tree pathogens, insect associates, and agents
of blue-stain. The American Phytopathological Society, St. Paul, Minnesota, USA: APS press.
207p.

Jacobs K, Solheim H, Wingfield BD, Wingfield MJ. 2005. Taxonomic re-evaluation of Leptographium
lundbergii based on DNA sequence comparisons and morphology. Myco Res 109: 1149-1161.

Kim J-J, Lim YW, Breuil C, Wingfield MJ, Zhou XD, Kim GH, 2005. A new Leptographium species
associated with Tomicus piniperda infesting pine logs in Korea. Mycol Res 109: 275-284.

Kuhls K, Lieckfeldt E, Samuels GJ, Kovacs W, Meyer W, Petrini O, Gams W, Borner T, Kubicek
CP. 1996. Molecular evidence that the asexual industrial fungus Trichoderma reesei is a clonal
derivative of the ascomycete Hypocrea jecorina. Proc Natl Acad Sci USA 93:7755-7760

Masuya H, Kaneko S, Yamaoka Y. 1998. Blue stain fungi associated with Tomicus piniperda
(Coleoptera: Scolytidae) on Japanese red pine. J For Res 3: 213-219.

Masuya H, Kaneko S, Yamaoka Y, Ohsawa M. 1999. Comparisons of ophiostomatoid fungi
associated with Tomicus piniperda and T. minor in Japanese red pine. J For Res 4: 131-135.
Masuya H, Wingfield MJ, Kaneko S, Yamaoka Y. 2000. Leptographium pini-densiflorae sp. nov. from

Japanese red pine. Mycoscience 41: 425-430.

Masuya H, Yamaoka Y, Kaneko S. 2001. Ophiostomatoid fungi isolated from Japanese red pine and
their relationship with bark beetles. Proceeding of 3rd Regional Workshop of IUFRO working
party 7.03.08, Forest Protection in Northeast Asia. Chiayi, Taiwan. p.193-198.

Masuya H, Kaneko S, Yamaoka Y. 2003. Comparative virulence among blue-stain fungi isolated
from Japanese red pine. J For Res 8: 83-88.

Olchowecki A. Reid J. 1974. Taxonomy of the genus Ceratocystis in Manitoba. Can J Bot 52:
16/5-17 Lt.

Robinson-Jeffrey RC, Grinchenko AHH. 1964. A new fungus in the genus Ceratocystis occurring
on blue-stained lodgepole pine attacked by bark beetles. Can J Bot 42:527-532.

Seifert KA. 1993. Sapstain of commercial lumber by species of Ophiostoma and Ceratocystis. In
Ceratocystis and Ophiostoma. Taxonomy, Ecology and Pathogenicity (eds. MJ Wingfield,
KA Seifert, JF Webber), pp. 141-151. The American Phytopathological Society, St. Paul,
Minnesota.

Solheim H, Langstrém B, Hellqvist C. 1993. Pathogenicity of the blue-stain fungi Leptographium
wingfieldii and Ophiostoma minus to Scots pine: effect of tree pruning and inoculum density.
Can J For Res 23: 1438-1443.

Swofford DL. 2002. PAUP* 4.0 Phylogenetic analysis using parsimony, version 4.0b. Sunderland,
Massachusetts: Sinauer Associates, Inc.

Thompson JD, Gibson TJ, Plewniak FE, Jeanmougin F, Higgins DG. 1997. The ClustalX windows
interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nuc Acid Res, 24: 4876-4882.

Van der Westhuizen K, Wingfield MJ, Yamaoka Y, Kemp GHJ, Crous PW. 1995. A new species of
Ophiostoma with Leptographium anamorph from larch in Japan. Mycol Res 99: 1334-1338.
Yamaoka Y, Wingfield MJ, Takahashi I, Solheim H. 1997. Ophiostomatoid fungi associated with the

spruce bark beetle Ips typographus f. japonicus in Japan. Mycol Res 101: 1215-1227.

Zhou XD, Jacobs K, Morelet M, Ye H, Lieutier F. Wingfield MJ. 2000. A new Leptographium species

associated with Tomicus piniperda in southwestern China. Mycoscience 41: 573-578.

é
JW!
.

SG ia en rt a wt

en lh sockes ts re ee =

i ee

yer Lives a in

} vty one Ca ea « ‘
| ete if ppalipaatececbat fae
zh pe Waal Pat elo on? jo oa ad
toe _ LOT eth ii righ Mai) sedatits ak viabbrs wis! of a 7. a a
cf)? roarelyae Sth nA oda ier eee Pere aoyrsiges |

—s ‘wileaigls x fring oe erty CiiaaRie yt ae rot Bi PRM am? ke M
- Se wi Cry tr laa a0 ce
j - f Aeeee os
ou.’ ie yt my ites et at) Ber ir air ace Mh sail :
ta CNP aOR T Sas cnagar Bh OR sits eine dae a
; iow: vi . eine preraMreipyhagal MOUS Y weg? pave ne Yep
3 eS es Suit bye seongegh
f mae 4 e Mi es es iyaut Bilurcoteg, 1M (4 clans ; vdohtendt Appeal
“Win oD Aho Anco Twi ga BrP yiabtrvaneags ating send Haw eriiseddsbwatiadion / -
7 as 1 Ae Tag dan eT crest coak erherdralle HMI Tey LIT AR yt gr |
Pe be mt preie hiapiney Whetestv nals habe Paget eeyl. siahsnobanigeetl:
a f ‘I eis ial i. 2° et SUS doh: he: bdibiah snhes weia
‘hi ia ee eg BPs KC OMWIOY avian Sahd ig immedi BURT bist) A bbdwersio ny

b 4 7 ‘ ‘ . i
= : » e 4 AP 8 Pie a 9, wen 1 a Bw ls a ‘hme “at ‘jaeaberinan

= ‘
taint cs Rs pitts Mi ceri opel 4d sepwsaai J wna 4 | HHA operetta aa yfisl -noanaledt -
7 Licaagy ON ce yahlelorb sg i Misa ‘Crm petiny agiod tis cn uta alae tary
Ne ey wenn cal? ta wueyoife ON ae: ohio? A Ueyt bene Vets Pabiei
owe ah nhiaigeetuary | hea ogiiing 0 jugpdnghia't sty, RET HRS»
At at Are be i as Hiieipnenit watredeA SHYT PP4-18) “hu bdo" Th, depstrad: Aa

tee

" a —. Ng eae of 1 Si'ay 4 inte "a aed pags,
, ive Fisthy w ee He ’ Ay wy: id Paty panier treet) iy {edie he Lape a
7 sei ats Winans tit lesb whet id patna aun ore 0 Ba or
“ay wore. os Date
: Shy pity i i ve ws peti quae AS prea ari an . ‘ean | 7
ee "arth ail A tHsnialwethonbads sah

. Pe Z ‘wheal lal rep ‘(ate geese ie
Ay alte ania et spy Potente area mi eeion ie EL

tye
Be " vik

etemare rie eee at vitiaaieey qui
wh Hilt tt ne REN it
¥ nek . oe

| : Bs vera oz rt
ayy” eo a ae 22-48 oon
7 ih 44 argu, Me ehh Ve ram

ee snernceenaratage ith Reowegye,

eT a

MY COTAXON

Volume 94, pp. 175-179 October-December 2005

Two parasitic fungi on a new host, Syringa (Oleaceae)

OvIDIU CONSTANTINESCU’, VADIM A. MEL’NIK? & GERARD J.M. VERKLEY?

‘ovidiu.constantinescu@evolmuseum.uu.se
Botany Section, Museum of Evolution, Uppsala University
Norbyvagen 16, SE-752 36 Uppsala, Sweden

?Komarov Botanical Institute, Laboratory of Systematics and Geography of Fungi
Prof. Popov Street 2, RU-197376 St. Petersburg, Russia

°Fungal Biodiversity Centre, Centraalbureau voor Schimmelcultures
Uppsalalaan 8, NL-3584 CT Utrecht, The Netherlands

Abstract—Thedgonia ligustrina, the agent of Ligustrum leaf-spot, and Gloeosporidiella
turgida, known as a parasite of Fraxinus, are reported for the first time on Syringa spp.
Both fungi were found in Sweden, the first in a tree nursery in the south, and the second
on plants cultivated in Uppsala. Brief descriptions and illustration are provided and the
distribution of T: ligustrina is reviewed.

Key words—anamorph, Ascomycota, Lithuania, taxonomy

Introduction

Several species of Syringa (lilac) are cultivated in Sweden for ornamental purposes
(Nitzelius 1964). One parasitic fungus found on S. vulgaris L., presented for identification
to the first author in 1985, and another one found on S. xchinensis Willd. in 2003-2005
by V.M. and O.C., were identified as parasites of Ligustrum and Fraxinus, respectively, all
members of the Oleaceae. These fungi were also isolated in culture, using the procedure
described by Constantinescu (1988). Because these fungi have been described and
illustrated in detail by previous authors, only short descriptions are provided and few,
significant details are illustrated in this paper. The nomenclature of colony colour follows
Kornerup & Wanscher (1983), the abbreviation of herbaria those from Holmgren et al.
(1990), and UPSC is the acronym of Uppsala University Culture Collection of Fungi.

Thedgonia ligustrina (Boerema) B. Sutton (Figs 1a & 2a)

A leaf-spot disease of Syringa vulgaris cultivated in a tree nursery in southern Sweden
was observed in 1985. In late autumn the same year several leaves showing symptoms
and the presence of a fungus were received for identification at UPSC.

On the upper leaf surface the fungus produces small, 0.5-1.5 mm round to irregular,
silvery spots, surrounded by a narrow, reddish brown margin. When the spots coalesce,
larger portions of the surrounding tissue become brown, necrotic. On the corresponding
lower surface, an ochreous tuft develops composed of conidiophores emerging from
colourless stromata and conidia. The conidiophores are agglomerated in fascicles,

176

colourless, 30-75 um long, 4-6 um wide, with 1-2 (-3) flat, not thickened scars located
at the tip or slightly below. The conidia are colourless, more or less cylindrical, 35-75 x
4-6 um, 0-4 septate.

Cultures initiated from conidia: on 2% malt-extract agar, the fungus grows very
slowly, forming colonies of 3-4 mm diam in 10 days at ca. 20°C; the colonies appear
umbonate, Brownish Orange to Light Brown (6CD 4-5), reverse Dark Brown (8F 4-5),
margin narrow, deep; exudate and diffusible pigment absent; the surface is velvety
and composed of erect hyphae Advancing hyphae are colourless, straight to slightly
curved, 3-3.5 um diam, septate every 15-25 um, sparingly branched, branches at ca.
50-70°, usually arising just below the septum of the subtending hypha; older hyphae
yellowish to brownish, 5-8 um diam, constricted at septa, later becoming moniliform to
chlamydospore-like and then up to 13 um diam.

Fig. 1. Fungi on Syringa; conidiogenous cells and conidia of a - Thedgonia ligustrina (UPS F-
117834) and b - Gloeosporidiella turgida (UPS F-118065). Bar = 10 um).

SPECIMENS EXAMINED -- On Syringa vulgaris: SWEDEN. Skane, Veberéd,
Bjorkhaga tree nursery (55°38'N 13°287E), XI. 1985, coll. L. Nilsson, det. O.
Constantinescu UPS F-117834; living culture UPSC 1699 (now at CBS 113536); dried
culture UPS F-118064. On Ligustrum vulgare: GERMANY. Bayern, Oberbayern, Bad
Reichenhall, “Thumsee (47°43’N 12°50’E), 13 VIII 1996, U. Braun in Triebel, Microfungi
exsiccati 348 UPS F-11959. KOREA. Suw6n, Guundong street, near the entrance to
NIAST, (37°15°N 127°00’E), 25 X 2003, V. Melnik LE 214697. LITHUANIA. Alytus,
Punia Forest (54°32’N 24°04’E), 7 1X 2000, A. Treigiené BILAS 27697; environs of Vilnius,
PaSilaiciai (54°44°N 25°42’E), 15 VII 2002, A. Treigiené BILAS 27698. ROMANIA.
Bucuresti, Mogosoaia Castle park (44°31’N 26°00’E), 26 X 1968, O. Constantinescu in
Herb. Mycol. Romanicum 2010 BUCM; UPS; living culture CBS 547.71.

Fig 2. a - Leaf spot of Syringa vulgaris produced by Thedgonia ligustrina (UPS F- 117834).
b - Stromatic conidioma of Gloeosporidiella turgida on twigs of Syringa xchinensis (UPS F-118065).
c - Acervular conidioma of Gloeosporidiella ribis on leaves of Ribes rubrum (UPS F-120164).

Bars = 1 cm ina, 75 um in b, and 25 um inc.

Discussion — The characters of the fungus present on Syringa agree well with the detailed
descriptions and illustrations of Thedgonia ligustrina from Ligustrum in Sutton (1973),
Yoshikawa & Yokoyama (1992), and Braun (1995). Our specimen was also compared
with several herbarium specimens.

Thedgonia ligustrina was recorded previously only on various species of Ligustrum,
such as L. japonicum Thunb., L. obtusifolium Siebold & Zucc., L. ovalifolium Hassk., and
L. vulgare L. Syringa is thus a new host record. Both Ligustrum and Syringa belong to the
family Oleaceae. The presence of T. ligustrina on Syringa, particularly in a tree nursery,
seems to be the result of a ‘host jump’ in the sense of Parlevliet (1979).

With the recent records by Stakvileviciené (2004) and Mel'nik et al. (2005), the
distribution of T. ligustrina includes Austria, Denmark, France, Holland, Germany,
Japan, Lithuania, Korea, Romania, Sweden, United Kingdom and USA.

Attempts by Yoshikawa & Yokoyama (1992) to isolate this fungus failed. Thedgonia
ligustrina has been tested as a possible agent of biological control of Ligustrum in La
Réunion (http://www.cabi-bioscience.org/Html/activitiesDevelopinCountries.htm).

Gloeosporidiella turgida (Berk. & Broome) B. Sutton (Figs 1b & 2b)

The fungus was found on dry, dead, ca. 2-3 mm thick twigs of Syringa xchinensis. It
appears as 0.2-0.5 mm pustules emerging through the bark, appearing ochre, later
becoming brownish. Each conidioma is seated on a basal stroma, ca. 200 um wide x
ca. 150-200 um high; conidiophores are colourless, simple or sparingly branched,

178

conidiogenous cells are 10-20 um long, 3-4 um broad; conidia are colourless, curved,
falcate to sickle-shaped, 22-33 x 4-5 um, narrowing to the rounded tip and the more or
less truncate base.

Colonies initiated from conidia: on 2% malt-extract agar slow growing, attaining
a diam of 5-7 mm in 10 days and 12-13 mm after 25 days at ca. 20°C, appearing flat,
centrally umbonate, surface lanose, Brownish Orange (7C 3-4) to Reddish Grey, to
Brownish Grey (8B, C 2); reverse vivid Brownish Orange (6C 8; 7C 8), margin narrow,
entire in young colonies but fimbriate in older ones, exudate absent, diffusible pigment
Brownish Orange. Advancing hyphae colourless, wavy to geniculate-like, ca. 2-3 um
diam, sparingly and irregularly branched at ca. 35-40° angle, septate every 18-22 um,
older hyphae yellowish and slightly wider. Spherical, 0.5-1 mm diam sclerotium-like
bodies, composed of interwoven hyphae are formed in fresh cultures. These may
represent young stages of conidiomata but they did not develop further after 6 months.
These sclerotial bodies are not formed in later subcultures.

SPECIMENS EXAMINATED: On Syringa xchinensis: SWEDEN, Uppland, Uppsala,
Kallparksgatan 12 (59°53’N 17°39°E), 22 VI 2003, V. Melnik LE 214424; UPS F-
118065; dried culture UPS F-118066; living culture CBS 116473; ditto, 15 IX 2004, O.
Constantinescu UPS F-118067; ditto, 15 VI 2005 UPS F-120165. On Fraxinus excelsior:
LITHUANIA, Lazdijai Distr., environs of GerdaSiai (53°57’N 23°54’E), 25 VII 1995, A.
Treigiené BILAS 27694; Kédainiai Distr., Berunkiskiai Forest (55°13’N 24°08’E), 18 VI
1999, A. Treigiené BILAS 27695. ditto, Stebuliai Forest (55°19’N 24°06E), 31 V 2000, A.
Treigiené BILAS 27696.

Discussion — The characters of the fungus on Syringa agree well with the description
and illustration of Gloeosporidiella turgida provided by Pirozynski & Morgan-Jones
(1968) under Cryptosporiopsis turgida (Berk. & Broome) Piroz. & Morgan-Jones.
Gloeosporidiella turgida is a known parasite of Fraxinus and was recorded from United
Kingdom (Pirozynski & Morgan-Jones 1968). It was also found in Lithuania (A. Treigiené
in litt.). This fungus was indicated as the agent responsible for canker of ash in the USA
(Adams 2001) but, according to M. Putnam (in litt.), a more thorough investigation
revealed that the fungus involved was Phlyctema vagabunda Desm. (Rossman et al.
2002). Syringa is a new host record for G. turgida. As in the case of Thedgonia ligustrina,
the new host belongs to the same family.

Gloeosporidiella turgida is based on Cryptosporium turgidum Berk. & Broome.
The placement in Gloeosporidiella was accepted by Verkley (1999) in his monograph
of Pezicula. However, there are important morphological discrepancies between C.
scutellata (G.H. Otth) Petr., the type species of Cryptosporiopsis and anamorph of
Pezicula ocellata (Pers. : Fr.) Seaver (syn. Ocellaria ocellata (Pers. : Fr.) J. Schrot.), and
G. ribis (Lib.) Petr., the type species of Gloeosporidiella and anamorph of Drepanopeziza
ribis (Kleb.) Hohn. In the former the conidioma is stromatic whereas in the latter it is
acervular, subcuticular and lacks stroma (Figs 2b,c). Consequently, G. turgida seems to
be better accommodated in Cryptosporiopsis, but it should be noted that its teleomorph
is unknown. Other Cryptosporiopsis anamorphs are associated with two phylogenetically
distinct teleomorph genera, Pezicula and Neofabraea p.p., and also closely related to
Phlyctema (teleomorph Neofabraea alba (EJ. Guthrie) Verkley), and Foveostroma
anamorphs of Dermea (Abeln et al. 2000).

179

Acknowledgements

We are indebted to Lennart Nilsson for the specimen of Syringa vulgaris, to Ausra Treigiené for
information on the presence of G. turgida in Lithuania, to Uwe Braun for providing a copy of
the text regarding Thedgonia from his monograph, to Melodie Putnam for drawing attention to
the paper by Rossman et al. (2002), to Svengunnar Ryman for information about the presence of
Syringa spp. in Sweden, and to Directors and Curators of BILAS, BUCM and UPS herbaria for
permission to examine specimens in their keeping. Special thanks are due to Amy Rossman, Shaun
Pennycook and Uwe Braun for their criticism as pre-submission reviewers.

Literature Cited

Abeln ECA, Pagter MA de, Verkley GJM 2000. Phylogeny of Pezicula, Dermea, and Neofabraea
inferred from partial sequences of the nuclear ribosomal RNA gene cluster. Mycologia
94: 685-693.

Adams G. 2001. A new disease of ash causing economic losses in Michigan In: Nursery and
Landscape Research. Projects and Education Programs (Brown-Rytlewski D., Ed.), p. 29.
Michigan State University.

Braun U. 1995. A monograph of Cercosporella, Ramularia and allied genera (phytopathogenic
hyphomycetes). 1. IHW-Verlag, Eching bei Miinchen.

Constantinescu O. 1988. An instrument and procedure for single-spore isolation. Trans. Brit.
Mycol. Soc. 91: 700-702.

Holmgren PK, Holmgren NH, Barnett LC [Eds] 1990. Index Herbariorum. Part I: The Herbaria of
the World. 8 ed. New York Botanical Garden, Bronx.

Kornerup A, Wanscher JH. 1983. Methuen Handbook of Colour. Methuen, London.

MePnik VA, Shin HD, Jee HJ, Cho WD. 2005. Materialy k izuchennyu raznoobraziya gribov Korei
[Contribution to the study of fungal diversity in Korea]. Mikol. Fitopatol. 39(3): 61-68. In
Russian.

Nitzelius T. 1964. Blommande buskar och trad [Flowering bushes and trees]. Saxon & Lindstréms,
Stockholm. In Swedish.

Parlevliet JE. 1979. The co-evolution of host-parasite systems. Symb. Bot. Upsal. 22 (4): 39-45.

Pirozynski KA, Morgan-Jones G. 1968. Notes on microfungi. III. Trans. Brit. Mycol. Soc.
51: 185-206.

Rossman AY, Castlebury LA, Adams GC, Putnam ML. 2002. Phlyctema vagabunda isolated from
coin canker of ash trees in Michigan. Pl. Dis. 86: 442.

Stakvileviciené S. 2004 Thedgonia ligustrina (Boerema) B. Sutton - naujas paprastojo ligustro
(Ligustrum vulgare) L. démétligés sukéléjas Lietuvoje [Thedgonia ligustrina. a new agent
of brown leaf spot of Ligustrum vulgare in Lithuania]. Dendrologia Lithuaniae 7: 123-127.
In Lithuanian.

Sutton BC. 1973. Some hyphomycetes with holoblastic sympodial conidiogenous cells. Trans. Brit.
Mycol. Soc. 61: 417-429.

Verkley GJM. 1999. A monograph of the genus Pezicula and its anamorphs. Stud. Mycol.
44: 1-180.

Yoshikawa M, Yokoyama T. 1992. Thedgonia ligustrina on Ligustrum japonicum and Cercospora
kyotensis sp. nov. on Hydrangea serrata var. thunbergii. Trans. Mycol. Soc. Japan 33: 177-184.

Sis) 5

7 a ;
; ‘ ae ad
ae AS 6 ’

pry | , we a <. ve Se eae bi otter ;

1 ‘pick ely % ail Wye. heoris LOR ual Mies Bite i w
aw gilt godt vasa ne y caikdeoabehll sielye gros Thy cal |
. : AGA A ure: 4.

: Sita, iironyiil fi
hile “i oa bijae on

lege apis Fr 6 bln ait teet uta ies dad oat ”

\ Raplanabalied “sapot or oleie gn |
Oi Sea ting ert Cita a RE, 5

ions — shat te sei yesh ite
RE ie gras

her west mn ine a5uiie, wr ih ‘sine Pasa me Avena aii ne hie '
"Yo tinpsyy Coll) ge Saiciiimiaaaninies: Wey Goohdlewws aire et)
a ve BNAS Fr aod rob Isnagied troy, wot bse bien yr
ap AS era ety pe hae ao bes: 2 jn Bongo noiligl A601 Vil sartbend’ paleo
a Siietivstees cvitdeneas trerant ant Balai tlh, Sah oth Aiidviarearabule lave

ab EH lect Nay Reread sae! DE celia high ta Myre ndt echeonttsaansneaings AL ¥
tS bet. (mipomoamlonels. (eryed a Jie Arete? Pipe, By & anette, 7

| aah Merten sLmannban wigtoeah aisnanto ee nea haoearedt ton stti |
aes joe Gye? Mitue ign foe ge dak tas x ti
uth S ns aed) slevth ltiogh 2 imate dian fie nates ays 4)
a deat Rileaa ot tht soi A Aaa MEH
{uules Hit tha fardat' vi awe Palyctie seers vital Spee Pat

fant peat abe tad ny 06 Ah anne APD epi A hd. ee
te bey ul dust, bes mite i thae se ny oan 8k Uist PY saad ddan oan fy

ie: par te ‘Aseanees) bial Rouse ane. ae _ wisi
Pe Ae ag rl ey i) wee, titel 8a see “se = a; \
b wld = ee

ay a. ti 4G ia iouaealy! Ya : ou . ea 7 if Le
"Rpt agate te eda ee regal sates aay ae
sa , on i > te , J Tid ar ee | ik y 7
see aan ; i ; } ee ay ie
if si

5 ie canes ve “aes: pine beet

+ dau iS , Pege

Ae atte Mipepadoe i Nikegiteries

et ee a
a cro ¥. yes ) ie! ~:

yo Pe
ic®

v7” os :
ae) 7

y it Bo + ah

ar | \

7 a

Mi é

MYCOTAXON
Volume 94, pp. 181-187 October-December 2005

Further notes on the molecular taxonomy of Metarhizium

Bo HuANG”?, RICHARD A. HUMBER?, SHIGUI LI’,
ZENGZHI LI? & KATHIE T. HODGE?

zzli@ahau.edu.cn
' Anhui Provincial Key Laboratory for Microbial Pest Control,
Anhui Agricultural University, Hefei 230036, China

*Department of Plant Pathology, Cornell University
Ithaca, NY 14853, USA

> USDA Plant, Soil & Nutrition Laboratory, Tower Road
Ithaca, NY 14853, USA

* Institute of Soil and Fertilizer Sciences
Chinese Academy of Agricultural Sciences, Beijing 100081, China

Abstract—The ITS1-5.8S-ITS2 rDNA regions from Metarhizium guizhouense, M.
pingshaense, M. iadini, and four other Metarhizium isolates were amplified and
sequenced. Bayesian analyses showed that M. pingshaense should be treated as synonym
of M. anisopliae var. anisopliae; that M. guizhouense should be treated as a synonym
of M. anisopliae var. anisopliae; and that M. iadini is a later synonym of M. flavoviride
var. pemphigi. Several previously unidentified isolates, RCEF0898, ACCC30130 and
RCEF1259, the taxonomic positions of which have been unclear or suspicious, were
identified as M. anisopliae var. anisopliae, M. anisopliae var. anisopliae and M. flavoviride
var. pemphigi, respectively.

Key words—entomopathogenic fungi, Clavicipitaceae, synonymy

Introduction

Under natural conditions, fungi are frequent and often important natural mortality
factors in insect populations (Milner, 2000). Entomopathogenic fungi may exhibit very
narrow or very broad host ranges, depending on the species and isolate. Metarhizium
anisopliae var. anisopliae (abbreviation: M.a. anisopliae) has one of the broadest host
ranges, having been found to naturally infect over 200 insect species (Milner, 2000).
Because of the absence of detrimental environmental effects, lack of residues in meat or
crops, and ease of mass production, some species of Metarhizium can be used for the
_control of many insect pests as an environmentally acceptable alternative to chemical
insecticides. Some Metarhizium mycoinsecticides are now registered in Australia,
Europe and the USA as well as being used in countries such as Brazil and China, and
have played important roles in controlling agricultural and forest insect pests.

*Author for correspondence

182

Two Metarhizium species and two varieties were accepted by Tulloch (1976) in her
important review. Most recently, 3 species and 4 varieties have been accepted (Rombach
et al. 1986) based on morphological data. Molecular phylogenetic studies of large and
small subunit rDNA by Liu et al. (1994) addressed some Chinese Metarhizium strains.
Later, Driver et al. (2000) proposed many new varieties based on their study of ITS
sequences. Information from additional genetic loci and additional isolates is needed to
fully resolve Metarhizium taxonomy.

The status of five Metarhizium species described from China has been unclear,
largely because cultures were difficult to obtain. These are Metarhizium cylindrosporae
Q.T. Chen & H.L. Guo, M. guizhouense, M. pingshaense, M. taii, and M. iadini. Recently
Huang et al. (2004) showed that M. cylindrosporae is correctly placed in Metarhizium,
rather than in Nomurea as proposed by Tzean et al. (1993), and that Nomuraea viridula
Tzean et al. also belongs in Metarhizium. Huang et al. (2005) proposed that M. taii
should be considered a synonym of M.a. anisopliae and revealed that Cordyceps taii
Z.Q. Liang & A.Y. Liu is the teleomorph of M.a. anisopliae. This study deals with the
taxonomy.and identity of the remaining three species based on ex type cultures. The
identity of several interesting Metarhizium isolates is also addressed. ITS sequences were
used as molecular markers to address these problems.

Materials and Methods

Fungal isolates and culture—Four isolates of Metarhizium deposited at the Institute
of Soil and Fertilizer Sciences, Chinese Academy of Agricultural Science (ACCC) were
provided by Li Sigui, the others were conserved in the Anhui Provincial Key Laboratory
for Microbial Pest Control, Anhui Agricultural University (RCEF). Table 1 lists the
hosts, identifications, and collecting locations of studied isolates. Those isolates that
are included in this study only by means of sequence data obtained from GenBank are
shown in Figure 1.

Table 1. Original identification, insect hosts, and geographic origins of six isolates of
Metarhizium spp. studied here.

GenBank Strain Original Host een
Accession No. Identification “s pan
DQ177434 RCEF0898 M. anisopliae Soil Anhui
ACCC30105 ! Alissonotum sp. /
DQ17742 :
Q 8 (Se ages M. pingshaense Galeout Guangdong
DQ177430 he Mae M. guizhouense Pas wus aye Guizhou
(ex type) Lepidopt.
DQ177429 ACCC30124 M. iadini Rhynchites coreanus / ein
(ex type) Coleopt.
DQ177432 ACCC30130 aE gy nde Uncertain Uncertain
var. minus

DQ177435 REEPIZ59 Metarhizium sp. _ Larva of Lepidoptera Anhui

183

For DNA extraction, spores or mycelium were transferred to a Petri dish containing
potato dextrose agar medium overlaid with a disk of autoclaved cellophane. The Petri
dish was sealed with Parafilm, and placed in an incubator at 25°C for about 1 week.
Mycelium was then scraped from the cellophane, then stored at -20°C prior to DNA
extraction.

DNA extraction, amplification and sequencing—Total genomic DNA was extracted
from frozen mycelium by using a benzyl chloride method (Zhu et al. 1994). DNA
pellets were air-dried and resuspended in 200 ul sterilized TE buffer (10 mM Tris-HCl,
1 mM EDTA, pH 8.0). The quantity and quality of total genomic DNA was observed
on a 0.8% TBE agarose gel stained with ethidium bromide. DNA for sequencing was
amplified enzymatically using the polymerase chain reaction. The internal transcribed
spacer regions (ITS1 and ITS2) of the ribosomal DNA operon, including the 5.8S gene,
were amplified using primers ITS4 and ITS5 (White et al. 1990). The PCR reaction was
performed with 0.5 ul of the dissolved total DNA in a 50 ul reaction volume containing
200 uM of each dNTP, 2 mM MgCl, 0.1 mM of each primer, and 2 units Taq DNA
polymerase with PCR buffer (Sangon, China). The PCR reactions were placed in a
thermal cycler (Techine, UK) under the following temperature-cycling parameters: Step
1) 5 min at 95°C; Step 2) 35 cycles of 1 min at 94°C, followed by 1 min at 54°C, and
1 min at 72°C; Step 3) 10 min at 72°C. The resulting products were examined on a
1.2 % TBE agarose gel stained with ethidium bromide. PCR fragments were purified
using the Wizard™ PCR Preps DNA Purification System Kit (Promega Co., France).
PCR products were sequenced using the above-mentioned primers on an ABI 3700
automated sequencer at Shanghai Genecore Biotechnologies Company. Products were
sequenced in both 5’ to 3’ and 3’ to 5’ directions.

Phylogenetic analyses—DNA sequences generated by us and downloaded from
GenBank (see Table 1 in Huang et al. 2005) were aligned using Clustal X 1.81 (Thompson
et al. 1997), and the alignment was refined by eye. Beauveria bassiana (Bals.-Criv.)
Vuill., a related clavicipitaceous anamorph, was used as the outgroup. Parsimony
analysis performed in PAUP* version b10 (Swofford 2002) using a heuristic search, but
it failed to complete using available memory, apparently because of a high number of
equally parsimonious trees arising from the similar sequences among isolates of M.a.
anisopliae. Bayesian analysis was carried out using MrBayes 3.0 b4 (Huelsenbeck 2000,
Huelsenbeck et al. 2001). We used a 6 parameter model to run four chains for 500,000
generations, sampling every 100 generations. The first 500 trees were discarded (burn
in), and the remaining trees were saved to a file. A 50% majority rule consensus tree
(Fig. 1) was then calculated using PAUP®*.

Results and Discussion

Metarhizium pingshaense and Metarhizium guizhouense—M. pingshaense is mainly
distinguished from M. anisopliae var. anisopliae in the color of the colony and in that
the spore chains are formed of individual spores connected eccentrically (Guo et al.
1986). Phylogenetic analysis reveals that the ex type isolate of M. pingshaense belongs
to a clade that includes 17 isolates of M.a. anisopliae, including the ex neotype isolate
FI1029. M. pingshaense differs from the ex neotype isolate by three base pairs in the ITS

184

80
$2

V.album
M.inovozealandicum

[E
AF194150
M.a.a.8x type
AFPI35214
AF 136376
M.pingshaense

AF136928
AF 137054
AF136375
ACCC30130
AFI37055
AF 135213
API35215
AF137059
AF 138212
AF137087
AFI35216
AF137056
AFS48395
RCEFOSS8
AFI35211
M.a.majus

HUE O AY

Lupnizi

poudosiue

M tail
M.guizhouense
AF 137058
M.a.lepidiotae
M.a.acridum

ME pemphigi
M.iadini
RCEF1259

M.Lminus

SOPHIA OARS “IW

M.iflavoviride
G. brittlebankisoides
B.bassiana

Figure 1. Bayesian phylogeny of Metarhizium spp. based on the analysis of ITS sequence data.
Posterior probabilities (>50%) are given as percentages above the branches. (M.f. = M. flavoviride,

and the six isolates in this study are indicated in bold face.)

sequence. We therefore propose that M. pingshaense should be regarded as a synonym
of M.a. anisopliae. The conclusion is supported by the earlier conclusion of Liu et al.
(1994) based on identical partial sequences from small (18S) and large (28S) subunit
rRNAs. Negligible differences in serology among M. pingshaense and several strains of
M.a. anisopliae (Hu et al. 1996) provide further support. There can be no question from

185

the integrative data here that M. pingshaense cannot be maintained as an independent
species, and it should be treated as a synonym of M.a. anisopliae.

The ex type isolate of M. guizhouense also fell in the clade including all isolates of M.a.
anisopliae except isolate F1379 (Fig. 1). Compared with the ex neotype isolate FI1029, M.
guizhouense differed in 6 base positions in the ITS regions. Two per cent divergence in
the ITS between M. guizhouense and isolate F11029 falls within the scope of variation
among M.a. anisopliae isolates (0-2.3%). According to Liu et al. (1986), conidial length
in M. guizhouense measured 6.7-7.3 um, while Driver et al. (2001) gave 5-8.0 um as the
range for conidial length in M.a. anisopliae.

Liu et al. (2001) suggested that M. taii and M. guizhouense were the same fungus
based on their morphology and type of esterase isoenzyme. The ITS sequences of these
two species are similar, differing in only two positions. Both species attack the larvae
of Lepidoptera. Huang et al. (2005) have demonstrated that M. taii must be treated as a
synonym of M.a. anisopliae based on its morphology and ITS sequence. We also consider
that Metarhizium guizhouense is a synonym of M.a. anisopliae, based on morphological
characters, ITS sequence and the conspecificity of M. taii and M. guizhouense.

Metarhizium anisopliae (Metsch.) Sorokin var. anisopliae, [Plant Parasites of Man and
Animals as Causes of Infectious Diseases] 2: 267 (1883) [in Russian].
Synonym: Metarhizium pingshaense Q.T. Chen & H.L. Guo, Acta Mycol. Sinica 5: 179
(1986) [in Chinese].
Synonym: Metarhizium guizhouense Q.T. Chen & H.L. Guo, Acta Mycol. Sinica 5: 181
(1986) [in Chinese].
Synonym: Metarhizium taii Z.Q. Liang & A.Y. Liu, Acta Mycol. Sinica 10: 260 (1991) [in
Chinese].

Metarhizium iadini and identification of isolate RCEF1259—According to Guo
(1991), M. iadini is differentiated by its light green colonies in culture, its ovoid conidia
with light plain base, (4-)5.7(-6)x(1.8-)2.2(-2.4)um, and its coleopteran host, Rhynchites
coreanus. Metarhizium flavoviride var. pemphigi (abbreviation: M.f. pemphigi) is similar,
with ovoid to elongate conidia measuring 5.4x2.4 um, a light green conidial mass, and a
root aphid host. In our analysis (Fig. 1) the ex type isolate of M. iadini, M.f. pemphigi and
strain RCEF1259 grouped together in a strongly supported clade. Among them there are
8 nucleotide differences in the ITS regions. Metarhizium iadini and M.f. pemphigi were
distinguished by only small differences in host and growth rate at low temperature (the
former reaches 15 mm, and the latter 40 mm at 10°C after 3 weeks). However, they share
other characteristics such as conidial shape and size, and color of colony. Also, these two
species display similar sequences in the ITS region. We conclude that M. iadini and Mf.
pemphigi are conspecific. The former name is legitimate, but the lack of a Latin diagnosis
makes it invalidly published (Art. 42). Accordingly, the isolate ACCC30124, originally
identified as M. iadini, is properly identified as M.f. pemphigi.
Strain RCEF1259 was isolated from an entomogenous fungus specimen collected
- from Anhui Province in China. A synnemata formed on a Lepidoptera larva is 5 cm long,
and green at the apex. Conidial size and shape are similar to those of M.f. pemphigi. This
isolate formed a few light green conidia, and a floccular mycelium on PDA after 10 days.
Because synnemata are unusual in Metarhizium, the isolate was included in this study to
assess its relationships and identification. Compared to M.f. pemphigi, RCEF1259 differs

186

in 4 positions in ITS region, and also shows 3 deletions. We conclude that it should be
recognized as M.f. pemphigi based on morphological and molecular data.

Before the current study, only two isolates of M.f. pemphigi had been recorded.
Similarities among these newly recorded isolates provide evidence that it is reasonable
for M.f. pemphigi to be recognized as a distinct variety. The light green color of the
conidial masses is apparently an important identifying morphological character for this
variety.

Metarhizium flavoviride var. pemphigi Driver & Milner, Mycol Res: 104: 144 (2000).
Synonym: Metarhizium iadini H.L. Guo, The Study and Application of Metarhizium: 27
(1991) [in Chinese].

Identification of isolates ACCC30130 and RCEF0898—Isolate ACCC30130 was
identified as M. flavoviride var. minus in a catalogue of Chinese agricultural isolates
(Guo & Ning, 1991). According to Liu et al’s 1994 study, M. pingshaense, ACCC30130
and M.a. anisopliae shared similar 18S and 28S DNA sequences. However, the present
study based on morphology and ITS sequences suggests that ACCC30130 should be
attributed to M.a. anisopliae. The strain differs from the M.a. anisopliae ex neotype
isolate by only 3 positions in the ITS regions.

The strain RCEF0898 differs by 6 nucleotides from the neotype strain of M.a.
anisopliae; it falls into the same clade as most isolates of the latter (Fig. 1). The
morphology of RCEF0898 is similar to M.a. anisopliae except that some large conidia
measured up to 9x3.5 um. Although Metarhizium taii has been reported to produce
some large conidia, it was synonymized with M.a. anisopliae in a recent study (Huang
et al. 2005). This small difference in conidial length is not considered taxonomically
significant. Therefore, strain RCEF0898 is also identified as M.a. anisopliae.

Acknowledgements

We are grateful to Drs. Wenying Zhuang and Yijian Yao for reviewing the manuscript. This project
was supported partly by the National Natural Science Foundation of China (Grant No. 30300004),
the Key Laboratory of Systematic Mycology and Lichenology (Grant No. 912), the Anhui Provincial
Science Foundation for Excellent Youth and program for “NCET”.

Literature Cited

Driver F, Milner RJ, Trueman WH. 2000. A taxonomic revision of Metarhizium based on a
phylogenetic analysis of rDNA sequence data. Mycol Res 104: 134-150.

Guo HL. 1991. The study and application of Metarhizium. Chinese Agriculture Press, Beijing.

Guo HL, Ye BL, Yue YY, Chen QT, Fu CS. 1986. Three new species of Metarhizium. Acta Mycol
Sinica 5: 177-184.

Guo HL, Ning GZ. 1991. Catalogue of agricultural isolates from China. China Agricultural Sciences
and Technology Publishing House, Beijing.

Liang ZQ, Liu AY, Liu JL. 1991. A new species of the genus Cordyceps and its Metarhizium
anamorph. Acta Mycol Sinica 10: 257-262.

Liu ZW, Guo HL, Kurtzman CP. 1994. Phylogeny of Metarhizium species as determined by partial
ribosomal RNA sequences. Acta Mycol Sinica 13: 139-151

Liu ZY, Liang ZQ, Whalley AJS, Yao YJ, Liu AY. 2001. Cordyceps brittlebankisoides, a new pathogen
of grubs and its anamorph, Metarhizium anisopliae var. majus. J Invert Pathol 78, 178-182.

187

Hu JJ, Fan MZ, 1996. The study on the immunological characters of the genus Metarhizium. Journal
of Anhui Agricultural University 23 (3): 433-437.

Huang B, Li SG, Li CR, Fan MZ & Li ZZ. 2004. Studies on the taxonomic status of Metarhizium
cylindrospora and Nomuraea viridula. Mycosystema 23: 33-37.

Huang B, Li CR, Humber RA, Hodge, KT, Fan MZ & Li ZZ. 2005 (2006). Molecular evidence
for the taxonomic status of Metarhizium taii and its teleomorph, Cordyceps taii (Hypocreales,
Clavicipitaceae). Mycotaxon 94: 137-147.

Huelsenbeck JP. 2000. MrBayes: Bayesian inference of phylogeny (software). New York: University
of Rochester.

Huelsenbeck JP, Ronquist FE, Nielsen ES, Bollback JP. 2001. Bayesian inference of phylogeny and its
impact on evolutionary biology. Science 294: 2310-2314.

Milner, RJ. 2000. Current status of Metarhizium as a mycoinsecticide in Australia. Biocontrol News
and Information 20: 47-50.

Rombach MC, Humber RA, Roberts DW. 1986. Metarhizium flavoviride var. minus var. nov., a
pathogen of plant- and leafhoppers on rice in the Philippines and Solomon Islands. Mycotaxon
2/: 87-92.

Swofford D. 2002. PAUP*: Phylogenetic analysis using parsimony (*and other methods), version 4.
Sunderland, Massachusetts: Sinauer Associates.

Tulloch M.1976. The genus Metarhizium. Trans Brit Mycol Soc 66: 407-411.

White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR
Protocols: A Guide to Methods and Applications. San Diego, California: Academic Press Inc.
pp 315-322.

Zhu H, Qu F, Zhu LH. 1994. Isolation of gnomic DNAs from fungi using benzyl chloride. Acta
Mycol Sinica 13: 41-47.

ial r
aE try on apron. Pa m5 :
at wer i cen: Tei

cupynet sy eV! ne eran sac en ein: ta a "
b Aug TSR Al - heed oe a oe —_— ’ an am <= > ¢ 7 ? a ‘ , ie mans £. mm . = ira
ee : 7 >: a een nbs ths a aa .

oa ye etd ated — 4 Crnry
24 Sed Sad | eT 7 > eocivet 4 et. tb

hd
-

eer ith te

us " es ry veo
< oe Rivals a A oe 9 (ee oe ‘ os

er! $ } ‘
(lon ronda vi Lig i Sir ily taupe i oe ie
ie - ae [| in siaiaaehi a ; :
_ as ’ ae te See ce : ‘
ae i Mucg? aaah Rise ‘€ ug Ai ts eet ther allal 6 )
: ‘ cnBSN igus ini ve tink PAS as i oe Set irs peer cre A:

Cras,
Bi): WE hw Ba oe MA a ert + ehh ted
re xt Ny Hiatt on ea ne is! ae eh ONAGY: bs BGA A
+ UE iri [ah aa re. leat aS ag TNS MAD tioned .as Of we, sid Tie <oe elBag 2m
‘rah he teen ga a4 gehen nz! wom LAM Loiytiersy we cwnieion ae 6 ws Authdt wat ae
ae _» * (Or — Pars . eae Le looyn” ie
Press cae Dob i ih. reer! Jy FA qiog ee dns: rex) eintn of Uir manner Pics nti peer” hy ;
7 | TAs - i= PreRrw Nate dt & (ria rns + ithua( Cron Ne HENGE),
a: rf Les adiey OS lenenic i Po cony tes EL eerneg iS eet Ms. 5 2). ea atid Prot i : _ a
ae win 2 wean 4 @iSise Veh ie ieee hie HCE. A ae ae
2 ; i ' 7 a 7 \ y iy 4) - :
& : ‘ Jar, ; = “ it x ae _ fi 7? fa
: SO GA wae pe “ie dinecnibihe Cina ee, Le tee? oat
Oia Bie h an al iM, + *aK)erm, Tear ab ‘hehe bin ay a
(ae CRORE AR SRE, oe bipthh Pe {HINGES i 2 ae oake
ba , > nf 400-In t iis i wis pes Mt ar A queens Qhinete Aare hice Be “27 * +44
> e i= § . ; “ co. *
Reed talc ts Bi, sae Sage, as Ry Aly Saab inaiiaci reaa t fs 7 haa
Mee.) BRO tee ee re
an Le Ci 3 wae aaese nesacrioh tolihtlraca his i i i Pe
padtnes gy Veigting eve taray, ~ 4
vee am rie Loe yi ed, & ih ah Mia nly Cayce sin
ries Ue Pi obras pera i a ee re
a] .
th
4
vie : i re / | oD pe Looe
a ; eae | ; - — 1 nue “1%
Tan ) :
4?
:

Volume 94, pp. 189-214 October-December 2005

The genus Hymenochaete (Basidiomycota, Hymenomycetes)
in the Hawaiian Islands

ERAST PARMASTO

erast.parmasto@zbi.ee
Institute of Agricultural & Environmental Sciences, Estonian University of Life Sciences
181 Rita St., 51014 Tartu, Estonia

ROBERT L. GILBERTSON

rlg@ag.arizona.edu
Department of Plant Sciences, Division of PlantPathology, University of Arizona
Tucson, AZ 85721, USA

Abstract — Eighteen species of the genus Hymenochaete found in the Hawaiian Islands
are described, including new species H. flexosetosa, H. geniculata and H. legeri. H.
attenuata sensu G. Cunn., found in New Zealand, is different from H. attenuata (Lév.)
Lév.; it is described as a new species H. nothofagicola. Main source of the origin of
Hawaiian Hymenochaete biota seems to be Australasia.

Key words — New Zealand, distribution, spore variation

Introduction

In his monograph of Hymenochaete, Burt (1918) did not mention any collections
from the Hawaiian Islands nor did Cunningham (1957) in his paper on New Zealand
and Australian “Thelephoraceae” or Léger (1998) in his world monograph of the
genus Hymenochaete. Burt (1923) in a paper on higher fungi of the Hawaiian Islands
mentioned three species: H. tenuissima Berk. (a synonym of H. rheicolor) was collected
“on decaying wood, EL. Stevens, 118, 967”, but the specimens were not found by us in
BPI or NY; H. cinnamomea (Pers.) Bres. and H. spreta Peck have been misidentified by
Burt (see below under H. semistupposa and H. tomentelloidea). Gilbertson & Adaskaveg
(1993) mentioned H. anomala and H. corrugata collected by them in 1990. Gilbertson
-& Hemmes (1997) described a new species, H. tomentelloidea from South Hilo District;
Gilbertson et al. (2002) listed four species of Hymenochaete (H. anomala, H. corrugata,
H. mougeotii and H. tomentelloidea) collected in Hawai'i, Kauai and Maui Islands in
their check list of wood-rotting Basidiomycetes. Apparently no other data on Hawaiian
Hymenochaete have been published.

190

Materials and methods

In the National Fungus Collections (BPI), there are specimens of eight Hymenochaete
species, mainly previously unidentified, collected by C.L. Shear and N.E. Stevens from
Hawai'i. In the Herbarium of the New York Botanical Garden (NY), one specimen of
H. attenuata collected by J. Kliejunas was found. Collections by R.L. Gilbertson, also by
J.E. Adaskaveg and D.E. Hemmes from 1990 to 2002 contain 114 specimens of Hymeno-
chaete reported in this paper. Collections are deposited in ARIZ and their duplicates
in TAA. For comparison, some specimens collected by S.H. Wu in Taiwan and by the
senior author in India (both in TAA) have also been examined.

Authors of fungal names follow Kirk & Ansell (1992). Herbarium acronyms are
after Holmgren, Holmgren & Barnett (1990). Names of (phyto)geographical regions are
given according to the Plant Taxonomic Database Standard No. 2, Edition 2 (Brummitt,
2001). Colour of the basidiomata of Hymenochaete species is very changeable during
their development, and most descriptions published until now are saturated with
different colour terms. To simplify the descriptions, colour names are given as used in
“A mycological colour chart” by Rainer (1970). In parentheses, the additional and more
precise colour notations are given according to Munsell, 1976 (M) and Kornerup &
Wanscher, 1973 (K & W). In this genus, it is difficult to study spores due to their small
measurements and Brownian movement when an ordinary microscope is used. That is
why measurements and figures of spores were made with the aid of a Sony CCD Video
Camera attached to a Nikon Labophot 2 microscope and analyzed by Global Lab Image
(Data Translation Inc.) software. All descriptions given below are based on Hawaiian
specimens; when these differ significantly from the descriptions published for other
regions, the differences are indicated.

Results and discussion

18 species of the genus Hymenochaete have been found in Hawaiian Islands. Only one
of these (H. tomentelloidea) was definitely known until this study. The propagules of
these fungi are small and easily transportable by winds (basidiospore length of most
Hawaiian species is in the limits of 2.5-8 um). Nevertheless, the number of species is
rather low. For comparison, of the more than 120 species known, 32 have been found in
New Zealand. The Hawaiian Islands have an isolated position far from mainlands. Their
age — about 0.5-5 mln years (Carson & Clague, 1995) - is perhaps rather short time
for invasion of Hymenochaete species from Americas, Asia or Australasia. Only two
or three species are of pantropical distribution (H. attenuata, H. unicolor and possibly
also H. legeri). Three species are common with South or Central America (H. berteroi,
H. cervina, H. minuscula), but these have also been found in Australasia. Six Hawaiian
species are common with New Zealand (H. dissimilis, H. innexa, H. semistupposa, H.
separata, H. unicolor, H. vaginata). However, there are almost no data on distribution of
Hymenochaete species in Papuasia and Southwestern Pacific, i.e., in the regions between
Australasia and Hawaiian Islands. One species (H. muroiana) has been found in Eastern
Asia (Japan, China) and Malesia, and one (H. separabilis) in Tropical Africa. According
to the currently known distribution, the main source of the origin of Hawaiian
Hymenochaete biota seems to be Australasia.

jal

The interval of time up to five million years was long enough to cause intensive
speciation of plants and insects; about 45% of mosses and 42% of angiosperms are
endemic (Eldredge & Evenhuis, 2003). Speciation is possibly more slow in fungi than in
other groups of living beings. In Hawaii, the percentage of endemic fungi (lichenized
species excluded) is about 13 (Eldredge & Evenhuis, 2003). Among Hymenochaete, four
species are endemic: H. flexosetosa (a species possibly closely related to pantropical
H. attenuata and H. rheicolor (Mont.) Lév.), H. geniculata (closely related to the New
Zealand's H. stratura G. Cunn.), H. subdissimilis ad int. (if different from H. dissimilis)
and H. tomentelloidea (closely related to H. separabilis). All these endemic taxa are
closely related to their siblings.

Of the 18 species found, only one is common in the Hawaiian Islands (H. legeri), two
occur occasionally (H. attenuata and H. semistupposa), all other species are very rare or
found only once.

Taxonomy

Key to Hawaiian Hymenochaete species
(Some other species, common in Tropical Asia and Australasia are included)

Tee basidioincerplicate OF cluisedercllexcC ma 5. a. anew Sen ee et ae A eee 2
Dero ac GlOMecLUISeCLesUDIALe) amare tes icc, Peed nee ts Ao ee orc 6
22 Soetae@ 0A SU SASS i ihre, ene’ At PAC Ores erties. 2 ot NEP EPEAT eT LAL s SSL 3
ZEOULAS op LEO A= PO UIT te. Sette eee: IN REE Seer td PEEL, eT ee ae ©
Bes COLtcy presciit; selac 30-50 X DO Ui sDleus TeXIDIC we en ce tae: 4
3. Cortex absent; setae 20-35 x 4-5 um; pileus brittle.... H. adusta (Lév.) Har. & Pat.

(Found in Japan, Philippines, Vietnam, Australasia)

4. Numerous brown thick-walled hyphidia in hymenium, 2.5-3.5 um in diam;
basidiome up to 500 um thick but tomentum thin (up to 150 um)
H. luteobadia (Fr.: Fr.) Hohn. & Litsch.

(Found in Philippines, Vietnam, Australasia)

4. Thick-walled hyphidia absent; tomentum up to 1000 um thick, later disappearing
and, then, pileal surtace black... sdemedo qatar nati opteler H. villosa (Lév.) Bres.
(Pantropical. Figs. 1, 1; 2, 3)

5. Part of the setae L-shaped, arising from a short thin setal hypha, 40-70 x 7-12 um;
Spores\(A.8=)5=5.8(26:2) X323:5(S337) WM es os oe ons oie waters 5. H. flexosetosa

5. All setae “normal”, 45-70(-80) x 7-12 um, spores 3.5-5(-5.5) x 1.7-—2.2 um; hyphae
of the context above the hymenium densely compacted in parallell. H. attenuata

6. Setae in apical part with small thorns or teeth (visible at high magnification) .... 7
Gr Sele WILNOUL (HOLS py. Scent et at cer aed Pein, see ee aoe 2 8
7. Setae 30-45 x 5-7(-8) um, with few (1-3) low broadly conical teeth or protuberances
tO oe L) Um ONC cae. date a ee el es oe 13. H. separabilis
7. Setae (35-)40-70 x 5-7 um, with 5-10 broadly conical teeth 0.8-1.5(-2) um long
peed Banta ries BE cite reek oils ein! aie ae 16. H. tomentelloidea

8. Brown or brownish hyphidia 2—4 um in diam with thickened or thick walls present,
butneveemonilioid Wan cee La Sa Pas IEE o

192

20,

20.

Hyphidia absent, or monilioid brown hyphidia or subhymenial hyphae present 12

Hyphidiasimple, notidendroid or arbusculoid 2. sae naciee ae aa ee 10
Hy pnidia dendroidly branichedn..t. swan cet ee | sce teviens felts eet 6. H. floridea

Spores broad, (5.7—)6-7 x (4.0-)4.3-5(-5.2) um; basidiomata thick (up to 500-
LL OO Rees siemens toe (ene ae eee wee Aa ae 3. H. cervina

. Spores 1.8-3.2 um broad; basidiomata very thin or up to 300 um thick ....... 11
. Spores cylindrical, 5.5-7(-7.5) x 1.8-2.5 um; basidiomata 50-100 um thick....... ;

Are Ski We ee Se CONROE wR MG cht BOM LE Athi Ls ps 8. H. innexa

. Spores ellipsoidal, 6.5-9.5 x 2.4—3.2 um; basidiomata up to 300 um thick ........

Saye yn st) BER ORICA EL LTE SI PISA OE LS Hi. SCN? Wh OIEY. SRL). ce 18. H. vaginata

. Many hyphae or hyphidia monilioid, with thickenings on walls; context soft

membranaceous;.of loosely: interwovenihyphaem: ch Wea eee ee 13

. Hyphae and hyphidia (when present) not monilioid; context absent or its hyphae
denselyypacked: Lr Aion), Se Ge ie: ieee, SEAR RT AE Bere i4

. Setal hyphae present in context; spores 3.7—4.8 x 2.2-2.7 um ...... 2. H. berteroi
Setal hyphae absent; spores 3.2-4.5 x 1.7-2.2 um ........... 12. H. semistupposa
Setae large, (60-)75-100(-120) x 10-15 um; spores 6-8 um long .... 9. H. legeri
Setae smaller, 30-80 x 4-9 um; spores 3.5-6.5 um long ...................-- 15

. Numerous conglomerates of crystals 8-50 um in diam present in the context (setal
orhyphalilayer)y pee etek Werner Vi crm chee ccaivcla: wt, alee enna 16

. Conglomerates of crystals absent, crystals in hymenium sometimes present ... 17
Setae 40-60(-65) x 7-10 um; hyphal layer 30-150 um thick,indistinctly different
from the setal layer; spores 3.7—4.4(-5.0) x 1.8-2.5um..... 15. H. subdissimilis
Setae smaller, (30—)35-45(-55) x 6-7(-8) um; hyphal layer absent; spores ellipsoid,
BF ROD AULD LSS [AA Silent, Wide Aigo abd ii ceirlinds mynleteenctre re yearirere 14. H. separata
Setae partly angled (geniculate) near the base, narrowly fusoid, (35-)40-60 x 4-7
(—8) um; setal hyphae (embedded horizontal setae) present .... 7. H. geniculata
setae never geniculate; setal hyphae. absent .x2.472)39 [Rae RRs OE en 18
Setae partly bifurcate at base, with slightly curved tip, (30-—)40-50(-60) x (5-)6-8
(-9) um; spores 4-6 x (2.5-)3-3.5 um; on bamboo .......... 11. H. muroiana

Setae never with bifurcate base; spores 2.2-3.2 um broad; on other substrata .. 19

Setae straight, (35-)45-80 x 5-9 um; spores ellipsoid, 4.2-5.4 x 2.5-3.2 um ......
SM ere Cer re eee tree Meh E eet eRe Acad ter ete Eee 4. H. dissimilis
Setae smaller, straight, slightly curved or undulate, (30-)35-60(-65) x 4-7 um;
SPOles almost sUDCyMCIiCa eet stan fawn te A erent este ie nee eet eee ieee ree 20
Spores 4.2—5.2 x 2.2-2.5 um; hymenium ochraceous or yellowish brown .........
5 A Ad SOME RL RNA Mee ST RN Re LR ow ee rina cit 10. H. minuscula
Spores 3.4-4.8 x 2.2-2.8 um; hymenium umber with fulvous, Sienna or grayish
RM LLLIUZ rect tatae reece th ae aaah SER eS ele ne Stee eho tel » A ee 17. H. unicolor

193

Annotated list of species

1. HYMENOCHAETE ATTENUATA (Lév.) Lév., Ann. Sci. Nat. Bot. HI 5: 152. 1846 not sensu
G. Cunn., 1957. Bigal 70,250

Basidiomata annual (?), pileate or seemingly effused-reflexed (then umbonate), closely
or loosely agnate, soft, papery-coriaceous and flexible when dry; pilei flabelliform to
dimidiate, 0.5-2 cm long, 200-500 um thick, usually imbricate or in rosettes, confluent
(up to 5 cm wide); pileal surface velutinous or tomentose when young or near margin,
then densely concentrically sulcate and zonate, coarsely radiately fibrillate (silky-fibrous),
dull or shiny, Sienna to Umber or dark Cinnamon (M: 7.5 YR 5/8-7, when old 5 YR 4/6;
K & W: 6 D 6-8, when old 6 E 6); margin thin, lobate, sometimes plicate, concolorous
with the pileal surface or lighter coloured (when young); hymenium smooth, in very old
specimens sometimes with low radial folds, not cracked, dark Sienna to light Umber or
dark Cinnamon (M: 7.5 YR 6/8, when old 7.5 YR 5/6; K & W: 6 D 5-6 or 5 C5).

Tomentum present as a layer of loosely interwoven hyphae or as hyphal tufts, (50)-
100-450 um thick; cortex absent; hyphal layer composed of loosely almost radiately
interwoven hyphae in upper part and an indistinctly delimited layer 100-150(-250)
um thick of hyphae more densely arranged in parallel above hymenial layer; setal layer
present in older specimens when setae are in two indistinct rows.

Hyphal system monomitic; hyphae with thickened walls (in tomentum thick-walled),
brownish, sparsely branched, with septa, in hyphal layer 2.5-3.5 tm, in tomentum 4-5
um in diam; setae sparsely situated or locally numerous, narrowly conical or slightly
fusoid, straight or some with curved tip, bluntly acute, (35-)40-70(-80) x 7-12(-14)
um, emerging 20-45 jm above the hymenium, with a thin hyphal sheath, without in-
crustation; basidioles with thickened and brownish at base rough (finely encrusted)
walls, 18-25 x 3-4.5 um; basidia 20-25 x 3.5-4 «um, with 4 thin sterigmata; spores short
cylindrical with one side slightly concave (suballantoid), 3 5--5(25.5) x (155-) Lo-22
um.

Hawar’l. J. Kliejunas 18a, det. G.A. Escobar, Kahalu'u Forest Preserve, Kona (NY); RLG
17007, 18112 on Metrosideros polymorpha, Mile 18, Saddle Rd. Kaua’t. RLG 21081,
21082, 21123 on Acacia koa, Nualolo Trail, Kokee State Park; RLG 20558, 21063, 21067,
22745A on Eucalyptus sp., RLG 22735, 22743 on Eucalyptus globulus, Makaha Rd.; RLG
21182, on Psidium guajava, Ohelo Berry Flat Trail, Kokee State Park. MoLoxka’l. RLG
19253 on Acacia mearnsii sp., Kamakou Rd.

Comments. This species belongs to the H. rheicolor-group of sibling species; their differ-
ence is not always clear, and most of the herbarium specimens including types of all
species and their synonyms have very few or no spores.

Bresadola has synonymized H. attenuata with H. rheicolor in one of his later papers
(1915: 301) but the two species are considered distinct by other authors. According to
_ Léger (1998), who has studied the types of both species, the main difference is in size
of setae and spores: 45-75 x 6-9(-11) «um and 3.5-4.5(-5.5) x 1.5-2(-2.2) um in H.
attenuata, 60-105(-120) x (8-)9-12(-13) um and 5-6 x 1.8-2.5 um in H. rheicolor.
Tomentum is well developed in H. attenuata, thin and formed of less differentiated
hyphal tufts in H. rheicolor. We have studied specimens of both species collected in
Argentina, Brazil, China (Yunnan), Dominica, Guatemala, Guyana, India, Mexico,

194

ODD Ora iQuOu Oren) OS m Cee
ror CG D Cre 6 4

Crate ek bona eae Woomera
Bee yacmel decent a0) ce OLc

SoC mo lO Ghenepn mania,
00+ 00» 0a» OO

000 OOO
goo 38

0 5 10 um
eee ee ee eee!

Fig. 1. Spores: 1 - Hymenochaete villosa, 2 - H. berteroi, 3 - H. subdissimilis, 4 - H. semistupposa,
5 — H. minuscula, 6 - H. attenuata, 7 - H. tomentelloidea, 8 - H. separabilis, 9 - H. geniculata,
10 — H. dissimilis, 11 - H. lignosa, 12 - H. flexosetosa, 13 - H. nothofagicola, 14 - H. legeri,
15 - H. muroiana, 16 - H. cervina

Puerto Rico and Thailand, and found the variability of setal size to be much broader and
sometimes overlapping in these species. Spore size is similar in the two species. We have
seen only two specimens of “typical” H. rheicolor with spores bigger than in H. attenuata
(see table below), and this difference is statistically insignificant when compared with
spores of H. attenuata. However, most specimens of both species in various herbaria are
sterile, and in the fertile specimens spores are usually partly damaged.

195

20 30 40 50 um

H. lignosa,
— H. attenuata,

3 — H. villosa, 4 -

lloidea, 2 - H. separabilis,

2. Setae: 1 - Hymenochaete tomente

Fig
5 -

H. geniculata, 9

7 - H. flexosetosa,

H. muroiana, 6 - H. subdissimilis,

10 - H. minuscula

196

0) 10 20 30 40 50 um
ae eee eee |

Fig. 3. Setae and hyphidia: 1 - Hymenochaete dissimilis, 2 - H. innexa (h - hyphidia), 3 - H. berteroi
(h - monilioid hyphidia), 4 - H. floridea (d - dendrohyphidia), 5 — H. semistupposa (h - monilioid
hyphidia)

10 20 30 40 50 um

Fig. 4. Setae: 1 - Hymenochaete cervina, 2 - H. nothofagicola, 3 - H. legeri

One of the additional characters of H. attenuata is differentiation of a hyphal layer near
the hymenium. Hyphae of this layer are densely compacted in parallel, whereas in H.
rheicolor they are interwoven.

It is possible to distinguish “typical” specimens of H. attenuata and H. rheicolor, but
there are several “untypical” specimens with overlapping characters in herbaria, and the
independence of these two species is doubtful.

Mean spore size and mean Q value in Hawaiian specimens of H. attenuata (Q value is the
ratio of mean spore length to mean spore width):

Oo a 0) 195 RLG 21082
4.05 x 1.79 2.26 RLG 22743
4.09 x 1.95 Pay) RLG 21067
4.47 x 2.01 ae RLG 19253
4.48 x 1.88 2:38 RLG 17007
4.69 x 1.93 2.43 RLG 21081

4.96 x 1.90 2.61 RLG 18112

198

For comparison, the mean spore size and mean Q value in other specimens studied:

H. rheicolor 4.27 x 1.94 2.20 Mexico, BPI 278538

H. attenuata 4.34x 1.85 235 Chile, BPI 330072

H. attenuata 4.34 x 1.86 2.35 Chile, BPI 33758

H. attenuata 4.54 x 2.00 2:20 India, TAA 103213

H. rheicolor 4.75 x 2.09 227 Guyana, BPI Lloyd 6734
H. rheicolor 4.80 x 1.93 2.49 Mexico, TN 18397

H. rheicolor 4.85 x 1.94 2.50 Mexico, XAL 1588

H. rheicolor 4.87 x 2.13 2.29 Mexico, TN 18369

H. attenuata 5.05 x 2.01 2.51 Thailand, O 18025

H. rheicolor Sl x10 2.46 Dominica, BPI 297738
H. rheicolor 5.33 x 1.99 2.68 Puerto Rico, BPI 278545

H. attenuata sensu G. Cunn. found in New Zealand on dead twigs of Nothofagus
spp. is a different species characterized with setae (55—)65-100 x (6-) 7-11(-14) um,
broadly ellipsoid or subcylindric spores with one side flattened, (5.5—) 6.0-8.0(-8.5) x
(3-)3.5-4.5(-5.0) um. Sparse dark brown thick-walled hyphidia 2.5-3 um in diam are
present in the hymenium. The New Zealand species will be described as a new one (H.
nothofagicola) in the Appendix of this paper. Description of H. attenuata by Job (1991:
7-8) combines the data on H. attenuata, H. attenuata sensu G. Cunn. and a species
collected in Switzerland and described by Job and Keller (1988).

2. HYMENOCHAETE BERTEROI Pat., Bull. Soc. Mycol. France 10: 78. 1894.

Description: see Parmasto, 2005. Bigs eas
O’aHu. C.L SHEAR 113 (BPI 1100595), on Acacia koa, Pupukea Forest Reserve, 31 Jan
(19282).

Comments. Closely related to H. semistupposa, which differs by absence of setal hyphae
and having spores 3.2-4.5 x 1.7-2.2 um.

3. HYMENOCHAETE CERVINA Berk. & M.A. Curtis, J. Linn. Soc., Bot. 10: 334. 1868.

Figs. 1, 16; 4, 1
Basidiomata perennial, effused, adnate, woody hard, up to 500-1100 um thick, as
rounded patches up to 5 cm or more in length. Hymenium even, umber (M: 5-7.5 YR
4/6 to 5/4; K & W:7 E4-7 F 5); margin abrupt.

Cortex present but not easily distinguishable, usually observable as a dark line near
the substrate; hyphal layer absent; setal layer very thick; dark line above the hymenium
absent.

Hyphal system subdimitic; (pseudo)skeletal hyphae ascending or vertically interwo-
ven, densely agglutinated, with thick walls, brown, sparsely branched, 3-5 um in diam;
generative hyphae innumerous, thin-walled, branched, subhyaline, 3-5 um in diam;
setae numerous, narrowly conical or spine-like, at base arising from a dense node of
thick-walled hyphae, straight, 70-100(-120) x 7.5-12(-14) um, emerging up to 40
um above the hymenium, with a hyphal sheath which is finely encrusted in old setae;
cystidia absent; hyphidia scattered, cylindrical, with brown thickened walls, in upper
part sometimes slightly sinuous, 2.5-3.5 um in diam; basidioles present, thin-walled;
basidia clavate or slightly subutriform, 20-25(-30) x 7-8.5 um, with 4 thin sterigmata

about 4 um long; spores broadly ellipsoid, with one side slightly flattened, mostly with a
large guttule, (5.7—)6-7 x (4.0-)4.3-5(-5.2) um.
Causes a fibrous white rot of wood.
Kaua’l. RLG 20644 on Cryptomeria japonica, Lehua puhi Trail, Kokee State Park.

Comments. This Hawaiian specimen is typical for H. cervina. Presence of crystalline
matter in the setal layer indicated for this species by Léger (1998: 86) is a variable
character in H. cervina. Spores have rarely been observed in specimens kept in world
herbaria but the Hawaiian collection has numerous spores. Their mean size is 6.39 x 4.60
um and the length/width quotient is 1.39 (average of 22 spores measured). H. cervina
has been found in Australasia (New Zealand), South America, Caribbean and North
America. Data on occurrence in East Tropical Africa (Uganda) are doubtful.

4. HYMENOCHAETE DISSIMILIS G. Cunn., Trans. Roy. Soc. New Zeal. 85 (1): 44. 1957.
Digs lets yal

Basidiomata perennial, effused, closely adnate, hard when dry, up to 1500 um thick;
hymenium smooth or tuberculous, deeply cracked, when young grayish Cinnamon (M:
5.5 YR 5/6; K & W: 6 D 4), then dark Vinaceous Buff (M: 7.5 YR 5.5/4; K & W: dark 6 D
3); margin indistinct, then abrupt.

Tomentum and cortex absent, hyphal layer thin and soon disappearing; context com-
posed of thickening, indistinctly stratose setal layer.

Hyphal system monomitic; hyphae densely agglutinated with brown resinous matter,
2.5-4.5 um in diam, brownish to brown, thick-walled, septate, branched; in context and
hymenium crystalline matter usually present; setae numerous, of variable size, (35-)45-
80 x 5-9 um, projecting to 50 um above hymenium, subulate, with acute tip, straight,
usually with a thin hyphal sheath, without incrustation; cystidia and hyphidia absent;
basidioles with thin walls at base slightly thickened and yellowish, 18-25 x 3.5-4.5 um;
basidia subutriform, (15—)18-22(-25) x 4-5 um, with 4 sterigmata about 4 um long;
spores ellipsoid, with one side flattened, 4.2-5.4 x 2.5-3.2 um.

Hawar. RLG 17624, 17741 on Acacia koa, Keanakolu Rd.

Comments. This species has been described from New Zealand and found later only in
Réunion. All three specimens collected on Hawai’ differ from the previously published
descriptions by lack of crystalline masses in the setal layer. We do not consider this
character to be a taxonomically important one.

H. dissimilis is externally very similar to H. unicolor. Both may have very thick
cracked basidiomata. The last named species differs in having smaller setae (30-)35-50
x 5-7 um and spores 3.4-4.8 x 2.2-2.8 um.

Mean spore size and mean Q value of H. dissimilis:

4.66 x 2.81 1.66 RLG 17624
5.03 x 2.90 L74 RLG 17741
5. HYMENOCHAETE FLEXOSETOSA Parmasto, sp. nova Pigs.15,12;.257

Basidiomata annua, pileata, flabelliformes, imbricata, ad 1 cm longa et 450 um crassa.
Tomentum et stratum hypharum adsunt, cortex et textus setarum desunt. Systema
hypharum monomiticum; hyphae tunicis incrassatis, ramosae; setae subulatae, 40-70

200

x 7-12 um, subacutae, sine incrustatione, setae nonnullae in parte basale ex hyphis
setoideis breves 20-40(-60) x 3-5 um adscedentia; cystidia et hyphidia desunt; basidioli
tunicis incrassatis basim tenuiter granulosis; basidia 20-25 x 4-5 um; basidiosporae late
ellipsoideae, (4.8-)5-5.8(-6.2) x 3-3.5(-3.7) um. A H. attenuata et H. rheicolore hyphis
setoideis praesentis atque sporis latis differt.

Holotypus: Hawai'i, on Psidium guajava, R.L. Gilbertson 18932, Honokaia Boy Scout
Camp (ARIZ; isotypus: TAA).

Etymology: flexuosus, flexuous; seta, seta.

Basidiomata annual, pileate, soft, papery-coriaceous and flexible when dry; pilei fla-
belliform, 0.3-1 cm long, 200-450 um thick, imbricate, sometimes seemingly effused-
reflexed but then umbonate (attached in one point); pileal surface velutinous or tomen-
tose, concentrically sulcate and zonate, coarsely radiately fibrillate (silky-fibrous), dull
Fulvous Umber (M: 7.5 YR 4/6; K & W: 6 D 5); margin thin, lobate, concolorous with
the pileal surface or lighter coloured; hymenium smooth, not cracked, grayish Fulvous
(M: 7.5 YR 5/6; K & W: 6 D 4).

Tomentum present as loosely interwoven hyphae, 80-200 um thick; cortex absent;
hyphal layer composed of radiately interwoven generative hyphae and few short setal
hyphae bending to setae; setal layer absent.

Hyphal system monomitic; hyphae with thickened walls, brownish (in tomentum
thick-walled and brown), sparsely branched, with septa, in hyphal layer 2.5-3.5 um, in
tomentum 3.5-5 um in diam; setae innumerous or numerous, subulate, straight, bluntly
acute, 40-70 x 7-12 um, emerging 10-25 um above the hymenium, with a thin hyphal
sheath, without incrustation; some setae are L-shaped, originating in the context from
a short setal hypha like horizontal part 20-40(-60) tum long and 3-5 um in diam; this
continues as a usual thick-walled generative hypha; basidioles with thickened and
brownish base with rough (finely encrusted) walls, 25-30 x 3.5-4 um; basidia 20-25
x 4-5 um, with 4 thin sterigmata; spores broadly ellipsoid, with one side flattened,
(4.8-)5-5.8(-6.2) x 3-3.5(-3.7) pum.

Causes white fibrous rot of wood.

Hawart. RLG 18932 on Psidium guajava, Honokaia Boy Scout Camp.

Comments. This new species is externally very similar to H. attenuata and H. rheicolor
which differ in spore form and width (1.7-2.3 um) and absence of setal hypha-like base
of L-shaped setae characteristic for H. flexosetosa. Mean size of spores of the type of
H. flexosetosa is 5.40 x 3.21 um; Q = 1.68.

An almost identical specimen has been collected 18 Sep 1956 by S. Ahmad from
Pakistan on branches of Viburnum sp. and identified by him as H. rheicolor (LY 2284).
It is sterile, with no spores.

6. HYMENOCHAETE FLORIDEA Berk. & Broome, J. Linn. Soc., Bot. 14: 68. 1873.

Fig. 3, 4
Basidiomata effused, closely adnate, 100-200 um thick (up to 500 um according to
Léger, 1998: 140); hymenium smooth, usually not cracked, bright Sienna (or reddish
brown) (M: 5 YR 5-6/8; K & W: 7 (C-D) 7; specimens described by Léger M: 5 YR
4/34); margin very narrow.

201

Tomentum and cortex absent; hyphal layer present, of densely interwoven hyphae.
Hyphal system monomitic; hyphae interwoven, distinct, 2.5-4.5 um in diam, brown,
with thick walls, septate, branched; setae numerous, (55—)60-—85(-—100) x 6-9(-10) um,
broadly subulate, with bluntly acute tip, straight, usually with a thin hyphal sheath,
some encrusted with granules, projecting to 40 um above the hymenium, at base usually
surrounded with arbuscular hyphidia; cystidia absent; hyphidia very numerous, with
brown thick-walled stem 3-4 um in diam, in subhymenium and hymenium dendroid,
repeatedly branched, in setal layer very numerous head-like brown arbusculi 10-25 um
in diam with very numerous short side branches about 1 um in diam; basidia not seen
but according to Léger (1998: 140) 15 x 4 u; spores cylindrical or ellipsoid, 6-7 x 2.5-2.8
uum.
Hawart. RLG 19000: on Metrosideros polymorpha, Thurston Lava Tube, Hawai'i
Volcanoes Nat. Park (HVNP).

Comments. This is the only Hymenochaete species with heavily branched dendrohyphidia
in Hawai'i. Somewhat similar is H. sphaericola Lloyd (H. cruenta (Pers.: Fr.) Donk p.p.),
a species widely distributed in East and South-East Asia and Australasia that has dend-
rohyphidia with innumerous long (5-25 um) branches never forming arbusculoid
heads. H. floridea has Asia Tropical-North-Central Pacific distribution.

7. HYMENOCHAETE GENICULATA Parmasto, sp. nova Figs. 1, 9; 2, 8

Basidiomata perennia, effusa, coriacea, 100-250, deinde ad 500 um crassa. Hymenium
laeve vel leviter colliculosum, atro-ochraceum, vetustus crevisum. Tomentum et cortex
adsunt; stratum hypharum crassum, ad stratum setarum indistinctum transiens, parte
basale cum setis adscedentis atque hyphae setales vel setae hyphales nonnullis ad 80 x 6 um.
Systema hypharum subdimiticum; hyphae tunicis incrassatis brunneis, leviter ramosae non
densiter intermixtae; setae numerosae, anguste fusoideae, 40-70 x 7-12 um, partim breve
stipitatae, aliae basim geniculate arcuatae, acutae, sine incrustatione; basidioli numerosi,
subhyalini; basidia cylindraceo-clavati, 20-30 x 4-5 um; basidiosporae breve cylindraceae
vel subellipsoideae, 4.5-6 x 2.3-3(-3.3) um. Species similis H. stratura stratis hypharum
hyphis paralleliter densiter contextis atque sporis minutis 3.5-4 x 2-2.5 um differt.
Holotypus: Kauai, Kokee St. Park, on Metrosideros polymorpha, 5 Jan 2000, R.L.
Gilbertson 22797 (ARIZ; isotypus: TAA).

Etymology: geniculatus, (setae) bent like a bent knee.

Basidiomata perennial, effused, adnate, when old detachable as small pieces, coriaceous,
100-250, later up to 500 um thick, as rounded patches, then confluent and up to 10 cm
long. Hymenium even or slightly tuberculose, yellowish brown, bronze brown or dark
ochraceous with an isabelline tint (M: 10 YR 5/8, 10 YR 5/6, when old umber - 7.5 YR
4/4); K & W: 5 (D-E) 5, when old 6 F 6), later with a few deep crevices; margin indistinct
and more lightly coloured, then abrupt.

Tomentum and cortex absent; hyphal layer thick, in lower part with scattered setae
(with gradual transition to the indistinct setal layer), with a few horizontal setae or short
setal hyphae, in old specimens more dense and may be called setal layer.

Hyphal system subdimitic; hyphae in the hyphal layer almost loosely interwoven,
with thickened brownish walls (some hyphae thin-walled and subhyaline), sparsely

202

branched, with septa, 2.5-3.5(-4) um in diam; setae numerous, narrowly fusoid,
(35-)40-60 x 4-7(-8) um, partly with a slightly sinuous thick-walled stipe, others angled
(geniculate) near the base, with an acute tip, naked or covered with a thin hyphal sheath,
projecting up to 20 um above the hymenium, setae embedded near to the substrate
ascending and up to 75 um long; setal hyphae (embedded horizontal setae) 40-80 um
long, 3.5-6 um in diam; basidioles numerous, subhyaline, 20-30 x 3.5-4.5 um; basidia
cylindrical-clavate, 20-30 x 4-5 um, with 4 sterigmata 2.5-3.5 um long; spores short-
cylindrical or almost ellipsoid, some with one side concave, 4.5-6 x 2.3-3(-3.3) um.
Causes fibrous white rot of wood.

Hawarl. RLG 20478, on Coprosma montana, Kipuka Puaulu, HVNP; RLG 17378,

22365 on Sapindus saponaria, Kipuka Ki, HVNP. Kaua’1. RLG. 22797 (holotype), on

Metrosideros polymorpha, Lehua Puhi Trail, Kokee State Park.

Comments. The species is possibly closely related to the H. stratura G. Cunn., found
twice in New Zealand on wood of Podocarpus species; H. stratura differs in having a
hyphal layer composed of densely parallel hyphae and small spores 3.5-4 x 2-2.5 um.

Mean spore size and mean Q value of H. geniculata:

4.98 x 2.81 L77 RUG 22797
530X275 1:93 RLG 17378
S152 X25 217 RLG 22365

8. HYMENOCHAETE INNEXA G. Cunn., Trans. Roy. Soc. New Zeal. 85 (1): 47. 1957.
Fig. 3, 2

Basidiomata perennial, effused, closely adnate, hard when dry, 50-100 um thick;
hymenium smooth, not cracked, light Umber (M: 5 YR 5/4; K & W: 6 D 4; New Zealand
specimens described by Léger (1998: 165) as reddish brown, M: 5 YR 4/4); margin very
narrow, thin, arachnoid-fibrillose, Sienna (M: 7.5 YR 6/6), then indistinct.

Tomentum, cortex and hyphal layer absent.

Hyphal system monomitic; hyphae interwoven, distinct but partly agglutinated
with brown resinous matter, 2-3 um in diam, brownish, with thickened walls, septate,
branched; setae numerous, 50-85 x (7—)8-13(-14) um, broadly subulate, with bluntly
acute tip, straight, usually with a thin hyphal sheath, some encrusted with granules, pro-
jecting to 40 um above the hymenium; cystidia absent; hyphidia with brown thickened
walls (but when new basidia are developing, then hyaline or absent), some slightly
sinuous, 2~3 um in diam; basidia subutriform, with slightly thickened walls at base,
15-20 x 4-5 um, with 4 thin sterigmata; spores cylindrical, straight or slightly curved,
5.5-7(-7.5) x 1.8-2.5 um.

Causes white pocket rot of wood.

O’anu. RLG 18411 on Eucalyptus sp., Manoa Falls Trail.

Comments. There is only one other Hymenochaete species with non-monilioid brown
hyphidia in Hawai'i, H. cervina, but it has broadly ellipsoid spores (5.7—)6-7 x (4.0-
)4.3-5(-5.2) um. H. innexa has been previously found in China, Japan, India, Australia
and New Zealand; isotypes in BPI studied by E. P. The Hawaiian specimen has only few
spores; mean size of 11 spores measured is 6.67 x 2.16 um; Q = 3.1.

203

9. HYMENOCHAETE LEGERI Parmasto, sp. nova Figs. 1, 14; 4, 3
A H. corrugata (Fr: Fr.) Lév. setis longis robustis (60-)75-100(-110) x 10-15 um apicis
crystallis multis tectis, sporis grandis cylindricaceis vel suballantoideis 5.5-8.2 x 2.2-3.2
um nec non hymenio pallide griseo vel albido differt.

Holotypus: Hawaiian Islands, Moloka’i Is., Kamakou Rd., on Eucalyptus sp., 9 Jan 2000
R.L. Gilbertson 23032 (ARIZ; isotype in TAA).

Etymology: Jean-Claude Léger (2 Oct 1938 - 16 July 1999), distinguished French
mycologist, author of a fundamental monograph of world Hymenochaete.

Basidiomata annual, effused, closely adnate, crustose, woody hard, 100-500 um thick
(when old up to 1 mm and sometimes indistinctly stratified), as rounded patches 0.5-2
cm long, then confluent and up to 10 cm long; hymenium even or somewhat tuberculose
when old, later with some irregular deep fissures, pale Mouse Gray, Vinaceous Buff, pale
Vinaceous Buff or whitish (M: 5-10 YR 7-8/2 to 8/1-3; K & W 5 B 2 or (5-6) (B—C) 2),
when old and sterile dark Fulvous to Umber or Sepia (M: 5 YR 4-5/4-6; K & W 6 D 6);
margin clearly delimited, when young narrowly white and fimbriate, soon abrupt, usual-
ly with a narrow brown(ish) strip (M: 5-7.5 YR 4/6; K & W:6 D6-6E/7).

Tomentum absent; cortex absent or present and then 10-20 um thick; hyphal layer
30-80 um thick, sometimes almost absent; setal layer thickening; dark line above the
hymenium absent.

Hyphal system subdimitic; hyphae in hyphal layer at first not densely, then densely
interwoven; generative hyphae with thin or slightly thickened walls, subhyaline, sparsely
branched and septate, 2.5-4 um in diam; skeletoids sparsely branched, with thickened
walls, brownish, 2.5-4 um in diam; setae numerous or crowded, hymenium composed
of basidioles, basidia and innumerous thin- or thick-walled hyphidia; setae broadly
conical, at base arising from a dense coralloid node of brown thick-walled hyphae,
straight, (60-)75-100(-120) x 10-15 um, projecting 30-60 um above the hymenium,
covered with a hyphal sheath, acute or almost blunt tip usually covered with a conical
conglomerate of crystals; hyphidia rare, cylindrical, brownish, with thickened walls, 2-3
uum in diam; basidioles thin-walled; basidia subutriform, 20-25 x 4.5-6 um, with thin
hyaline walls, with (2) 4 sterigmata 3—4 um long; spores cylindrical or suballantoid, 6-8
of Dem ey AUANH

Causes white pocket rot of wood.

Hawarl. RLG 17184 on hardwood, RLG 17193 on Grevillea robusta, RLG 17194 on
Psychotria hawaiiensis, RLG 18651 on Psidium guajava, Kalopa State Park; RLG 17553
on Casuarina sp., RLG 17806, 17858, 18202 on Psidium guajava, RLG 17859, 18242,
22239 on Eucalyptus sp., RLG 18924 on Toona ciliata; Honokaia Boy Scout Camp; RLG
20977, 20989 on Toona ciliata, Stainback Highway; RLG 17246 on Mangifera indica,
Rainbow Falls; RLG 19428 on Mangifera indica, Kapoho Rd.; RLG 20727 on Acacia koa,
Keanakolu Rd.; RLG 23308 on Coprosma montana, Kipuka Puaulu, HVNP; RLG 16826
on Sapindus saponaria, Kipuka Puaulu, HVNP; RLG 22250 on Schinus terebinthifolia,
RLG 22254 on Cerecropia obtusifolia, Manuka State Park. Kaua’1. RLG 21072 on Acacia
koa, Makaha Rd.; RLG 21198 on Metrosideros polymorpha, Lehua Puhi Trail, Kokee State
Park; RLG 17945, 21260, 22726 on Pinus elliottii, Makaha Rd.; RLG 20617, 21055 on
Sequoia sempervirens; Kokee State Park; RLG 21044 on Eucalyptus sp., Kukiolona Park,
Kalaheo; RLG 21168: on Metrosideros polymorpha, Ohelo Berry Flat Trail, Kokee State
Park; RLG 21226 on Acacia koa, Makaha Rd.; RLG 22727 on hardwood, Makaha Rd.;

204

RLG 22787 on Nestegis sandwicensis, RLG 22803 on Metrosideros polymorpha, Lehua
Puhi Trail, Koke’e State Park; RLG 22845 on Acacia melanoxylon, Ohelo Berry Flat Trail,
Koke’e State Park; RLG 21251 on Pinus elliottii, Milol?i Rd. Maul. J.E. Adaskaveg 1469
on Spathodea campanulata, Mile 4, Hana Highway; RLG 19172 on Psidium guajava,
Maluhia Boy Scout Camp; RLG 21475, on Pinus pinaster, Waihou Spring Trail, Olinda;
RLG 21524 on Aleurites molluccana, Makemakeole Trail, West Maui; RLG 23150,
23158 on Araucaria heterophylla, Maluhia Boy Scout Camp. MoLoka’!. RLG 21449 on
Casuarina sp., Palaau State Park; RLG 21337, 23032, 22965, 22978, 23044, 23048, 23053
on Eucalyptus sp., Kamakou Rd.; RLG 19204 on hardwood, Kamakou Rd.; RLG 19353
on Acacia mearnsii, Kamakou Rd.; RLG 23002 on Araucaria heterophylla, Kamakou Rd.;
RLG 21411 on Pinus pinaster, Kamakou Rd,; RLG 22947 on Casuarina sp., Kalaupapa
Overlook. O’anu. C.L Shear, BPI 11006101, on Hibiscus tiliaceus, Tantalus Rd.; Don
Hemmes 65 on Syzygium cumini, Pali; RLG 16931 on hardwood, Manoa Falls Trail;
RLG 18331, on Schinus terebinthifolia, Pwu Ohia Trail; RLG 18346: on Psidium guajava,
Manoa Cliffs Trail.

Found also in INp1A (Tamil Nadu St., Kalakad Sanctuary, 13 Feb 1979 E. Parmasto, TAA
103250), TAIWAN (Wu 880501/26, TAA) and Azores (on Cryptomeria, B. Spooner, K).

Comments. The new species is well characterized by broad setae with a tip usually heavily
covered with crystals, relatively big suballantoid spores and (when not very old or dead)
alabaster or marble white hymenium. It seems to be closely related to the widespread
(but not reported in Hawai’i) species H. corrugata that also has relatively big setae with
nodose hyphal base and granulose tip, but has a much darker pinkish gray hymenium.
That species has setae 35-80(-100) um long, spores of similar form but smaller (4.5—-6.5
x 1.5-2.3 um). Several species of Hymenochaete have whitish gray hymenium covered
with numerous crystals when basidiomata are old, sterile or half-dead. In H. legeri, pale
colour of hymenium caused by abundant crystals is a sign of intensive growth and in
many cases also of presence of ripe basidia and spores.

In old specimens of H. legeri the hyphal layer is almost indistinguishable from the
setal layer, and cortex is hardly observable. In sterile and no longer growing specimens
the hymenium turns brown and the characteristic pale (whitish) colour fades off.

H. legeri has Macaronesia—Asia Tropical-North-Central Pacific distribution.

Mean spore size and mean Q value of H. legeri:

6.305 2.71 DRED RLG 18346
6.o1ix 2.64 2.39 RLG 18331
6.31 x 2.48 2.54 RLG 19172
6.34 x 2.41 2.65 RLG 23032
6.48 x 2.56 253 RLG 17194
6.56 x 2.36 278 RLG 18924
6.68 x 2.58 2.60 RLG 22978
6.77 x 2.68 2553 Azores (K)
6.92:x% 2:57 2.69 RLG 21475
6.94 x 2.49 2: & RLG 18924
7.03 x 2.64 2.0), BPI, Shear 1100610
4.05.x 2.61 2:1) RLG 23048
LAX 2.05 2.73 RLG 23044
LOD on 2.79 RLG 22965

7.18 x 2.63 pA i RLG 21055

205

7 222.63 Za) RLG 22947
A295 X2.53 2.87 RLG 21449
At Xea68 275 RLG 21044
VERY Oe ORV 2.56 Adaskaveg 1469
TI 2k AOy: 297 RLG 17184

10. HYMENOCHAETE MINUSCULA G. Cunn., Trans. Roy. Soc. New Zeal. 85 (1): 48.
1957. Prose). 5; 2,110

Basidiomata perennial, effused, adnate, woody hard, 150-450 um thick (50-150 um
in specimens found in New Zealand, Africa and America), when old with innumerous
deep cracks. Hymenium smooth, dark grayish Ochreous (M: 10 YR 5/6; K & W: 6 D 4);
margin abrupt.

Cortex, tomentum and hyphal layer absent; setal layer indistinctly stratose, with
scattered crystals; dark line above the hymenium absent.

Hyphal system monomitic; hyphae distinct, densely interwoven, with thin or thick-
ened brownish walls, sparsely branched, septate, 2.5-4 um in diam; setae numerous,
subulate, acute, straight or some slightly curved and undulate, 35-60(-65) x 4-7 um,
usually with a thin hyphal sheath, emerging up to 40 um above the hymenium; cystidia
and hyphidia absent; basidioles 18-25 x 3-3.5 um, with thickened base walls encrusted
with granules; basidia subutriform, 15-22 x 3.5-4 um, with 4 thin sterigmata; spores
ellipsoid or short-cylindrical, with one side flattened or slightly concave, 4.2-5.2 x 2.2-
2a LUN:

Causes a fibrous white rot of wood.

Hawart. RLG 17722: on Acacia koa, Keanakolu Rd..

Comments. Ochraceous or yellowish brown colour characterizes this species. It has
been found also in New Zealand, Western Indian Ocean region of Africa, and in South
America, i.e, has a Gondwanan distribution type.

Mean spore size and mean Q value of H. minuscula:
4.67 X 2.37 1.98 REG 17722

11. HYMENOCHAETE MUROIANA I. Hino & Katum. in Hino, Icones Fung. Bambus.
Japan 237. 1961. Pigs; lo 3ios 2,9

Basidiomata annual, effused, adnate, when older detachable as small fragile pieces,
coriaceous, hard when dry, 30-50(-100 ?) um thick, as rounded patches 2-5 cm long,
later sometimes confluent and up to 15 cm long. Hymenium even, vinaceous buff, fawn
or dark fawn, when old dark fawn or grayish umber (M: 5 YR 5/4 or 6/1 - 7/2, when old
and sterile 5 YR 4.5/2; K & W: 7 C 2 — D 3, when old 7 E 4-5); margin thin, indistinct,
then distinctly delimited, concolorous with the hymenium.

Tomentum, cortex and hyphal layer absent; setal layer very thin, 10-20 um thick;
dark line above the hymenium absent.

Hyphal system monomitic; hyphae in setal layer densely interwoven, agglutinated,
with thickened or thick walls, brownish, with rare septa and branches, (2-)2.5-4 um
in diam; hyphal layer composed of loosely interwoven, richly branched and septate
brownish hyphae with thickened or thick walls, 2.5-4.5 um in diam; setae numerous;
hymenium composed of basidioles and basidia; cystidia and hyphidia absent; setae

206

narrowly (sometimes broadly) subulate, usually partly bifurcate at base, with slightly
curved upper part and acute or almost blunt tip, (30—)40-50(-60) x (5-)6-8(-9) um,
naked (without a hyphal sheath), projecting up to 20(-30) um above the hymenium;
basidioles thin-walled; basidia subutriform, 15-20 x 4.5-6 um, with thin hyaline walls,
with 4 sterigmata 3-4 um long; spores broadly ellipsoid, 4-6 x (2.5-)3-3.5 um.
Causes fibrous white rot of wood.

Hawar'. RLG 21011, 21019, 21028 on Bambusa vulgaris, Waipio Ridge Trail; RLG 21013,

21017 on Phyllostachys nigra, Waipio Ridge Trail. Maur. C.L. Shear and N.E. Stevens,

BPI 1199597; West Maui, Pogues Ditch, 2 Jan 1928, no other data (BPI 1100597).

Comments. This species has been described from Japan, and found later only in Taiwan
(NMNS, S.H. Wu 880501-26, unpublished data), Indo-China and Malesia (Parmasto,
2005). Most collections are from dead (fallen) stems of bamboo.

In the original description of H. muroiana and its synonym H. iriomotensis 1. Hino
& Katum. (Hino & Katumoto, 1964) as well as in the redescription of the types by Léger
(1998: 199), the spores are described as (3-)3.5—4(-4.5) x (1.8—)2-2.6 um and setae as
very numerous and smaller than in most of our specimens (Léger: (16-)18-35 x (4.5-
)5-6(-6.5) um). However, some old sterile specimens collected from Taiwan and Hawai'i
(BPI 1100597) studied by us have densely crowded, short conical setae 30-40 x 7-12
tum; setal variation seems to be related to the state of development of the basidiomata.
The types of this species were described by Léger (1998: 198, 200) as soot brown (brun
suite, 7.5 YR 5/2); as in most species of Hymenochaete, the colour depends on presence
or absence of basidia and basidioles. In the Hawaiian collections, both sterile umber
fawn and fertile vinaceous buff specimens are represented.

One of the Hawaiian specimens (RLG 21011) differs from the others by thickness
(up to 250 um), dark brown colour (7.5 YR 4/6), setae 35-50(-55) x 5-7(-8) um, small
spores 3-4 x 1.9-2.5 um (mean size: 3.47 x 2.15 um, Q = 1.62) and substrate (Coprosma
montana of the family Rubiaceae). According to the spore size, this collection is close
to the Japanese and Sulawesi specimens of H. muroiana. It may be possible that there is
more than one species in this group.

Mean spore size and mean Q value of H. muroiana:

5.30, 5.9.00) 1.54 RLG 21028
3: 01X9.09 L39 RLG 21019

12. HYMENOCHAETE SEMISTUPPOSA Petch, Ann. Roy. Bot. Gard., Peradeniya 9: 278.
1925. Pigs. 1) 43.5

Basidiomata annual (but sometimes layered), effused, adnate but easily detachable,
soft membraneous, 200-500 um thick; first 3-10 mm in diam, with pennately fimbriate
margin, then confluent. Hymenium even (under looking glass pubescent), in old
specimens sometimes minutely cracked, sepia to dark brown (M: 2.5-5 YR 4/3, K & W:
6 E 6); margin when young pennate-fimbriate with fibrils 1-2 mm long, not attached to
the substrate, margin and very young basidiomata sienna or fulvous to sienna (M: 5 YR
5-6/8; K & W: Cinnamon or Raw Sienna, 6 D (6-7)).

‘Tomentum absent or present as abhymenial hairs; cortex present, 40-150 um thick;
context composed of cinnamon or fulvous hyphal layer 100-200 um and thin to thick
setal layer up to 200 um thick; dark line above the hymenium absent.

207

Hyphal system monomitic; hyphae of the fibrillose margin parallel, with
thickened walls, yellow, rarely septate, some slightly flexuous; cortex composed of
densely agglutinated parallel brown, thick-walled hyphae 3.5-5 um in diam; hyphal
layer composed of loosely interwoven, richly branched, septate brown hyphae with
thickened or thick walls, 2.5-4.5 um in diam, many hyphae slightly monilioid and with
punctually thickened walls; setal layer made of thickening hymenium, between setae are
vertically situated, densely parallel, frequently septate, yellow or brownish, slightly monil-
ioid hyphae; hymenium composed of setae, numerous hyphidia and basidioles, and few
basidia; setae numerous, conical, straight, with acute tip, (40)45-—70(-80) x (6—) 7-9.5(-12)
uum, mostly with a hyphal sheath, projecting up to 40 um above the hymenium;
hyphidia, basidioles and basidia similar to each other, 18-25 um long and 2.5-4 um
(basidia up to 6 um) in diam, with walls thickened and brownish at base, developing
from hyphae with numerous septa; many hyphidia monilioid and/or with thickenings
on walls; basidia cylindrical, with 4 sterigmata 3-4 um long; spores ellipsoid or short
cylindrical, one side slightly concave or flattened, 3.2-4.5 x 1.7-2.2 um.

HawallAN Is. 1921 EL. Stevens 871, 878 (BPI 277727, 277717, identified as H.
cinnamomea). HAWAII. RLG 18934 on Eucalyptus sp., Honokaia Boy Scout Camp;
RLG 17442 on Metrosideros polymorpha, Thurston Lava Tube, HVNP; RLG 16978,
16983 on Metrosideros polymorpha, Mile 21, Saddle Rd.; 18085, 20746, 20757, 20763 on
Metrosideros polymorpha, Mile 18, Saddle Rd.; RLG 19047 on Metrosideros polymorpha,
Manuka State Park. Kaua’1. RLG 20580 on Acacia melanoxylon, Ohelo Berry Flat Trail,
Kokee State Park; RLG 22828 on hardwood, Lehua Puhi Trail, Kokee State Park. OAHU.
C.L. Shear (BPI 1100598) on Metrosideros polymorpha, Manoa Valley.

Comments. Cunningham (1957) and Job (1987) found that the basidiomata of this
species may be layered. In several Hawaiian specimens new basidiomata are growing on
old (dead?) ones, in the beginning as small isolated “islands”. The “layers” (basewalls) of
the basidiomata are not the result of uniform thickening of old ones.

H. semistupposa has been found in Southern Africa, East Tropical Africa (Kenya),
Asia Tropical (India and Sri Lanka) and Australasia. Almost all known substrates belong
to the tropical family Myrtaceae. These data suggest that this fungus belongs to the
Gondwanan historical type of distribution.

Mean spore size and mean Q value of H. semistupposa:

3:96 X1.83 95 RLG 16983
Do, SOLS 1 oF RLG 18934
Di xn 93 1.94 RLG 20580
5:93, X11.8 2 Dalif RLG 18085
413 X1.93 2.14 RLG 22828

13. HYMENOCHAETE SEPARABILIS J.C. Léger, Bull. Soc. Mycol. France 97 (1): 7. 1981.
Figs. 1, 8; 2, 2

Basidiomata annual or perennial, effused, adnate but separable as pieces when dry, soft
or coriaceous, when young about 60 um thick, then 200-400 um, as rounded patches
0.5-5 cm in diam, later confluent and up to 10 cm long; hymenium even, in older parts
irregularly cracked; light Umber (M: 5 YR 4.5-5/3-4; African specimens 10 YR 6/8, later
7.5 YR 5/6; K & W: 7 E 6); margin thin, slightly fibrillose, then abrupt, distinct, lighter

208

coloured than hymenium; context lighter coloured than hymenium, dark Sienna (M: 5
YR5/73K:&.W37.D.6):

Tomentum and cortex absent; hyphal layer present but weakly differentiated from
the thickening setal layer; dark line above the hymenium absent.

Hyphal system monomitic; hyphae brownish, with thickened walls, occasionally
branching, septate, 2-4 tm in diam, in hyphal layer loosely, later densely interwoven;
setae numerous, subulate, subfusoid, with acute tip, 25-45 x 5-7(-8) um, straight or
some slightly curved, not encrusted, usually with a thin hyphal sheath, projecting up
to 30 um above the hymenium, in upper quarter with few (1-4, rarely up to 8) low
broadly conical teeth or protuberances up to 0.5(-—1) um long; cystidia and hyphidia
absent; basidioles 12-15 x 3-4 um; basidia subutriform, 15-35 x 4-5 um, walls of basal
part slightly thickened and encrusted with granules (as are the basidioles, too), with 4
thin sterigmata 3-4 um long; spores broadly ellipsoid, with one side slightly flattened,
2.7-3.5(-4.0) x 1.8-2.5 um (in African specimens 2.8-4.5 x 1.5-2.5 um).

Causes white fibrous rot of wood.

Hawar'. EL. Stevens 877 (BPI 278618) on frondose wood, identified by Burt as H.
spreta (see Burt, 1923: 186); RLG 20978 on Toona ciliata, Stainback Hwy. Kaua’1. RLG
21190 on Metrosideros polymorpha, Lehua Puhi Trail, Kokee St. Park. MoLoKka’1. RLG
23023 on Araucaria heterophylla, RLG 23026 on Cupressus macrocarpa, Kamakou Rd.

Comments. The very small protuberances (denticles) on upper part of setae are
visible only when great magnification (x 1000 or more) is used. The similar species
H. tomentelloidea has setae (35-)40-70 x 5-10 um with 5-10 broadly conical teeth
0.8-1.5(-2) um long and more elongated spores 3.1-4.5 um long. H. separabilis
is a species of Tropical African—Northwestern Pacific distribution and possibly of
Gondwanan origin. The specimens found in Africa (Central African Republic, Gabon,
Madagascar, Mauritius, Réunion) are all thin (about 60 um), possibly young, and with
better developed hyphal layer with loosely interwoven thin-walled hyphae (see Léger,
1998: 252-254).

Mean spore size and mean Q value of H. separabilis:

Dye es AG NIN) 1.34 RLG 20978
Dal Xe 1.41 RLG 23026

14. HYMENOCHAETE SEPARATA G. Cunn., Trans. Roy. Soc. New Zeal. 85 (1): 50. 1957.

Basidiomata perennial, effused, closely adnate, very hard when dry, as rounded patches
0.5-2 cm long, later confluent, 200-500, later up to 750 um thick; hymenium coarsely
low-tuberculate or smooth, with some crevices, dark Hazel to Fawn (M: 7.5 YR 5/4 or
almost 7.5 YR 4/4; K & W: 7(-6) E, brownish terra cotta); margin abrupt, concolorous.

Tomentum, cortex and hyphal layer absent, setal layer sometimes indistinctly
2-layered.

Hyphal system subdimitic; skeletoids ascendant, with thickened brownish walls,
2.5-3.5 um diam., densely agglutinated with brown resinous matter; generative hyphae
few, subhyaline, with septa, 3-4 um diam; setal layer and hymenium with numerous
conglomerates of crystals 8-30 um diam; setae numerous, broadly subulate, (30)35-
45(—55) x 6-7(-8) tm, partly covered with a thin hyphal sheath, without incrustation or

209

with a few crystals; cystidia and hyphidia absent; basidioles numerous, brownish, 22-28
ium long; spores (according to Léger, 1998: 255) ellipsoid, 5-6.5 x 3-3.5 um.

Hawar'. RLG 20489, 23311 on Coprosma montana, RLG 23297 on Pisonia sandwicensis,
Kipuka puaulu, HVNP.

Comments. All Hawaiian specimens are sterile; they may belong to one of the two
Australasian species, H. separata or H. vallata. The last named species has spores about
4x 2 um and setae (23-)25-45(-55) x (4.5-)5-7.5 um, but these are all covered with
crystals. Setae of H. separata are bigger, described as (37—)45-55(-57) x (5.5-) 6-8 um
by Léger (1998: 255). H. separata has been found previously in New Zealand and in
Réunion.

15. HYMENOCHAETE SUBDISSIMILIS ad int. Pigsa1,3;.2, 0

Basidiomata perennial, effused, closely adnate, hard when dry, detachable as small
pieces, 100-400 tm thick; hymenium tuberculate, rather densely deeply cracked,
Grayish Sepia (M: 5 YR 5/2; K & W: 7 (D-E) 3 - 8 E33), margin abrupt (¢).
Tomentum and cortex absent, hyphal layer 30-150 um thick, pseudoparenchymatous,
indistinctly different from the setal layer; setal layer thickening, not clearly stratose.
Hyphal system monomitic; hyphae very densely agglutinated with brown resinous
matter, indistinct, 2-3.5 um in diam, brown, thick-walled; crystalline matter present in
context and hymenium, in context as conglomerates 15-50 tum in diam; setae numer-
ous, broadly subulate, 40-60(-65) x 7-10 um, projecting to 30 um above the hymenium,
with bluntly acute tip, straight, usually with a thin hyphal sheath, irregularly encrusted;
cystidia and hyphidia absent; basidioles present; basidia subutriform, 12-16 x 4-5.5 um,
with 4 sterigmata 3-4 um long; spores elongated-ellipsoid or short-cylindrical, slightly
curved or with one side flattened, 3.7-4.4(-5) x 1.8-2.5 um.
Causes white fibrous rot of wood.
Hawar'i. RLG 19028 on Psidium guajava, Manuka State Park. Maur. RLG 16777 on
Syzygium jambos, Mile 6, Hana Highway (identified in Gilbertson et al., 2002: 227 as H.
anomala Burt).

Comments. This possibly new species is externally very similar to H. dissimilis as descr-
ibed by Léger (1998: 126-127) but differs in having a tuberculate hymenium, an indis-
tinct hyphal layer, shorter setae and distinctly smaller spores. However, H. dissimilis
described by Job (1990: 19-20) has setae similar to those in H. subdissimilis (45-65 x
6-8 um). Another possibly closely related species, H. unicolor, differs in having a smooth
(even) brown hymenium, smaller nonencrusted setae (30-)35-50 x 5-7 um, basidioles
with thickened walls at the base, and broader spores 3.4—4.8 x 2.2-2.8 um.

Among specimens collected in Hawai'i, one (BPI 1103516, on Cyathodes sp., Maun-
ahui, Molokai; Degener Otto 2823, 15 Apr 1928) is very similar to H. subdissimilis
but has longer spores 4.2-5.2 x 1.7-2.4 um (mean size: 4.80 x 2.08 um, Q = 2.31). Its
~ hymenium is Vinaceous Buff-Grayish Sepia (M: 2.5 YR 5.5/4). After more collections
(including young and thin ones) are found, possibly all three species (H. dissimilis, H.
subdissimilis, and H. unicolor) may be synonymous, and only one species with variable
spore size exists.

210

Mean spore size and mean Q value of H. subdissimilis:

4.05 x 2.05 oF, RLG 19028
4.19x 2.16 1.94 RLG 16777

16. HYMENOCHAETE TOMENTELLOIDEA Gilb. & Hemmes, Mycotaxon 62: 476. 1997.
Figsnlio21

Basidiomata annual, effused, adnate, soft or coriaceous, when young 60-70 um thick,
then 200-450 um, as rounded patches 0.5-2 cm in diam, later confluent and up to 10
cm long; hymenium even, in older parts irregularly cracked; grayish dark Cinnamon or
Sienna-Umber (M: 7.5 YR 5-6/8 or 6/6; K & W: 6 D (6-7), 6 E5 or 6 D 4); margin thin,
indeterminate, lighter coloured than hymenium (sometimes M: 7.5 YR 6/10), slightly
fibrillose, then distinct and concolorous with the hymenium.

Tomentum absent, cortex sometimes present but then indistinct, 20-40 um thick;
hyphal layer up to 300 um thick; setal layer (when present) later thickening and up to
100 um thick; dark line above the hymenium absent.

Hyphal system monomitic; hyphae brown, with thickened or thick walls, occasional-
ly branching mainly at less than right angles, septate, 2-3.5 um in diam, in hyphal layer
loosely, then densely interwoven; setae numerous, subulate, with acute tip, (35-)40-70
x 5-7 um, straight or some slightly curved, not encrusted, usually with a thin hyphal
sheath, in upper third with few (5-10) broadly conical teeth 0.8-1.5(-2) tm long; project-
ing up to 20 um above the hymenium; cystidia and hyphidia absent; basidioles 15-20
x 3.5-5 um; basidia subutriform, 15-20 x (3.5-)4—5 um, with lower part slightly thick-
ened and encrusted with brown granules, with 4 thin sterigmata 3-4 um long; spores
ellipsoid, with one side slightly flattened, 3.1-4.5 x 1.8-2.5 um.

Causes white fibrous or pocket (?) rot of wood.

Hawart. RLG 20807 (holotype) on Cibotium chamissoi, Stainback Highway; RLG
18075, 18123 on Metrosideros polymorpha, Mile 18, Saddle Rd. Kaua’1. RLG 21106 on
Acacia koa, Nualolo Trail, Kokee State Park. MOLoKA’I. RLG 22952, on Casuarina sp.,
Kalaupapa Overlook.

Comments. The innumerable small denticles on upper part of setae are clearly visible
only when great magnification (x 1000 or more) is used. Differences between this species
and the very similar H. separabilis are described in the comments under that species.
H. separabilis and H. tomentelloidea are possibly two closely related sibling species of
Gondwanan origin, H. tomentelloidea being endemic.

Mean spore size and mean Q value of H. tomentelloidea:

3.40 x 2.14 59 RLG 18123
3.74 x 2.35 1.58 RLG 21106
4.11 x 2.43 1.69 RLG 18075
4.14x2.01 2.06 RLG 22952

17. HYMENOCHAETE UNICOLOR Berk. & M.A. Curtis, J. Linn. Soc., Bot. 10: 335. 1868.
Figs. 4, 11; 2, 4

Basidiomata perennial, effused, adnate, hard to woody when dry, when young 60-120
um thick, when old up to 700 um or more, as rounded patches 0.5-2 cm in diam,

Zid

later confluent and up to 5 or more cm long; hymenium even, soon cracked, when old
with deep cracks (fissures), Fulvous Umber or Sienna~Umber (M: 5 YR 4.5/6 to 5/4;
K & W: 6 E 6), when old light grayish Umber (M: 5-7.5 YR 6/4; K & W: 6 (E-D) 4);
margin distinctly delimited, lighter when young, soon abrupt and concolorous with the
hymenium.

Tomentum and cortex absent; hyphal layer 30-50 tm thick, with some included
setae, hardly distinguishable from the setal layer (with some setae), later disappearing;
setal layer thickening, with indistinct layers; dark line above the hymenium absent.

Hyphal system monomitic; hyphae brownish, with thickened walls, scarcely septate,
2-3 um in diam, in hyphal layer interwoven, in setal layer tightly agglutinated and
encrusted with brown resinous matter; setae numerous, subulate, some slightly curved,
with acute tip, (30-)35-50 x 5-7 um, not encrusted, usually with a thin hyphal sheath,
projecting up to 20 um above the hymenium; hymenium composed of basidioles and
basidia, no cystidia or hyphidia; basidioles almost cylindrical, with basal part thickened
and encrusted with resinous matter (uneven), 15-25 x 3.5-5 um; basidia subutriform,
15-25 x 4-5 um, with 4 thin sterigmata; spores ellipsoidal with one side flattened or
almost short-cylindrical, 3.4-4.8 x 2.2-2.8 um.

Causes white fibrous rot of wood.

Hawar'. RLG 17718 on Acacia koa, Keanakolu Rd. Kava’. RLG 20601 on Acacia koa,
Nualolo Trail, Kokee State Park; RLG 21204 on Myrica faya, Lehua Puhi Trail, Kokee
State Park.

Comments. Identity of the specimens studied by us is not certain. Types of both H.
unicolor and its synonym H. lignosa G. Cunn. are old thick specimens with only a few
small spores, and most collections kept in herbaria under these names are sterile. Spores
of the Hawaiian specimens are smaller than those described by Cunningham (1957),
Reeves & Welden (1967), Job (1990) and Léger (1998), who all indicated the same (!)
size, 4.5-5.5 x 3-3.5 um. Asian and African specimens studied by Parmasto (2005) have
spores 4.5-5.7 x 2.5-3.3 um. The species complex including H. unicolor, H. dissimilis, H.
minuscula and H. subdissimilis is in need of further study.

Mean spore size and mean Q value of H. unicolor:

SB IK2 oD 1.56 RLG 20601
Di Xe Zak 1.50 RLG 21204
4.41 x 2.32 1.90 RLG 17718

18. HYMENOCHAETE VAGINATA G. Cunn., Trans. Roy. Soc. New Zeal. 85 (1): 30. 1957.

Basidiomata effused, adnate but detachable as pieces, coriaceous, 120-300 um thick,
as rounded patches 0.5-1 cm long, then confluent; hymenium smooth (or tuberculate),
Umber (M: 7.5 YR 4/6); margin Ochraceous (M: 7.5 YR 7/6-7).

Tomentum thin; cortex, hyphal and setal layers present but not easily distinguishable
_ in young specimens; dark line above the hymenium absent.

Hyphal system monomitic; hyphae densely or almost loosely interwoven, with thick-
ened walls, brownish, sparely branched, septate, 3-4 um in diam; setae numerous, coni-
cal-subfusiform, 90-130 x 10-17(-20) um, emerging up to 75 um above the hymenium,
with a hyphal sheath, not encrusted; hyphidia innumerous, brownish, with thickened

ake

walls, 2-3 um in diam, some slightly flexuous; basidia subcylindrical, 18-25 x 4.5-5.5
um, with 4 sterigmata; spores cylindrical, about 6.5-9.5 x 2.4—3.2 um.
O’aHu. C.L. Shear (BPI 1100612) on Scaevola sp., Pupukea Paumalu Forest Reserve,
15 Feb [1928 ?]. - Isotype studied: NEw ZEALAND, J.M. Dingley (K (M) 57642) on
Phyllocladus alpinus, Wellington, Whakapapa, Mt. Ruapeku, 20 Oct 1949.

Comments. Until now the species was known only froma single New Zealand collection;
its variation is unknown. The Hawaiian collection is a small young specimen but with
big setae and spores characteristic for this species, and brownish hyphidia. According
to Job (1991: 46) and Léger (1998: 288), the basidiomata of this species may be up to
800-1000 um thick with thickening stratose setal layer. Isotype of this species is almost
sterile with only few, partly collapsed spores (6—)6.8-8 x 2.4-3.2 ttm (mean of 12 spores:
7.24 x 2.79 um; Q = 2.60). The Hawaiian specimen has few cylindrical curved spores
7-9.5(-10) x 2.5-2.9 um; mean of 14 spores: 8.37 x 2.64 um, Q = 3.17.

Appendix

HyMENOCHAETE NOTHOFAGICOLA Parmasto, sp. nova. Fig. 1, 13; 4, 2
— H. attenuata sensu G. Cunn., Trans. R. Soc. New Zeal. 85 (1): 33. 1957.
A H. attenuata (Lév.) Lév. setis longis (55-)65-100 x (6-)7-11(-14) um, sporis grandis
(5.5-)6.0-8.0(-8.5) x (3-)3.5-4.5(-5.0) um nec non pileis anguste reflexis ad 3 mm longis
differt.
Holotypus: New ZEALAND, North Canterbury Distr, Arthur’s Pass, 2500 ft, on
Nothofagus solandri, Jan 1956, J.M. Dingley (PDD 16989).

Etymology: nothofagicola, growing on Nothofagus spp.

Basidiomata effused-reflexed with narrow reflexed part (pileus) 1-3 mm broad, adnate
but removable in pieces, soft coriaceous, 200-350 um thick; pileal surface radially
fibrillose or substrigose, then almost glabrous, with one or two concentric zones, brown
(M: 5 YR 5/4-6; K & W: 6 (D-E) 5, Sahara); hymenium smooth but uneven, soon
minutely radially or plumosely cracked, Fulvous or Sienna-Umber when young (M: 7.5
YR 5/8 to 5 YR 5/6; K & W: 6 D 7 to 6 D (4-5), raw Sienna, Sunburn or Camel), then
Umber (M: 5 YR 4/5-6; K & W: 6 E (4-5), brown when old M: 5 YR 4/4); margin 0.5-1
mm broad, thin, sometimes torn, more lightly coloured (7.5 YR 7/10; K & W: 5 B 6,
apricot yellow), soon concolorous with hymenium.

Tomentum present but in old specimens almost indistinct; cortex absent; context
composed of hyphal layer gradually transiting to tomentum, and setal layer.

Tomentum 50-150 um thick, hyphae loosely arranged; hyphal system subdimitic;
setal hyphae absent; skeletoids 2-4 um in diam, brownish, with thickened walls;
generative hyphae yellowish, thin-walled, with rare septa; aggregates of crystals
sometimes present in hyphal layer; setae numerous, (55—)65-100 x (6-)7-11(-14) um,
fusiform, with almost blunt or acute tip, straight or in upper part slightly curved, naked,
in old specimens with hyphal sheaths, without incrustation; basidioles not numerous,
similar to basidia; basidia broadly clavate, 18-25 x 6.5-8 um, with 4 sterigmata; spores
broadly ellipsoid, with one side flattened, or subcylindric, sometimes with a large
guttule, (5.5-)6.0-8.0(-8.5) x (3-)3.5-4.5(-5.0) tum; in old specimens small crystals are
present in hymenium.

Causes white fibrous rot of wood.

Specimens studied. Holotype (see above); cotypes: NEw ZEALAND: Taupo Distr.,
Kaimanawa Ranges, 2000 ft, on Nothofagus solandri var. cliffortioides, Dec 1946, G.H.
Cunningham (PDD 4959); Kaimanawa Ranges, Upper Mohaka River, on N. menziesii,
May 1953, J.M. Dingley (PDD 12542); same locality, on N. fusca, May 1953, J.M. Dingley
(PDD 12593); Taupo Distr., Poronui, Upper Homestead, on N. menziesii, Jun 1953, J.M.
Dingley (PDD 12596); Buller Distr., Totara Flats, Glandville Forest, on N. fusca, Apr
1955, J.M. Dingley (PDD 16595); all specimens determined by G.H. Cunningham as H.
attenuata (Lév.) Lév.

Comments. This species was identified as H. attenuata by Cunningham. The true
H. attenuata, which has not been found in Australasia, differs by densely parallelly
compacted hyphae above the hymenium, shorter setae (35—)45-70(-80) um long and
small spores 3.5-5(-5.5) x (1.5-)1.7-2.2 um. Description of H. attenuata by Job (1990:
7-8) combines the data on H. attenuata, H. attenuata sensu G. Cunn. (= H. nothofagicola)
and a species collected in Switzerland and described by Job & Keller (1988).

Another species growing on Nothofagus spp. and closely related to H. nothofagicola is
H. australis Parmasto & Gresl. which has been found in Southern South America where
it is common in Tierra del Fuego. It differs in having a cortex and cylindrical spores 7-9
x 2.4—3.2 um. The two sibling species possibly have common Gondwana origin. Both are
superficially very similar to H. tabacina, which differs in presence of setal hyphae and
smaller spores 4.2-6.8 x 1.3-2.2 um.

Three of the specimens of H. nothofagicola studied by me are almost sterile, with a
few damaged spores, the other three (including the holotype) have limited numbers of
spores. In only one specimen (PDD 4959) was it possible to measure 25 spores. Their
mean size is 7.23 x 4.28 um; Q = 1.69.

Acknowledgments

Financial support from the Estonian Science Foundation (Grant no. 2145) to E. P. is gratefully
acknowledged. He is thankful to the USA National Fungus Collections and New York Botanical
Garden for the possibility to work in the herbariums (BPI, NY) in 1998 and 1999, and for loan
of specimens from PDD. We thank Dr. Karen K. Nakasone and Dr. Don E. Hemmes who kindly
reviewed the manuscript.

Literature cited

Bresadola J. 1915. Basidiomycetes Philippinenses (Series III). Hedwigia 56: 289-307.

Brummitt RK. 2001. World geographical scheme for recording plant distributions. Plant Taxonomic
Database Standards No. 2, Ed. 2, August 2001. TDWG by the Hunt Institute for Botanical
Documentation: Pittsburgh.

Burt EA. 1918. The Thelephoraceae of North America. X. Hymenochaete. Ann. Missouri Bot. Gard.
5: 301-372 +2 pl.

Burt EA. 1923. Higher fungi of the Hawaiian Islands. Ann. Missouri Bot. Gard. 10: 179-189.

Carson HL, Clague DA. 1995. Geology and biogeography of the Hawaiian islands. In: Wagner
WL, Funk VA (eds.), Hawaiian biogeography. Evolution on a hot spot archipelago. Smithsonian
Institution Press: Washington & London, p. 14-29.

Cunningham GH. 1957. Thelephoraceae of New Zealand. XIV. The genus Hymenochaete. ‘Trans.
Roy. Soc. New Zeal. 85: 1-51.

214

Eldredge LG, Evenhuis NL. 2003. Hawaii’s biodiversity: a reassessment of the number of species
in the Hawaiian Islands. Supplement to the Records of the Hawaii Biological Survey for 2001-
2002. Bishop Museum Occasional Paper 76: 1-28.

Gilbertson RL, Adaskaveg JE. 1993. Studies on wood-rotting Basidiomycetes of Hawaii. Mycotaxon
495 309=39 7,

Gilbertson RL, Hemmes DE. 1997. Notes on fungi on Hawaiian tree ferns. Mycotaxon
62: 465-487.

Gilbertson RL, Bigelow DM, Hemmes DE, Desjardin DE. 2002. Annotated check list of wood-
rotting Basidiomycetes of Hawai'i. Mycotaxon 82: 215-239.

Hino I, Katumoto K. 1964. Notes on some new species of fungi collected in the Ryukyu Archipelago.
Bull. Fac. Agric. Yamaguti Univ. 15: 505-516.

Holmgren PK, Holmgren NH, Barnett LC (eds.) 1990. Index herbariorum. Part I: The herbaria of
the World. 8" ed. New York Botanical Garden: Bronx, NY.

Job DJ. 1987. South African species of Hymenochaete (Aphyllophorales). South Afr. J. Bot.
53: 293-299.

Job Dj. 1991. Le genre Hymenochaete dans les zones tempérées de ’hémisphere sud. Mycol. Helvet.
1990, 4 (1): 1-51.

Kirk PM, Ansell AE. 1992. Authors of Fungal Names. Index of Fungi Supplement. Intern. Mycol.
Inst.: Kew. 95 p.

Kornerup A, Wanscher JH. 1973. Methuen Handbook of Colour. 3rd Ed. London.

Léger J-C. 1998. Le genre Hymenochaete Léveillé. Bibliotheca Mycologica 171. J. Cramer: Berlin &
Stuttgart. 319 p.

Munsell Book of Color. 1976. Baltimore.

Parmasto E. 2005. New data on rare species of Hydnochaete and Hymenochaete (Hymenochaetales).
Mycotaxon 91: 137-163.

Rayner RW. 1970. A mycological Colour Chart. Commonwealth Mycological Institute and British
Mycological Society: Kew.

Reeves F, Welden AL. 1967. West Indian species of Hymenochaete. Mycologia 59: 1034-1049.

MYCOTAXON

Volume 94, pp. 215-217 October-December 2005

A new predatory fungus from China

DONGSHEN YANG , WEIMIN CHEN , YING HUANG,
MINGHE Mo & KEQIN ZHANG

minghemo@yahoo.com.cn
Laboratory for Conservation and Utilization of Bioresources
Yunnan University, Kunming 650091, PR. China

Abstract—Dactylellina illaqueata, a new predacious fungus capturing nematode by
stalked adhesive knob in combination with non-constricting ring, is reported from
Yunnan Province, China. The fungus is characterized by its simple, unbranched
conidiophores singly bearing elongate fusiform conidia with 3-8 septa (usually 5) on
the tip.

Key words—orbiliaceous fungi, nematode-trapping fungi

While surveying predacious fungi in Yunnan Province, soil samples were collected
and spread on plates containing 2% corn meal agar medium. Nematodes (Panagrellus
redivivus) were added in the plates as bait for predacious fungi. After 20 d for incubation
at room temperature (about 20-28°C), predacious fungi were isolated under a dissecting
microscope and identified according to the taxonomic system of Scholler et al. (1999).
A new taxon, named Dactylellina illaqueata, is described here.

Dactylellina illaqueata D. S. Yang & M. H. Mo sp. nov. (Figures 1-15)

Mycelium effusum, hyphis sterilibus hyalinis, septatis, plerumquel.8-2.5 um crassis.
Conidiophoris hyalinis, septatis, erectis, simplicis, plerumque 95-250 um altis, basi 2.2-
2.6 um crassis, apicel.8-2.1 um crassis. Conidiis hyalinsi, elongato fusiformibus, apice
rotundatis, basi truncates, 3-8 septatis (plerumque 5-septatis), 25.5-117.5 um (saepe circa
66.5 um) longis, 5.5-15.2 um (saepe circa 4.8 um) crassis. Chlamydosporis in culturis
vetustioribus, globusis ad ellipsoidis.

Etymology: The species epithet refers to the species capturing nematodes by trapping
devices.
Holotype: YMF1.01846D, Simao, Yunnan, China, Oct 2005, DongSheng Yang. The

holotype and its living culture (YMF1.01846) were deposited in the Laboratory for
Conservation and Utilization of Bio-resources, Yunnan, P. R. China.

Mycelium scanty, spreading, vegetative mycelium colorless, septate, mostly 1.8-2.5
um wide. Conidiophores (Figs 1-3) colorless, erect, unbranched, often 95-250 um
high, 2.2-2.6 um wide at base, and gradually tapering upward to a width of 1.8-2.1 um

* Authors DongShen Yang and WeiMin Chen contributed equally to this work.

216

at tip, bearing a single conidium on the tip, occasionally two conidia. Conidia (Figs
4-12) colorless, elongate fusiform, narrowly obtuse at the distal end, truncate at the
base, the middle cell swelling obviously, 25.5-117.5(66.5)x5.5-15.2 (14.1) um, 3-8 septa,
mainly 5 septa. The proportion of conidia with 3,4, 5, 6, 7 and 8 septa accounts for 9.1%,
15.2%, 63.6%, 6.1%, 3.0% and 3.0%, respectively. When induced with nematodes, the
fungus produced non-constricting ring (Fig 13) and stalked adhesive knob (Fig 14).
Chlamydospores (Fig 15) spherical to ellipsoidal, intercalary.

Based on phylogenetic analysis of 18s rDNA, a new genus concept was proposed for
predatory anamorphic Orbiliaceae by Scholler et al. (1999) in which the trapping device
is the main morphological criterion for generic delimitation. In this taxonomic system,
the genus Dactylellina M. Morelet emend. M. Scholler et al. includes three species
capturing nematode by stalked adhesive knob in combination with non-constricting
ring, D. leptospora (Drechsler) M. Morelet (Drechsler, 1937), D. lysipaga (Drechsler)
M. Scholler et al. (Drechsler, 1937) and D. yunnanensis (K. Q. Zhang et al.) M. Scholler
et al. (Zhang et al. 1996). D. illaqueata described here is mainly characterized by its
5-septate conidia singly bearing on the unbranched conidiophores and this species
resembles D. yunnanensis and D. lysipaga in conidial shape. However, D. yunnanensis
usually forms short denticles on tip of conidiophores and bears 2-5 conidia, and
D. lysipaga produces the conidia mainly with 2-4 septa. In comparison with D. leptospora,
the conidia of D. illaqueata usually have a wider middle cell (average 14.1 um) than
that of D. leptospora (4.0-5.8 um). In addition, conidia of D. leptospora have more septa
(5-15) than those of D. illaqueata (3-8, mainly 5 septa).

Acknowledgments

We are very grateful to the presubmission peer reviewers Dr. ShiDong Li and Dr. XueFeng Liu. We
are also indebted to Prof. MeiHua Liu for helping with the Latin. This work was jointly supported
by the projects from Ministry of Science and Technology of P. R. China (2003CB415102), NSFC
(30460078), and Department of Science and Technology of Yunnan Province (2005NG05,
2003RC03, 2004C0001Q).

Literature Cited

Drechsler C. 1937. Some hyphomycetes that prey on free-living terricolous nematodes. Mycologia
29:447-552.

Scholler M, Hagedorn G, Rubner A. 1999. A reevaluation of predatory orbiliaceous fungi. II. A new
generic concept. Sydowia 51(1): 89-113.

Zhang KQ, Liu XZ, Cao L. 1996. Nematophagous species of Monacrosporium from China. Mycol.
Res. 100: 274-276.

217

Figs 1-15. Dactylellina illaqueata. 1-3. Conidiophores and immature conidia. 4. Immature conidia.
5-12. Mature conidia. 13. Non-constricting rings. 14. Adhesive knobs and non-constricting rings.
15. Chlamydospores. Bar=10um.

a Aes a
4 i

‘at eo $afise witsvea *Heyh bt aot Bratt rraseo- nov, ©) shits yuatet yy SLa lide
agi» ‘all i) | fee 7 arene m es: re

Ait icentace pearance tis > ae Ligue wtke oie aw esnodgotbiend 2, E +L atari) envtlrsetoo 6 [> Lagi “4
f : apt a iy A 1 ed |

MYCOTAXON

Volume 94, pp. 219-224 October-December 2005

New species of sterile crustose lichens from Australasia

JOHN A. ELIx

John. Elix@anu.edu.au
Department of Chemistry, Faculty of Science, Australian National University
Canberra, A.C.T. 0200, Australia

Abstract—Hypocenomyce isidiosa and Lepraria lobata from Australia, Leprocaulon
australasicum from Australia and Norfolk Island and Pertusaria cyathicola from
Norfolk Island are described as new to science. The species are distinguished by their
characteristic chemistries and vegetative propagules.

Key words—chromatography, morphology, taxonomy

Introduction .

Sterile crustose lichens are, in general, very poorly known although Tonsberg (1992),
made a very significant contribution to the understanding of the Norwegian species.
Like Tonsberg, I consider that the vegetative dispersal units (soredia, isidia, lobules,
phyllidia and pseudopodetia) and the presence of diagnostic lichen substances to be
important taxonomic characters. In this paper I describe four new species from Australia
and Norfolk Island.

Materials and Methods

The morphology of the lichen specimens was examined using a Zeiss Stemi 2000C
stereomicroscope, and a Zeiss Axiolab compound microscope. Chemical constituents
were identified by thin layer chromatography (Elix & Ernst-Russell 1993), high
performance liquid chromatography (Elix et al. 2003) and comparison with authentic
samples.

Taxonomic Descriptions

Hypocenomyce isidiosa Elix, sp. nov.

Similis Hypocenomyce friesii (Ach.) P. James & Gotth. Schneid. sed sterilis et superficie
dense isidiatis differt.

Etymology: The specific epithet is derived from the dense isidia characteristic of this
species.

Type: AUSTRALIA. Western Australia, Charles Gardner Flora Reserve, central track,
20 km SW of Tammin along old York Road, 31°47’24”S, 117°28°07”E, 305 m, on dead,
charred wood in Eucalyptus woodland with Casuarina and Acacia in shallow gully, J. A.
Elix 31849, 22 Apr. 2004; holo: PERTH, iso-CANB.

220

KEY CHARACTERS — Thallus lignicolous, crustose to subsquamulose, scattered granules or
squamules 0.1-1.2 mm wide, adnate, separate, not proliferating, green-brown, margin
somewhat crenulate and +upturned, squamules soon developing dense granular isidia
which dominate the thallus, soredia absent. Granular isidia globose to subglobose,
0.03-0.05 mm high, with conspicuously blackened apices, becoming coralloid and
densely crowded, forming cerebriform, conglomerate clusters, 0.5-2.0 mm _ wide.
Apothecia and pycnidia not seen. Chemistry — K-, C-, KC-, Pd-, UV+ faint white; _
containing confriesiic acid (major), friesiic acid (minor).

Distribution — At present this species is only known from the type locality in Western
Australia.

Ecology — This species is lignicolous on dead, charred Eucalyptus logs. Common
associated species include Flavoparmelia rutidota (Hook. f. & Taylor) Hale, Hertelidea
pseudobotryosa R.C. Harris et al., Hypocenomyce australis Timdal, H. foveata Timdal,
H. scalaris (Ach.) M. Choisy, Punctelia subalbicans (Stirt.) D.J. Galloway & Elix and
Thysanothecium scutellatum (Fr.) D.J. Galloway.

commMENts — Hypocenomyce isidiosa is a rare species characterized by the dominant,
black-tipped granular, globose to subglobose isidia which coalesce to form cerebriform
clusters largely obscuring the primary squamules and the presence of confriesiic and
friesiic acids as lichen substances. Friesiic and confriesiic acids are very rare depsido-
depsones so far only known from the genus Hypocenomyce (Elix et al. 2004; Timdal
1984). Both Hypocenomyce friesii and H. caradocensis (Leight. ex Nyl.) P. James & Gotth.
Schneid. contain friesiic acid (major) and confriesiic acid (minor or trace). The new
metabolite confreisiic acid shows an identical ultraviolet spectrum to freisiic acid, but
appears to be a higher homologue with standard TLC Rx values: Rp (A) 0.12; Rp (B’)
0.23; Rp (C) 0.16; standard HPLC RT=24.5 min. The present species is considered to
belong to Hypocenomyce because of the unique chemistry and substrate preference,
both of which are typical of this genus. Although common at the type locality, no fertile
material of H. isidiosa was found. The squamules of H. isidiosa resemble those of H. friesii
but are scattered and separate rather than being dense and contiguous to subimbricate.
Furthermore, H. friesii differs chemically and lacks isidia. |

Lepraria lobata Elix & Kalb, sp. nov.
Similis Lepraria jackii Tonsberg sed thallo crassiore et lobato differt.
Etymology: The specific epithet refers to the characteristic lobate margins of this
species.
Type: AUSTRALIA. Western Australia, slopes of Angwin Peak, Porongurups Range,
Porongurups National Park, 19 km ESE of Mt. Barker, 34°40’S, 117°51’E, 360 m, on

granite rocks in low sclerophyll forest with heath and numerous granite outcrops, J. A.
Elix 41327, H. T. Lumbsch & H. Streimann, 16 Sept. 1994; holo: PERTH.

KEY CHARACTERS — Thallus leprose-sorediate, granulose, whitish grey to greenish or bluish
grey, usually delimited, forming extensive, irregularly spreading patches to 10 cm wide,
or in small, irregularly roundish-colonies 0.5-1 cm wide that eventually coalesce;
often with well-defined marginal lobes, 1-2 mm wide, +raised at margins, covered

pi |

with granules, thick (up to 250 um), medulla white, distinct; hyphae 1.6-3 um thick;
soredia farinose, dispersed or forming a thick, continuous layer, troundish, 20-75 um
wide, commonly aggregated in roundish clumps (consoredia) up to a 350 um wide,
usually with short projecting hyphae to 20(-100) um long; photobiont chlorococcoid,
with individual cells 7-12 um wide. Hypothallus not apparent. Chemistry — K+
yellow, C-, Pd+ pale yellow; containing atranorin (major), zeorin (major or minor,
very rarely absent), rangiformic/jackinic acid (major) or roccellic/angardianic acid
(major), tnorrangiformic/norjackinic acid (minor or trace), +pallidic acid (minor),
+conpallidic acid (minor), +3’-demethylatranorin (trace), +3,7-di-O-methylstrepilin
(trace), +unknown dibenzofurans (minor), +fragilin (trace), +7-chloroemodin (trace),
tursolic acid (minor).

Distribution — At present this species is known from Western Australia and the
Australian Capital Territory.

Ecology — This species is corticolous on Leptospermum or muscicolous or terricolous
in sheltered rock ledges. Common associated species on terricolous substrata include
various Cladonia and Xanthoparmelia species, Buellia substellulans Zahlbr., Lecanora
farinacea Fée and Parmelia signifera Nyl., and on corticolous substrata, Candelariella
xanthostigmoides (Mill. Arg.) R. W. Rogers, Flavoparmelia rutidota, Hypogymnia
mundata (Nyl.) Rass., Parmelia pseudotenuirima Gyeln., Parmelina endoleuca (Taylor)
Hale, Parmotrema reticulatum (Taylor) M. Choisy and Usnea inermis Motyka.

comments — Lepraria lobata is a scattered species characterized by a relatively thick, grey-
white, leprose thallus which typically becomes lobate at the margins and by the presence
of atranorin, + zeorin and fatty acids as the major lichen substances. Chemically L. lobata
closely resembles L. jackii (Tonsberg 1992) in containing atranorin and fatty acids (i.e.
jackinic/rangiformic acid, norjackinic/norrangiformic acid and/or roccellic, angardianic
and toensbergianic acids) but is distinguished by usually containing high concentrations
of zeorin (L. jackii rarely contains trace amounts of zeorin). Morphologically L. lobata
differs from L. jackii in having a much thicker and compact thallus, a medullary layer
and distinct, lobate margins. Lepraria jackii is normally unstratified and lacks lobate
margins. Lepraria borealis Loht. & Tonsberg is similar to L. lobata since it forms lobed,
rosette-forming thalli with a more or less granular upper surface and contains atranorin,
rangiformic acid and +roccellic acid. However, L. borealis never contains zeorin or
pigments and the lobed margins are obscure.

SPECIMENS EXAMINED — AUSTRALIA. Australian Capital Territory, S of Paddys River near

Murrays Corner, 35°24’S, 148°57’E, 550 m, on bark of Leptospermum in thicket, J. A. Elix

647, 13 Mar. 1975 (CANB). Western Australia, Gorge Rock, c. 24 km SE of Corrigin,

32°25’S, 118°00°E, 300 m, over moss on sheltered granite ledge, K. & A. Kalb 35287, 18

Aug. 1994 (CANB; herb. Kalb).

Leprocaulon australasicum Elix, sp. nov.

Similis Leprocaulon microscopicum (Vill.) Gams ex D. Hawksw. sed superfice cinerascens
et acidum protocetraricum, acidum norsticticum et acidum salazinicum continente

differt.
Etymology: The specific epithet is derived from the distribution of this species.

LEED)

Type: NORFOLK ISLAND. Norfolk Island National Park, West Palm Glen Track,
29°01'06"S, 167°56'33”E, 140 m, on base of Cyathea in subtropical forest, J. A. Elix
29042, 16 June 1992; holo: CANB.

KEY CHARACTERS — Primary thallus crustose, arachnoid-tomentose, thin, persistent, white
to off-white or pale cream, irregularly thickening, +glabrous, becoming verruculose and
somewhat leprose-granular, granules scattered, pale orange-brown, 20-40 um wide.
Secondary thallus of numerous, pale yellow-orange to orange-brown pseudopodetia, |
pseudopodetia globose at first but then elongate-cylindrical, delicate, fragile, simple
or coralloid-branched and entangled, erect or +decumbent, 0.1-1.0 mm high, 0.1-0.15
mm thick, bearing small, leprose-arachnoid granules, 20-70 um wide, often with dense,
projecting hyphae up to 20 tm long; photobiont chlorococcoid, with individual cells 7-
10 um wide. Hypothallus not apparent. Apothecia and pycnidia unknown. Chemistry
— K+ yellow becoming dark red, C-, Pd+ orange-red; containing protocetraric acid
(major), norstictic acid (minor), salazinic acid (minor), atranorin (minor).

Distribution — At present this species is known from three localities in subtropical
rainforest in Queensland, New South Wales and Norfolk Island.

Ecology — ‘This species is corticolous on the base of Cyathea or Eucalyptus or is
lignicolous. Common associated species include various Cladonia species, Cryptothecia
bartlettii G. Thor, C. scripta G. Thor, Flavoparmelia euplecta (Stirt.) Hale, Lepraria
atrotomentosa Orange & Wolseley, L. coriensis (Hue) Sipman, Parmotrema reticulatum,
P. tinctorum (Nyl.) Hale, and Pseudocyphellaria poculifera (Mull. Arg.) D.J. Galloway &
P. James.

comments — Leprocaulon australasicum is a scattered species characterized by the
conspicuous, pale yellow-orange to orange-brown pseudopodetia and the presence
of protocetraric, salazinic and norstictic acids as the major lichen substances.
Morphologically L. australasicum resembles L. microscopicum but the latter species
differs in having a blue-green to yellow-grey upper surface with white pseudopodetia
and in containing usnic acid, zeorin, +atranorin, +rangiformic acid (Lamb & Ward
1974). Furthermore, L. microscopicum grows on thin soil in rock crevices, peaty soils
and only very rarely on the base of aged trees rather than predominantly on corticolous
or lignicolous substrata.

SPECIMENS EXAMINED — AUSTRALIA. Queensland, Noosa Heads, Noosa National Park,
along the Noosa Hill Track, 26°23’S, 153°06°E, 30 m, on base of Eucalyptus in coastal
rainforest, J. A. Elix 10369, 31 July 1982 (CANB). New South Wales, Andersons Hill
Road, Conglomerate State Forest, 21 km NW of Coffs Harbour, 30°04’S, 153°05’E, 240 m,
on shaded rotting log in subtropical forest, H. Streimann 60554, 19 April 1998 (CANB).
NORFOLK ISLAND. Norfolk Island National Park, track between Mt Pitt and Mt
Bates, 29°00°50"S, 167°56'05”E, 270 m, on dead Cyathea in disturbed subtropical forest,
J. A. Elix 27367, 15 June 1992 (B, CANB, NY); Norfolk Island National Park, West Palm
Glen Track, 29°01°06"S, 167°56'33”E, 140 m, on base of Cyathea in subtropical forest,
J. A. Elix 29042, 16 June 1992 (CANB); Pop Rock, near Mount Pitt Road, 29°01’23”S,
167°56'10”E, on dead Cupressus in disturbed subtropical forest, J. A. Elix 29293, 18 June
1992 (CANB); Norfolk Island National Park, Mount Pitt Road, 29°01’S, 167°56’E, 300
m, on treelet stem in disturbed subtropical forest, H. Streimann 34843, 10 Dec. 1984 (B,
CANB).

223

Pertusaria cyathicola Elix, sp. nov.

Similis Pertusaria erythrella Muill. Arg. sed arthothelinum et thuringionum continente
differt.

Etymology: The specific epithet derives from Cyathea and the Latin cola (dweller) in
reference to the substrate of the holotype.

Type: NORFOLK ISLAND. Norfolk Island National Park, West Palm Glen Track,

29°01’06"S, 167°56’33"E, 140 m, on base of Cyathea in subtropical forest, J. A. Elix
29043, 16 June 1992; holo: CANB.

KEY CHARACTERS — Thallus crustose, off-white to pale greyish white, slightly cracked
and areolate, surface slightly wrinkled and dull, verruculose, soon developing soredia,
lacking isidia. Soralia yellow to yellow-orange, numerous, conspicuous, disc-like or
sub-hemispherical, often constricted at the base, 0.5-2 mm diam., soredia farinose.
Apothecia and pycnidia unknown. Chemistry — stictic acid (major), constictic acid
(minor), arthothelin (minor), thuringione (minor), 3-O-methylthiophanic acid (trace),
peristictic acid (trace), substictic acid (trace), hypostictic acid (trace), novostictic acid
(trace).

Distribution — At present this species is only known from the type locality on Norfolk
Island.

Ecology — This species is corticolous on Cyathea. Common associated species include
various Cladonia species, Cryptothecia bartlettii, Flavoparmelia euplecta, Lepraria
atrotomentosa, L. coriensis, Leprocaulon australasicum, Parmotrema reticulatum, P.
tinctorum and Pseudocyphellaria poculifera.

comments — Pertusaria cyathicola is a rare species characterized by the conspicuous
yellow to yellow-orange soralia and the presence of arthothelin, thuringione, stictic
acid and constictic acid as the major lichen substances. Although no fertile specimens
have been seen, this species has typical pertusarioid chemistry comprising the stictic
acid chemosyndrome and xanthones. Morphologically P. cyathicola closely resembles
Pertusaria erythrella but the latter species has white soralia and contains lichexanthone
and the norstictic acid chemosyndrome (Archer 1997).

Acknowledgements

I thank Dr Alan W. Archer and Dr Patrick M. McCarthy for helpful discussions and amendments
to the draft manuscript.

Literature Cited

Archer AW. 1997. The lichen genus Pertusaria in Australia. Bibliotheca Lichenologica 69: 1-249.

Elix JA, Ernst-Russell KD. 1993. A catalogue of standardized thin layer chromatographic data and
biosynthetic relationships for lichen substances (2™ Edition). Australian National University,
Canberra.

Elix JA, Giralt M, Wardlaw JH. 2003. New chloro-depsides from the lichen Dimelaena radiata.
Bibliotheca Lichenologica 86: 1-7.

Elix JA, Tonsberg T, Wardlaw JH. 2004. The structure of friesiic acid, a novel lichen substance from
Hypocenomyce friesii. Bibliotheca Lichenologica 88: 103-104.

224

Lamb, IM & Ward, A. 1974. A preliminary conspectus of the species attributed to the imperfect
lichen genus Leprocaulon Nyl. Journal of the Hattori Botanical Laboratory 38: 499-553.

Timdal E. 1984. The genus Hypocenomyce (Lecanolales, Lecideaceae), with special emphasis on the
Norwegian and Swedish species. Nordic Journal of Botany 4: 83-108.

Tonsberg T. 1992. The sorediate and isidiate, corticolous crustose lichens in Norway. Sommerfeldtia

14: 1-331.

MYCOTAAON

Volume 94, pp. 225-230 October-December 2005

Some interesting pyrenomycetous fungi on bark of Quercus spp.
from Spain

JULIA CHECA & M.N. BLANCO

julia.checa@uah.es, natividad.blanco@uah.es

Dpto. Biologia Vegetal. Univ
Alcald de Henares. 28871 Alcala de Henares, Madrid. Spain

Abstract—Four species of pyrenomycetous fungi (Decaisnella mediterranea, Decaisnella
mesascium, Ostreichnion nova-caesariense and Rosellinia tassiana) growing on bark of
Quercus spp were studied.

Keywords—Pyrenulales, Ascomycota

introduction

During the study of pyrenomycetous fungi from the National Park of Cabafieros (Ciudad
Real, Spain), the bark of Quercus spp. has been demonstrated as a very good substrate
for the development of this kind of fungus.

This National Park is located in the centre of Spain and has one of the best representations
of Mediterranean flora on the Iberian Peninsula. Here, there are forests of Quercus
faginea Lam., Q. ilex ssp. ballota (Desf.) Samp., Q. suber L. and Q. pyrenaica Willd.,
accompanied by Arbutus unedo L., heaths and others shrubs. We have compared this
area with a holm oak wood situated in Retiendas (Guadalajara, Spain) and found that
both places share some interesting species, which are new records for Spain or Europe.

This paper deals with four species [Decaisnella mediterranea, Decaisnella mesascium,
Ostreichnion nova-caesariense and Rosellinia tassiana] and provides new data on their
areas and habitats.

Descriptions

Decaisnella mediterranea Checa & M.N.Blanco, Mycotaxon 91:353 (2005)

SPECIMENS EXAMINED— SPAIN: Ciudad Real NATIONAL PARK OF CABANEROS: ‘EL
CARACOL’, 30.V.2003, bark of Quercus faginea, leg. J. Checa & M.N. Blanco, AH 32203
(rypus). 30.1V.2004, AH 33904 (PARATYPUS). ‘EL LABRADILLO, 30.IV.2004, bark of
Quercus ilex ssp. ballota, leg. J. Checa & M.N. Blanco, AH 34188, 34186.

Comments- The genus Decaisnella Fabre was reinstated by Barr (1979) who recognized
two series of species on the basis of ascospore shape (Barr 1986).

226

D. mediterranea with fusiform ascospores, (12)-15-(17) transversal septa and 1-(2)
longitunal septa, was described by us (Checa & Blanco 2005). It was found on Quercus
faginea in the National Park of Cabafieros, and now we add other collections from
Quercus ilex ssp. ballota in the same area.

Decaisnella mesascium (De Not.) M.E. Barr, N. Amer. Flora, Ser. 2, 13: 80 (1990)
FIGURE 1, A-B

Ascomata scattered or clustered, Gare to superficial, 0,5-1 mm diam., globose,
papilla rounded, periphysate.

Asci clavate, with 8 biseriate ascospores, 185-215 x 35-40 um; pseudoparaphyses

trabeculate, 2 um diam.; ascospores ellipsoid, 53-60-(64) x 17-22 um, brown with pallid

ends, verruculose, with 7-15 transverse septa and 2-3 longitudinal septa.
SPECIMENS EXAMINED— SPAIN: Ciudad Real NATIONAL PARK OF CABANEROS: ARROYO
BREZOSO, 21.X1.2003, bark of Quercus faginea, leg. J. Checa & M.N. Blanco, AH 342224,
34225. ibid. bark of Quercus pyrenaica, AH 34235. “ARROYO MENGUADOS, 30.IV.2004,
bark of Quercus faginea, leg. J. Checa & M.N. Blanco, AH 34202. ‘EL CARACOL, 8.X1.03,
bark of Quercus faginea, leg. J. Checa & M.N. Blanco, AH 34223, 30.1V.2004, AH 34210,
34226. ‘EL LABRADILLO, 30.1V.2004, bark of Quercus ilex ssp. ballota, leg. J. Checa &
M.N. Blanco, AH 34187

Comments- Barr (1990) included D. mesascium in the group having oblong or ellipsoid
ascospores with rounded or obtuse ends.

Although this species has been demonstrated to be very common on bark of Quercus
spp., this is the first record in Mediterranean area; it seems to be chiefly European as
Barr (1990) suggested.

Ostreichnion nova-caesariense (Ellis) M.E.Barr, Mycotaxon 3:84 (1975).
FIGURE 1, C-E

Ascomata scattered, superficial, boat-like, 0,8-1,2 x 0,5-0,7 mm, with a longitudinal line
of dehiscence.

Asci clavate, with 8 biseriate ascospores, 120-130 x 30-35 um.; pseudoparaphyses
trabeculate, in gel matrix; ascospores ellipsoid, 35-40 x 13-15 um, sometimes constricted
at the primary septum, 7-8-(13) transversal septa, Y-formed in the end cells and 1-3
longitudinal septa, brown, smooth or finely verruculose.
SPECIMENS EXAMINED— SPAIN: Ciudad Real NATIONAL PARK OF CABANEROS: ‘ARROYO
BREZOSO, 21.X1.2003, bark of Quercus faginea, leg. J. Checa & M.N. Blanco, AH 34236,
34237. “EL CARACOL, 30.V.2003, bark of Quercus faginea, leg. J. Checa & M.N. Blanco,
AH 32201, 32202. 8.X1.2003, leg. J. Checa & M.N. Blanco, AH 34238. 30.1V.2004, AH
34203, 34205, 34244, 34248. 5-XI-2004, AH 34213. “LAGUNA DE LOS CUATRO MORROS,
5.X1.2004, bark of Quercus faginea, leg. J. Checa & M.N. Blanco, AH 34212.

Comments- The genus Ostreichnion Duby is characterized by the conchate ascomata
and muriform ascospores. It was created for two species, O. europaeum Duby and O.
americanum Duby, the first one is a synonym of Hysterium pulicare Pers. and the second

IAG

FIGURE L.- A, B Decaisnella mesascium, (AH 34223). A.- pseudothecia. B.-Mature ascospores. C-E.-

ariense (AH 34213). C.- hysterothecia. D.- Ascus. E.- Ascospores.
Scale bars. A,C- = 0,5 mm. B, D, E= 10 um.

Ostreichnion nova-caes

228

considered to be the same as O. sassafras (Schwein.) M.E.Barr. At present it includes three
species: O. curtisii (Duby) M.E.Barr, O. nova-caesariense and O. sassafras (Barr 1975,
1990). These species have been treated in different genera of the Hysteriaceae, but the
morphology of ascomata and ascospores justifies their inclusion in the Mytilinidiaceae.

O. nova-caesariense was regarded as a synonym of Hysterographium flexuosum (Schwein.)
Sacc. (Zogg 1962), however there are some differences between the two genera. The
conchate ascocarps, prosenchymatous peridium and trabeculate pseudoparaphyses
characterize O. nova-caesariense as a member of the Mytilinidiaceae.

Barr (1990) indicated the bark of Pinus rigida as the substrate for this species, known
only from type locality. We add some collections from Quercus faginea that provide a
wider habitat and distribution of it. Probably, the substrate is not too important to this
saprotrophic fungus (Barr, com. pers.).

Rosellinia tassiana Ces. & De Not., Comm. Soc. crittog. Ital. 1(4): 227 (1863)
FIGURE 2

Stromata scattered or clustered in groups of two or three from a common base,
superficial, black, 1-1,5 mm diam., 2-2,5 mm long, subglobose, surface warty, with one
papillate perithecium, 800-900 um diam; ectostroma black, entostroma white.

Asci cylindric, 250-280 x 18-20 um with 8 uniseriate ascospores; paraphyses 4-5 um
diam.; ascospores ellipsoid to ovoid, 30-37-(49) x 12-15 um, dark brown, germ slit
nearly spore length, straight, without appendages.

Cultures: Monosporic cultures were made in PDA, but they produced only sterile
mycelium not the anamorph state.
SPECIMENS EXAMINED— SPAIN: Ciudad Real NATIONAL PARK OF CABANEROS: ‘ARROYO
BREZOSO, 6.X1.2004, bark of Quercus ilex ssp. ballota, leg. J. Checa & M.N. Blanco, AH
34211. Guadalajara, RETIENDAS: 30.1.2003, bark of Quercus ilex ssp. ballota, leg. J. Checa
& M.N. Blanco, AH 35129. 12.11.2003, AH 35125, 35126, 35127, 35128.

Comments- This species commonly grows on Quercus spp., but until now it was only
known from Italy (Petrini 1993). This author considered R. tassiana to be related to
uniperitheciate Xylaria or Kretzschmaria species and excluded it from Rosellinia.

The anamorph state is not known and our cultures from ascospores in PDA and MEA
only produced sterile mycelium.

Acknowledgements

We want to express our gratitude to Dr. Margaret Barr and Dr. Larissa Vasilyeva for revision and
expert criticism on the manuscript, and to the Project REN2002-01965.

FIGURE 2.- Rosellinia tassiana (AH 35127 ) A, B.- Stromata. C.- longitudinal section of stroma.
D.- Ascus. E.- Ascus apex. E- Ascospores. G, H.- cultures; G- obverse; H- reverse.
Scale bars. A-C = 0,5 mm. D-E 35 um. F = 15 um. G-H =2 cm.

229

230

Literature Cited

Barr ME. 1975. The genus Ostreichnion. Mycotaxon 3(1): 81-88.

Barr ME. 1979. A classification of Loculoascomycetes. Mycologia 71: 935-957.

Barr ME. 1986. On Julella, Decalourea, and Decaisnella, three dictyosporous genera described by
J.H. Fabre. Sydowia 38:11-19.

Barr ME .1990. Melanommatales (Loculoascomycetes). North American Flora 2(3) : 1-129.

Checa, J. & M.N. Blanco. 2005. Decaisnella mediterranea, a new species on Quercus faginea from
Spain. Mycotaxon 91:353-355.

Petrini 1993. Rosellinia species of the temperate zones. Sydowia 44:169-281.

Zogg, H. (1962). Die Hysteriaceae s. str. und Lophiaceae. Beitr. Kryptogamenfl. Schweiz. 11(3):1-
190.

MYCOTAXON

Volume 94, pp. 231-234 October-December 2005

Biogeography and hosts of poroid wood decay fungi in
North Carolina: species of Fomes, Fomitopsis, Fomitella
and Ganoderma

L.E GRAND & C.S. VERNIA

larry_grand@ncsu.edu
Department of Plant Pathology, North Carolina State University
Raleigh, North Carolina 27695-7616 USA

Abstract—Distribution and host species are given for two species of Fomes, one species
of Fomitella, four species of Fomitopsis and five species of Ganoderma. A county
distribution map is provided for eight species. Numerous new fungus-host plant
associations are reported. Species checklist and figures can also be accessed at:
http://www.cals.ncsu.edu/plantpath/people/faculty/grand/mycotaxon_4.pdf.

Key words—fungus distribution, polypores

Introduction

The importance of biodiversity and biogeography of fungi, especially in unique
ecosystems and specific regions, was previously addressed by Grand & Vernia (2004ab,
2005). Studies by Jung (1987), Vernia & Grand (2000) and Grand & Vernia (2002,
2003) reported on the occurrence of host plants of poroid wood decay fungi in North
Carolina. The distribution and host plants in North Carolina of species of Phellinus and
Schizopora (Grand & Vernia 2004a), Ceriporia, Ceriporiopsis and Perenniporia (Grand
& Vernia 2004b) and Coltricia, Coltriciella and Inonotus (Grand & Vernia 2005) were
previously addressed. This report is the fourth in a continuing study of poroid wood-
decay fungi in North Carolina and deals with species of Fomes, Fomitella, Fomitopsis
and Ganoderma.

Materials and methods

Poroid wood-decay fungi were intensively collected in North Carolina over the past eight
years (1997-2004). Collections, housed in the Mycological Herbarium, Department
of Plant Pathology, North Carolina State University (NCSC), and records of the Plant
Disease and Insect Clinic, Department of Plant Pathology, NCSU, were utilized in the
results. Previous studies (Grand et al. 1975, Jung 1987) that contained data on county
distributions were used in developing the distribution maps. Similarly, data from the
BPI website (Farr et al. n.d.) provided some county data.

Collections were made of all species of Fomes, Fomitella, Fomitopsis and Ganoderma
species on unusual hosts. Specimens were placed in paper bags in the field with a sample
of decayed wood with most collections and field notes for all collections. Specimens

232

were examined in the laboratory and identified using existing taxonomic treatments
(Gilbertson & Ryvarden 1986, Jung 1987, Overholts 1953).

Nomenclature and authorities are from Gilbertson & Ryvarden (1986) and Index
Fungorum (CABI Biosciences et al.) for the fungi and Kartesz (1994) for the host plant
species.

The majority of collection sites were in state parks, gamelands and natural areas,
Nantahala, Pisgah, Croatan and Uwharrie National Forests, the Blue Ridge Parkway and
the Great Smoky Mountains National Park. A county distribution map is provided for
all species that were recorded in three or more counties (Figs. 1-8).

Results and discussion

Fomes fomentarius (L. : Fr.) J. Kickx f. (Fig. 2) was found on six host species in 12 western
counties, all in the Blue Ridge Mountains of the Southern Appalachian Mountain chain.
Fomes fasciatus (Sw. : Fr.) Cooke (Fig. 1), a species with a distribution in the southern
United States (Gilbertson & Ryvarden 1986), was collected for the first time in North
Carolina, in three counties in the Coastal Plain and southern Piedmont regions. It appears
that E fomentarius reaches its southernmost distribution in the southern mountains of
North Carolina and Tennessee and that FE fasciatus reaches its northernmost distribution
in southern North Carolina.

Fomitopsis cajanderi (P. Karst.) Kotl. & Pouzar (Fig. 3) was found in 15 counties in
the Blue Ridge Mountains and Piedmont regions and was recorded on five host species.
Fomitopsis pinicola (Sw. : Fr.) P. Karst. (Fig. 4) was found in eight counties in the Blue
Ridge Mountain region of western North Carolina.

Fomitella supina (Sw. : Fr.) Murrill, Fomitopsis durescens (Overh. ex J. Lowe) Gilb.
& Ryvarden and Fomitopsis spraguei (Berk. & M.A. Curtis) Gilb. & Ryvarden were not
collected frequently enough to determine any distributional patterns.

Five species of Ganoderma were recorded in this study. Ganoderma applanatum
(Pers.) Pat. (Fig. 5) was found in 19 counties on 22 host species. G. applanatum is
primarily distributed in the Blue Ridge Mountains of western North Carolina but
collections were made in the eastern Piedmont and northern Coastal Plain regions as
well. Ganoderma tsugae Murrill (Fig. 8), which is primarily found on Tsuga canadensis
Carriére in North Carolina, was also found on Abies fraseri (Pursh) Poir. and Pinus
pungens Lamb. Tsuga caroliniana Engelm. is most likely a host as well. Dead, needleless
trees of T. caroliniana are difficult to distinguish from T. canadensis. Ganoderma tsugae
is distributed in nine counties in the Blue Ridge Mountains in western North Carolina
with a single report from a disjunct population of T: canadensis in the Piedmont.

Ganoderma lucidum (Curtis : Fr.) P. Karst. (sensu lato) is morphologically variable
(Gilbertson & Ryvarden 1986) and considered by most taxonomists to be a species
complex. With the exception of Ganoderma curtisii (Berk.) Murrill, G. lucidum was
considered in the broad species concept in this study. G. lucidum (Fig. 7) is widely
distributed in North Carolina and was found in 29 counties on 29 host species. The
species concept of G. curtisii in this study was limited to those basidiocarps with a well-
developed stipe, eccentric pileus and typically forming from underground roots near
stumps. G. curtisti (Fig. 6) is widely distributed in North Carolina and was found in 11
counties on 14 host species.

Fig. 1. Distribution of Fomes fasciatus

in North Carolina.

Cee
feee\

225

ee 1
oh ern’ f
gy ¥ Seba
Ahern a ae re
nt) 5 e mee)
iis

Dro
7s in ;

S
ae

Fig. 2. Distribution of F. fomentarius
in North Carolina.

Fig. 3. Distribution of Fomitopsis cajanderi

in North Carolina.

Fig. 4. Distribution of E pinicola
in North Carolina.

Fig. 5. Distribution of Ganoderma applanatum
in North Carolina.

Fig. 6. Distribution of G. curtisii
in North Carolina.

Fig. 7. Distribution of G. lucidum
in North Carolina.

Fig. 8. Distribution of G. tsugae
in North Carolina.

234

Acknowledgements

The authors thank Drs. Richard Baird and Lauraine Hawkins for suggestions and comments that
improved the manuscript. Financial support for this project was provided, in part, by generous
grants from the Highlands Biological Station (Highlands, NC). A special thanks to Tom Howard
and the staff of the North Carolina State Parks system for permission to collect in the parks and
natural areas of North Carolina. Richard Giles provided additional collections. Michael J. Munster
assisted in the preparation of the manuscript.

Literature cited

Farr DF, Rossman AY, Palm ME, McCray EB. (n.d.) Fungal Databases, Systematic Botany &
Mycology Laboratory, ARS, USDA [http://nt.ars-grin.gov/fungaldatabases/ (accessed on 04
October 2003)]

CABI Biosciences, Centraalbureau voor Schimmelcultures, Landcare Research (custodians). (n.d.)
Index Fungorum [http://www.indexfungorum.org (accessed on 17 January 2006)].

Gilbertson RL, Ryvarden L. 1986. North American Polypores. Vol. 1. Abortiporus - Lindtneria.
Fungiflora, Oslo. Pp. 1-433.

Grand LE, Menge JA, Bond JJ. 1975. Partial checklist of fungi from Highlands, North Carolina and
vicinity. J. Elisha Mitchell Sci. Soc. 91:221-229.

Grand LF, Vernia CS. 2002. New taxa and hosts of poroid wood-decay fungi in North Carolina.
Castanea 67:193-200.

Grand LF, Vernia CS. 2003. Noteworthy Collections, North Carolina, Cryptoporus volvatus (Peck)
Shear. Castanea 68:88-89.

Grand LE, Vernia CS. 2004a. Biogeography and hosts of poroid wood decay fungi in North Carolina:
species of Phellinus and Schizopora. Mycotaxon 89:181-184.

Grand LE, Vernia CS. 2004b. Biogeography and hosts of poroid wood decay fungi in North Carolina:
species of Ceriporia, Ceriporiopsis and Perenniporia. Mycotaxon 90:307-310.

Grand LF, Vernia CS. 2005. Biogeography and hosts of poroid wood decay fungi in North Carolina:
species of Coltricia, Coltriciella and Inonotus. Mycotaxon 91:35-38.

Jung HS. 1987. Wood-rotting Aphyllophorales of the southern Appalachian spruce-fir forest. Bibl.
Mycol. 119:1-260.

Kartesz JT. 1994. A synonymized checklist of the vascular flora of the United States, Canada, and
Greenland. Second Edition. Volume 1—Checklist. Timber Press, Portland, Oregon. 622 pp. ~

Overholts LO. 1953. The Polyporaceae of the United States, Alaska and Canada. University of
Michigan Press, Ann Arbor. 466 pp.

Vernia CS, Grand LF. 2000. Polypores of a North Carolina Piedmont forest. Mycotaxon
74; 153-159.

———

Volume 94, pp. 235-240 October-December 2005

Two new species of Ramaria from southwestern China

PING ZHANG

zhangping0000@163.net
College of Life Science, Hunan Normal University
Changsha 410081, Hunan Province, P. R. China

ZHU-LIANG YANG

fungi@mail.kib.ac.cn
Kunming Institute of Botany, Chinese Academy of Sciences
Kunming 650204, Yunnan Province, P. R. China

ZAI-WEI GE

zwge@mail.kib.ac.cn
Kunming Institute of Botany, Chinese Academy of Sciences
Kunming 650204, Yunnan Province, P. R. China

Abstract—Two new species of the genus Ramaria collected from southwestern China are
described and illustrated. They are Ramaria luteoaeruginea and Ramaria pallidolilacina.
The former belongs to subgenus Echinoramaria while the latter to subgenus Laeticolora.
Discussions on these two species and their affinities are furnished. The holotypes are
deposited in the Cryptogamic Herbarium of Kunming Institute of Botany, the Chinese
Academy of Sciences (HKAS).

Key words—clavarioid fungi, taxonomy

Introduction

Southwestern China, including Yunnan, Sichuan, Tibet and Guizhou, is rich in taxa of
Ramaria Fr. ex Bonord. Several new species have been discovered and reported from
this area previously (Petersen 1987a; Petersen & Zang 1986, 1989, 1990). While studying
the Ramaria samples collected from the region, the authors have recently found two
additional new species. They are reported herein.

Microscopic examinations were made with bright field and phase contrast optics.
Measurements of spores were made in 5% KOH solution. The abbreviation [n/m/p] shall
mean n basidiospores measured from m basidiocarps of p collections. Dimensions for
basidiospores are given with notation of the form (a)b-c(d). The range b-c contains
a minimum of 90% of the measured values. Extreme values, i.e., a or d, are given in
parentheses. Q is used to mean ‘length/width ratio’ of a basidiospore in side view; Q
means average Q of all basidiospores + sample standard deviation. For demonstration

236

of spore ornamentation, aniline blue (cotton blue) staining was used following the
method described by Kotlaba & Pouzar (1964). Color codes of the form “3B3” are from
Kornerup & Wanscher (1981); Color names with first letter capitalized (e.g., Cream
Color) are from Ridgway (1912).

Taxonomy

1. Ramaria luteoaeruginea P. Zhang & Zhu L. Yang, sp. nov. Figs. 1-4 —
Basidioma ramosum, ad 7 x 5 cm, obovatum ad obconicum;stipite ad 3 x 3 cm, crasso,
singulari, albo, interdum aeruginescenti, cum ramulis abortivis, carne alba, non-
gelatinosa; ramis crassis, luteis; apicibus acutis ad digitatis, aerugineis; basidiis 55—70 x
7-9 um, clavatis, 4—sporigeris; sporis (9.5—) 10.5—12.5 (—13.0) x (4.5—) 5.0-6.0 (—6.5)
um, ellipsoideis vel elongato-lacrymiformibus, subechinatis. Fibulae praesentes.
Holotype: Zhu L. Yang 4314 (HKAS 45693), 7. VIII. 2004, Changdu, Tibet, China.

Etymology: Referring to the colors of the yellow branches and more or less green
apices.

Basidioma (Fig. 1) up to 7 cm high, up to 5 cm broad, repeatedly branched, usually
obovate to obconic in outline. Stipe up to 3 x 3 cm, single or falsely fasciculate, smooth
upward, tapering gradually downward into a tangle of white mycelia and slender
rhizomorphs involving significant amounts of substrata, white [1A1], unchanging on
drying, staining locally to intense verdigris [25C4-6, Montpellier Green, Light Porcelain
Green] when fresh, remaining so after drying, with a few abortive stumps high on stipe;
flesh white, solid, not gelatinous or slippery, dried flesh firm but easily penetrated. Major
branches 4—6, stout, more or less terete, ascending, white below, upward concolorous
with upper branches. Branches 4—5 ranks, ascending, polychotomous, longitudinally
rugose; internodes diminishing gradually upward, buff-yellow [3A2-6, Straw Yellow,
Warm Buff] below, gradually concolorous with apices; axils more or less rounded. Apices
1—2 mm long, acute to finger-like, dull blue-green [29D4-7, Dark Dull Yellow-Green].
Taste and odor, and macrochemical reactions not recorded.

Stipe tramal hyphae 2—8 um wide, hyaline, thin-walled (wall up to 0.5 um thick), parallel,
clamped; ampulliform clamps occasional; gloeoplerous hyphae not observed. Tramal
hyphae of upper branches 2-15 um wide, hyaline, thin-walled, loosely parallel, clamped;
ampulliform clamps occasional, up to 10 um broad, thin-walled. Hyphae of basal mat
1.5-3.0 um diam, thin-walled, clamped; stellate crystalline material (Fig. 4) often
found between hyphae. Subhymenium rudimentary, hyphal. Hymenium thickening.
Basidia (Fig. 2) 55-70 (—80) x 7-9 um, clavate, clamped; contents homogeneous when
young, becoming multiguttulate when mature, hyaline or slightly yellowish, slightly
cyanophilous, 4-spored; sterigmata 4—6 um long.

Basidiospores (Fig. 3) [40/2/1] (9.5—) 10.5-12.5 (-—13.0) x (4.5—) 5.0-6.0 (—6.5) um [Q
= (1.90-—) 2.00-2.36 (—2.40), Q = 2.19 + 0.14], elongate pip-shaped, with apex mostly
rounded, sometimes somewhat attenuate, with a distinct suprahilar depression, yellow-
ocher under bright field; wall slightly thickened (up to 0.5 um thick), moderately
cyanophilous; apiculus not conspicuous, eccentric; ornamentation of numerous,
scattered, strongly cyanophilius warts or obtuse spines up to 1 um long.

2D7,

Q00/P

Figs. 1-4: Ramaria luteoaeruginea (HKAS 45693, holotype).

1. Basidioma; 2. hymenium; 3. Basidiospores; 4. Crystal from basal mat.

Habitat: Gregarious on humus under Picea.
Known distribution: Only known from the type locality.

Notes: Ramaria luteoaeruginea is characterized by its stocky fruitbodies naturally
staining blue-green both on stipes and apices in the field even without bruising, middle
size spores [i.e., larger than those of R. abietina (Pers.: Fr.) Quél., but smaller than those
of R. grandis (Peck) Corner], and subspinous spore ornamentation. It is a member of
Ramaria subgenus Echinoramaria Corner (Corner 1950; Petersen 1981).

Ramaria luteoaeruginea is similar to R. echinovirens Corner et al., R. glaucoaromatica
R.H. Petersen and R. ochrochlora Furrer-Ziogas & Schild. However, R. echinovirens,
described from the Indian Himalayas, has orange yellow apices and was collected under
Quercus. Ramaria glaucoaromatica, originally described from the Rockies, United States,
can be separated from R. luteoaeruginea on its dull ocher apices and smaller spores
(Petersen 1981). Ramaria ochrochlora, from the Alps in Switzerland, is distinguished
from R. luteoaeruginea by its greenish yellow apices and smaller spores (Petersen 1981;

Schild 1971).

These four species appear to be very closely related in having stocky fruitbodies,
virescent color reactions and spinous or warty spores, and tending to occur in high
elevation areas.

Singh (1977) reported a taxon from India, which is quite similar to R. luteoaeruginea.
Branch tips of the specimens were noted as green. He identified the specimens as R.
ochrochlora. The identification was dubious, because R. ochrochlora stained green only
at the base, rather then on tips.

238

2. Ramaria pallidolilacina P. Zhang & Z. W. Ge, sp. nov. Figs. 5-7
Basidioma ramosum, ad 13 x 10 cm, obovatum ad subglobosum; stipite ad 3 x 2 cm,
attenuato, singulari, albo ad cremeo, carne alba, non-gelatinosa; ramis pallide lilacinis,
subrugulosis vel rugulosis, apicibus scopiformibus vel brevi-digitatis, cum ramulis concoloris;
basidiis 60-85 x 9-11 um, clavatis, 4-sporigeris; sporis (10.0—) 10.5—13.0 (—14.0) x (4.5—)
5.0-6.0 (—7.0) um, ellipsoideis, irregulariter verruculosis. Fibulae absentes.

Holotype: Z. W. Ge 332 (HKAS 46112), 11. VIII. 2004, Leiwugi, Tibet, China.
Etymology: Referring to the color of the branches.

Basidioma (Fig. 5) up to 13 cm high, up to 10 cm broad, repeatedly branched, usually
obovate to subcircular in profile. Stipe up to 3 x 2 cm, single, tapering gradually
downward, tomentose at base, smooth upward, without abortive branches, white to
cream [1A1, 2A2], not changing color on bruising; flesh white, solid, not gelatinous or
slippery. Major branches 4—6, stout, up to 1 cm thick, ascending, concolorous to branches
above. Branches 4—5 ranks, ascending, more or less rugulose, polychotomous, pallid lilac
[15A2-3; Light Vinaceous-Gray, Pale Light Vinaceous-Purple], slowly becoming purple-
gray [14A2; Vinaceous-Gray] with spore deposit; internodes diminishing gradually
upwards; axils more or less rounded. Apices obtuse, rather crowded, 0.5—-1 mm long,
molar-like when young, broom-form or short-digitate by maturity, concolorous with
the branches. Taste and odor, and macrochemical reactions not recorded.

Tramal hyphae of stipe 3-15 um wide, hyaline, thin-walled, clampless, interwoven;
ampulliform septa and gloeoplerous hyphae not observed. Tramal hyphae of upper
branches 3-10 um wide, hyaline, thin-walled, loosely parallel, clampless; gloeoplerous
hyphae not observed. Subhymenium rudimentary, hyphal. Hymenium unthickening.
Basidia (Fig. 6) 60-85 x 9-11 um, clavate, clampless, cyanophilous, 4-spored; sterigmata
6-8 um long.

Basidiospores (Fig. 7) [60/2/2] (10.0—) 10.5—13.0 (—14.0) x (4.5—) 5.0-6.0 (—7.0) um [Q
= (1.62—) 1.85—2.40 (—2.60), Q = 2.14 + 0.20], ellipsoid, more or less flattened adaxially,
roughened in profile; wall up to 0.5 um thick, cyanophilous; hilar appendix prominent;
ornamentation of prominent, discrete, low warts and short ridges randomly placed.

Habitat: Solitary on soil in Picea forest.
Known distribution: Only known from southwestern China.

Additional material examined: CHINA, Tibet, Jiangda County, near Tongpu village, alt.
3300m, 2-VIII-2004, Z. W. Ge 260 (HKAS 46040).

Notes: Ramaria pallidolilacina is characterized by its pallid lilac branches and apices,
relatively small, white, tapering stipe, clampless basidia and coarsely ornamented spores.
It belongs to Ramaria subgenus Laeticolora Marr & D. E. Stuntz (Marr & Stuntz 1973;
Petersen 1987a, 1987b; Petersen & Zang 1989, 1990).

A group of taxa within Ramaria subgenus Laeticolora with lilac, violet or purple
coloration has been described previously (Petersen 1987b). Several species included in
this group such as R. asiatica (R.H. Petersen & M. Zang) R.H. Petersen, R. cedretorum
(Maire) Malencon, R. fennica (P. Karst.) Ricken, R. himalayensis R.H. Petersen, R.
purpurissima R.H. Petersen & Scates, R. versatilis Quél., can be easily separated from R.
pallidolilacina by producing clamped basidia. Although R. pallida (Schaeff.) Ricken (=

29.

10um

Figs. 5-7: Ramaria pallidolilacina (HKAS 46112, holotype).

5. Basidioma; 6. hymenium; 7. Basidiospores.

R. mairei Donk) is a clampless species with purplish fruitbodies, its purple tints exhibit
only at the apices. Furthermore, its stipe is more conspicuous than R. pallidolilacina
(Petersen 1974). Ramaria spinulosa (Pers.: Fr.) Quél., reported from Europe and North
America, with purple tinged fruitbody and clampless basidia, is also similar to R.
pallidolilacina. But the former differs from the latter by its unique cinnamon tan stipe
surface and pale beige stipe flesh (Petersen 1985; Schild 1990). Ramaria subspinulosa
(Coker) Corner has smaller spores, and a tinge of lavender appearing only on the upper
part of fruitbody when young (Coker 1923; Corner 1950; Petersen 1987b). Ramaria
fumosiavellanea Marr & D. E. Stuntz, originally described from North America, with
violet color component and clampless basidia, is distinguished from R. pallidolilacina
by its darker (15-18D3) branches with grayish orange (5B3) apices and less ornamented
spores (Marr & Stuntz 1973).

Acknowledgements

‘The first author is very grateful to Dr. R.H. Petersen, Tennessee, and Mr. E. Schild, Brienz, for
their valuable published data on Ramaria. The authors thank Dr. R.H. Petersen and Dr. T-H. Li,
Guangzhou, for their critical reviewing the manuscript. Dr. R. Kirschner, Frankfurt am Main, is
acknowledged for his improvement of the Latin descriptions. Thanks are also due to Dr. W.Q. Hu,
Montreal for his corrections of language. This study is supported by the National Natural Science
Foundation of China (Nos. 30525002, 30420120049) and the NSF (DEB-0321846).

240

Literature cited

Coker WC. 1923. The Clavarias of the United States and Canada. The University of North Carolina
Press: Chapel Hill (USA).

Corner EJH. 1950. A monograph of Clavaria and allied genera. Oxford University Press: London
(UK).

Kornerup A, Wanscher JH. 1981. Taschenlexikon der Farben. 3. Aufl. Muster-Schmidt Verlag:
Zurich (Switzerland).

Kotlaba FE, Pouzar Z. 1964. Preliminary results on the staining of spores and other structures of —
Homobasidiomycetes in cotton blue and its importance for taxonomy. Feddes. Repert. 69: 131-
142.

Marr CD, Stuntz DE. 1973. Ramaria in western Washington. Biblioth. Mycol. 38: 1-232.

Petersen RH. 1974. Contribution toward a monograph of Ramaria. 1. Some classic species
redescribed. Amer. J. Bot. 61: 739-748.

Petersen RH. 1981. Ramaria subgenus Echinoramaria. Biblioth. Mycol. 79: 1-261.

Petersen RH. 1985. Notes on clavarioid fungi. XX. New taxa and distributional records in Clavulina
and Ramaria. Mycologia 77: 903-919.

Petersen RH. 1987a. A new species of Ramaria subg. Laeticolora from Yunnan. Acta Mycol. Sinica,
Suppl. I: 255-257.

Petersen RH. 1987b. Contribution toward a monograph of Ramaria. VI. the Ramaria fennica -
versatilis complex. Sydowia 40: 297-226.

Petersen RH, Zang M. 1986. New or interesting clavarioid fungi from Yunnan, China. Acta Bot.
Yunnanica 8: 281-294.

Petersen RH, Zang M. 1989. Ramaria subgenera Ramaria and Laeticolora in Yunnan. Acta Bot.
Yunnanica 11: 363-396.

Petersen RH, Zang M. 1990. Ramaria subgenera Ramaria and Laeticolora in Yunnan (continuation).
Acta Bot. Yunnanica 12: 49-56.

Ridgway R. 1912. Color standards and color nomenclature. Washington, DC, Publ. by author.

Schild E. 1971. Clavariales. Fung. Rar. Icones Color. 5: 1-44.

Schild E. 1990. Studies in Ramaria. Z. Mykol. 56: 131-150.

Singh IP. 1977. Studies on clavarioid fungi of India. Ph.D. dissertation, Punjab University (India).

MYCOTAXON

Volume 94, pp. 241-244 October-December 2005

The world’s second record of Neoheteroceras flageoletii
reported from Turkey

ELsAD HUSEYIN', FARUK SELGUK’, AHMET SAHIN”

elsadhuseyin@hotmail.com
'Gazi University, Kirsehir Arts and Sciences Faculty
Kirsehir, 40100, Turkey

Firat University, Arts and Sciences Faculty
Elazig, 23100, Turkey

Abstract—Neoheteroceras flageoletii, a rare coelomycete with appendage-bearing
conidia, is reported and illustrated from Turkey on Tilia rubra subsp. caucasica. It is a
second locality of this fungus.

Key words— anamorphic fungi, morphology

Introduction

Fungi of Turkey have not been extensively investigated. Most studies research
macromycetes, generally agaricoid fungi. Reports on micromycetes, including
anamorphic fungi, were made by Bremer et al. (1947, 1952) and Petrak (1953). Data
concerning the anamorphic fungi were first published as information on diseases of
plants (Karel 1958) or fungal diversity investigations (Gébelez 1967). Anamorphic fungi
of Turkey have been studied extensively, however, during the last ten years (Altan &
Tamer 1996, Hiiseyinov & Selcuk 1999, Braun et al. 2000, Hiiseyinov 2000, Huseyin &
Selcuk 2001, Hiiseyinov et al. 2002, Hiiseyin et al. 2003, Selcuk et al. 2003, Menik et al.
2004, Kirbag 2004).

Material and Methods

The plant material for this paper was gathered from the forest of Rize province (Eastern
Black Sea Region) in July 1998.

The host plant was identified according to Davis (1967). Specimens of the fungus
were taken to the laboratory and microscopically examined under a Nikon compound
microscope. Sections were hand cut using a razor blade. The fungus was identified
following Nag Raj (1993). The specimen was deposited at GAZI.

Results

In this study, we clearly demonstrated that the fungus is a species of Neoheteroceras, viz.
N. flageoletii. The description and illustration below is based on the Turkish material.

242

Neoheteroceras flageoletii Nag Raj, Coelomycetous anamorphs with appendage-bearing
conidia, p. 539, 1993.

Conidiomata stromatic, subepidermal, innate-erumpent, broad conical in sectional
view, 220-500 um in diam in the base, uni- or bilocular, dark brown (Fig. 1A).
Conidiophores cylindrical, simple, sparsely septate at the base, colourless. Paraphyses
unbranched, filiform, septate, colourless, 50-65 x 2.5-3 um. Conidia oblong to fusiform
or stenoclavate, bearing appendages, 7- septate, faintly constricted at the septa, 45-58 x
7.5-10 um including the apical and basal appendages; basal cell obconic with a truncate
base, colourless, cellular appendage, 5-10 tm long; median cells dirty-brown to amber-
brown 35-40 (—45) um long, wall thick, smooth or slightly verruculose; apical cell conic,
colourless, drawn out at the apex into an unbranched, attenuated, tubular appendage,
10-20 um long; 1-2 sometimes 3 lateral appendages arising from the second, third and
sixth median cells from the top, cellular, unbranched, colourless, sinuate, 7.5-22.5 x
2.5-3 um (Fig. 1B).
Specimen examined——TURKEY, Rize Prov., Ardeshen district, near the Nursery of
General Forest Manager, on dead branches of Tilia rubra DC. subsp. caucasica (Rupr.) V.
Engler (Tiliaceae), 41°21714°N, 41°13’50” E, 670 m, 30-VII-1998, Co. HUSEYIN E (EH
1281) and SELCUK F (FS 0206).

Discussion

The morphological characters of Neoheteroceras flageoletii of Turkish sample show
some distinctions from the original collection. According to Nag Raj (1993) the fungus
has conidia 48-60 x 7-11 um, basal cellular appendage 3-8 um long, apical cellular
appendage 14-22 um long and conidia with 2-3 lateral appendages, 12-30 x 2-3 um.
The fungus is terrestrial saprotroph, which requires a high level humidity and inhabits
the bark of dead branches 0.5-1 cm diam.

Saccardo (1915) first described this fungus on Tilia europaea from France, as
Heteroceras flageoletii. However, the monotypic genus Heteroceras Sacc. is an illegitimate
later homonym, and consequently the species name is invalid. When Nag Raj (1993)
re-examined the holotype, he published Neoheteroceras as a nom. nov. for the genus
and N. flageoletii as a nom. nov. for the species. Until now there has been no additional
information about this fungus. We think that our report from Turkey is the second
registration of this fungus in the world.

The teleomorph of this species is unknown.

Acknowledgements

The authors would like to extend a sincere gratitude to Dr. Lorelei L Norvell (Mycotaxon) for
linguistic help and a critique of the manuscript. We also thank Dr. V. Mel'nik (St. Petersburg) for
kind help in identification of fungus, Dr. Cvetomir M. Denchev (Sofia, Bulgaria) and Dr. Tatjana
Andrianova (Kiev, Ukraine) for critically reading the manuscript and serving as presubmission
reviewers.

243

Fig.1. Neoheteroceras flageoletii: A.-vertical section of a conidioma. Scale bar=50 ym; B.-natural

conidia. Scale bar=15 um.

Literature Cited

Altan Y, Tamer AU. 1996. The parasitic fungi occurring on some endemic plants in Turkey and
their damaging effects. Plant life in South-West and Central Asia. Ege University Pres, Izmir,

_ Turkey, pp. 398-401.

Braun U, Melnik V, Hiiseyinov E, Selcuk FE. 2000. Mycopappus alni on species Betula and Pyrus
from Turkey. Mikologia i Fitopatologia. “Nauka”. St-Petersburg, 34(6): 1-2.

Bremer H, Ismen H, Karel G, Ozkan M. 1947. Beitrage zur Kenntnis der parasitischen Pilze der
Tiirkei. I. Revue de la Faculté des Sciences de Université d’Istanbul. Ser. B. 12(2): 307-334.

Bremer H, Karel G, Bryikoglu K, Géksel N, Petrak F. 1952. Beitrage zur Kenntnis der parasitischen

244

Pilze der Tiirkei. VI. Revue de la Faculté des Sciences de l'Université d'istanbul. Ser. B. 17(3):
209227 9.

Davis PH. (Ed.). 1967. Flora of Turkey and East Aegean Islands, Vol. 2, Edinburgh Univ. Pres.,
Edinburgh. 581 pp.

Gobelez M. 1967. La Mycoflore de Turguie. II. Mycopathologia et Mycologia Applicata, 23(1): 47-
67.

Hiiseyin E, Selcuk F. 2001. New and poorly known genera of microfungi for Turkey, Turk. J. Bot.,
25 (6): 437-438.

Hiiseyin E, Selcuk E Gaffaroglu M. 2003. Some materials on mitosporic fungi from Turkey. I.
Hyphomycetes. Botanica Lithuanica. Vilnius, 9(2): 151-160.

Hiiseyinov E, 2000. New records of microfungi for Turkey. Israel Journal of Plant Sciences. 48(1):
75-78.

Hiiseyinov E, Selcuk F. 1999. New records of phytopathogenic microfungi for Turkey. Plant Disease
Research 14(2): 175-176.

Hiiseyinov E, Mel'nik V, Selcuk F. 2002. Ceratophorum helicosporum — a new for mycoflora of
Turkey genus and species of Hyphomycetes (Dematiaceae). Mikologia i Fitopatologia. “Nauka’.
St-Petersburg. 36(3): 11-13.

Karel GA. 1958. A Preliminary List of Plant Disease in Turkey. Ayyildiz Matb. Ankara. 44 pp.

Kirbag S. 2004. New records of microfungi from Turkey. Pak. J. Bot. 36 (2): 445-448.

Melnik V, Hiiseyin E, Selcuk F. 2004. Contribution to the studying of micromycetes in several
Black Sea Provinces of Turkey. Academia Scientarum Rossica. Institutum Botanicum nomine
V.L. Komarovii. Novitates Systematicae Plantarum non Vascularum. “Nauka’, Petropolis, 37:
133-148.

Nag-Raj TR. 1993. Coelomycetous anamorphs with appendage-bearing conidia, Mycol. Publ.,
Waterloo, Ontario. 1101 pp.

Petrak FE. 1953. Neue Beitrage zur Pilzflora der Turkei. Sydowia. Ann. Mycol. 7(I-4): 14-44.

Saccardo PA. 1915. Fungi noveboracenses. Ann. Mycol. 13: 115-138.

Selcuk F, Hiiseyin E, Bitmis K. 2003. Some materials on mitosporic fungi from Turkey. II.
Coelomycetes. Botanica Lithuanica. Vilnius, 9(2): 161-170.

MYCOTAXON

Volume 94, pp. 245-248 October-December 2005

Lewia chlamidosporiformans sp. nov.
from Euphorbia heterophylla

BRUNO S. VIEIRA & ROBERT W. BARRETO

rbarreto@ufv.br
Departamento de Fitopatologia, Universidade Federal de Vicosa
Vicosa, Minas Gerais, 36570-00, Brazil

Abstract—Lewia chlamidosporiformans found associated with the weed Euphorbia
heterophylla (wild poinsettia) was collected in Brazil and is newly described and
illustrated. It differs from the other species in the genus by having longer ascospores that
are surrounded by a mucilaginous sheath and asci that have a different shape (obovoid
to obpyriform). It produces abundant chlamydospores when grown in liquid media. Its
pathogenicity to wild poinsettia was demonstrated.

Key words—Pleosporaceae, Euphorbiaceae, Ascomycota

Introduction

During isolations of fungal pathogens of weeds occurring in Brazil, cultures of a fungus
showing typical features of members of Lewia (Simmons 1986a) were obtained from
leaf spots on wild poinsettia (Euphorbia heterophylla L). Alternaria-like conidia were
also produced. Members of Alternaria are known to be anamorphs of Lewia, helping
to confirm that the fungus newly collected belonged to Lewia. This paper describes the
teleomorphic stage of this fungus.

Although there are 50 known species of Alternaria, according to Kirk et al. (2001),
only 5 species of Lewia have been described. Nevertheless, the total number or species
presently included in this genus is 7 namely: L. intercepta, L. infectoria, L. photistica, L.
avenicola, L. ethzedia, L. sauropi, L. scrophulariae (Simmons 1986a,b; Zhang & David,
1996; Simmons 2002; Kwasna & Kosiak 2003). Barreto & Evans (1998) provided a
complete list of the fungal pathogens known in association with wild poinsettia but the
list does not include any species of Lewia or Pleospora (the genera from which Lewia
was segregated). There are also no recent reports of species in these genera associated
with this host. A comparison of the fungus on wild poinsettia with the other species in
the genus led to the conclusion that this represents a new species, which is described
below.

Material and Methods

Cultures were obtained on VBA medium (vegetable broth-agar), a general-purpose
medium (Pereira et al. 2003). Semi-permanent slides were prepared and mounted
in lactophenol. Observations, measurements and photographs were made using an

246

Olympus BX 50 light microscope, fitted with a camera. Dry cultures of the fungus were
prepared by following the methodology described by Rossman & Simmons (1999)
and representative specimens of the fungus were deposited in the herbarium at the
Universidade Federal de Vicosa (Herbarium VIC).

When grown in a liquid medium Jenkins-Prior (Fargues et al. 2001) under agitation
at 180 rpm with a temperature of 25 + 2 °C, the fungus formed abundant chlamydospores
starting after 3 days of cultivation.

Confirmation of the pathogenicity of the isolate was made by utilizing a
chlamydospore suspension, produced as described above, as inoculum. Inoculation of
E. heterophylla plants was performed as follows: the concentration of the suspension was
adjusted to 1 x 10’ chlamydospores/ml with the help of a hemocytometer. Tests plants
were brush-inoculated with the suspension on both sides of all leaves of the plants. After
the inoculation, the plants were maintained in a dew chamber at 25 °C for 48 hours and
later transferred to a greenhouse where they were observed daily for the appearance of
symptoms. Plants brushed with sterile water served as controls. The experiment was
accomplished with three replicates, each replicate consisting of a pot containing a 20-
day old plant.

Taxonomic Description

Lewia chlamidosporiformans B.S. Vieira & R.W. Barreto, sp. nov. FIGS 1-3

Ab Lewia photistica Simmons; In VBA ascomata 145-190 x 115-160 um, asci obovoidei vel
obpiriformei, 80-120 x 37-44um, ascosporae 25-37 x 10-12, cum tunica mucosa involutae,
differens.

Etymology: reference to the abundant formation of chlamydospores in liquid culture.

Holotype: on Euphorbia heterophylla, Brazil, Minas Gerais, Vicosa, January 2005, B.S.
Vieira (VIC-28732).

Colonies on VBA (amended with 20 glucose g/L) 50 mm diam. after 7 days at 25 °C under
a 12 hours photoperiod, cottony, grey, with some whitish areas, dark green reverse, with
diurnal zonation with ascomata formation and sporulation. Ascomata pseudothecial,
globose, dark brown, often immersed in the culture medium, 145-190 x 115-160 um.
Asci obovoid to obpyriform, thin-walled, bitunicate, 80-120 x 37-44 um, 8 spored.
Ascospores inordinate fusiform, often rounded at the apex and subacute at the base,
usually constricted at the subapical transversal septum, 25-37 x 10-12 um, subhyaline to
very light brown, smooth, mature ascospores usually with 2 to 5 transverse septa and 1
or 2 longitudinal septa, surrounded by a distinct mucilaginous sheath. Chlamydospores
formed abundantly in liquid culture media, in hyphae, intercalary, mostly in chains, 1-
celled, subspherical, subcylindrical or irregular, 7 - 17 um diam, thick walled, smooth,
subhyaline to very light brown. Anamorph: a typical Alternaria.

Comments — Ascomata of L. chlamidosporiformans were produced in vitro, in
synthetic media, namely: Kondryatiey medium and Goral medium (Fargues et al.
2001), submerged in those media, either singly or clustered. L. chlamidosporiformans
resembles L. avenicola in this respect as described by Kwasna & Kosiak 2003 for ascomata
produced on SNA slants. L. sauropi is also known to produce ascomata in culture (Zhang

247

Figs. 1-3. Lewia chlamidosporiformans. Fig. 1. Ascus with ascospores. Fig. 2. Mature ascospores
(note the mucilaginous sheath surrounding the ascospores). Fig.3. Chain of chlamydospores with
some undergoing germination. Bars = 24 um (Fig. 1);32 wm (Fig. 2); 31 pm (Fig. 3)

& David, 1996). The other Lewia usually produce ascomata only on tissues of infected
plants (Whitehead & Dickson 1952; Simmons 1986a,b). Sporadically, the formation
of teleomorphs in vitro was observed by Bilgrami (1974) in L. infectoria (Pleospora
infectoria) and Simmons (1986b) in L. photistica. Although Alternaria species and their
teleomorphs may produce clumps of thick walled cells, they do not usually produce
typical chlamydospores such as those of L. chlamidosporiformans (Ellis 1971; Ellis 1976).
L. avenicola is known to produce chlamydospores arranged in chains or clusters on PDA
and SNA (Kwasna & Kosiak 2003). L. chlamidosporiformans resembles L. ethzedia and L
scrophulariae in ascomatal size (150-200 um), but differs from the other species in this
respect (Kwasna & Kosiak 2003). The sole species of Lewia known to attack a member of
the Euphorbiaceae (namely Sauropus androgynus Mert.) is L. sauropi. This species differs
from L. chlamidosporiformans in the following features: asci in L. sauropi have a different
shape (obovoid, pyriform or ellipsoidal), asci are wider (47-57 um) and no mention of
chlamydospore formation was made in the original description (Zhang & David, 1996).

248

Three features are particularly useful for separating L. chlamidosporiformans from all
other species in this genus, being unique for the new species: the ascus shape which
is obovoidal to obpyriform (subcylindrical to subellipsoidal in all other species); the
length of the ascospores is larger than described for other known species (25 -37 um for
L. chlamidosporiformans as compared to the the maximum length known for this genus
until now L. sauropi - with a length of 29.5-35 um); the presence of a mucilaginous
sheath surrounding the ascospores (unknown for other members of Lewia).

Inoculation of L. chlamidosporiformans caused severe yellowing of leaves followed by -
a general necrosis and defoliation that finally led to plant death after 5 days of inoculation.
Some diseased leaves were maintained in a dew chamber under a temperature of 25 °C
for 24 hours and after this period abundant formation of conidia was observed.

Acknowledgments
The authors wish to thank Dr. Harry C. Evans and Dr. José Luiz Bezerra for reviewing the manuscript

and to acknowledge the Conselho Nacional do Desenvolvimento Cientifico e Tecnolégico (CNPq)
for financial support.

Literature Cited

Barreto RW, Evans HC. 1998. Fungal pathogens of Euphorbia heterophylla and E. hirta in Brazil and
their potential as weed biocontrol agents. Mycopathologia 141: 21-36.

Bilgrami RS. 1974. Occurrence of the perfect stage of Alternaria tenuis Nees on the leaves of
Marsilea quadrifolia L. Current Science 43: 492.

Ellis MB. 1971. Dematiaceous Hyphomycetes. Commonwealth Mycological Institute, Kew.

Ellis MB. 1976. More Dematiaceous Hyphomycetes. Commonwealth Mycological Institute, Kew.

Fargues J, Smits N, Vidal C, Vey A, Vega FE, Mercadier G, Quimby P. 2001. Effect of liquid
culture media on morphology, growth, propagule production, and pathogenic activity of the
Hyphomycete, Metarhizium flavoviride. Mycopathologia 154: 127-137.

Kirk PM, Cannon PF, David JC, Stalpers JA. 2001. Dictionary of the Fungi. CAB International,
Wallingford, UK.

Kwasna H, Kosiak B. 2003. Lewia avenicola sp. nov. and its Alternaria anamorph from oat grain,
with a key to the species of Lewia. Mycological Research 107 (3): 371-376.
Pereira JM, Barreto RW, Ellison CA, Maffia LA. 2003. Corynespora cassiicola f. sp. lantanae:
a potential biocontrol agent for Lantana camara from Brazil. Biological Control 26: 21-31.
Rossman A, Simmons E. 1999. A modified technique for making dried cultures as voucher
specimens. Inoculum. 50 (4): 3.

Simmons EG. 1986a. Alternaria themes and variations (14-16). Mycotaxon 25: 195-202.

Simmons EG. 1986b. Alternaria themes and variations (22-26). Mycotaxon 25: 287-308.

Simmons EG. 2002. Alternaria themes and variations (305-309) Lewia/Alternaria revisited.
Mycotaxon 83: 127-145.

Whitehead MD, Dickson JG. 1952. Pathology, morphology and nuclear cycle of two new species
of Pyrenophora. Mycologia 44: 747-758.

Zhang T, David JC. 1996. Notes on Alternaria species on Euphorbiaceae in IMI and K. I. Taxa
on Euphorbia, Acalypha and Sauropus. Mycosystema 8-9: 109-121.

MYCOTAXON

Volume 94, pp. 249-252 October-December 2005

Weddellomyces turcicus, a new species
on a grey Acarospora from Turkey

M. GOKHAN Hatici*, ALAN ORANGE**, AHMET AKSoyY***

*mghalici@erciyes.edu.tr ***aksoy@erciyes.edu.tr
Erciyes Universitesi, Fen Edebiyat Fakiiltesi, Biyoloji Boliimii
38039 Kayseri, TURKEY

“alan.orange@nmgw.ac.uk
Department of Biodiversity and Systematic Biology, National Museum of Wales
Cardiff CF10 3NPB, U.K.

Abstract— Weddellomyces turcicus is described as new from the thallus of an unidentified
grey placodioid Acarospora in Turkey; it differs from other species of the genus in the
asci being 2-spored when mature.

Key words— Ascomycetes, cephalothecoid exciple, lichenicolous fungi, Dacampiaceae

Introduction

The genus Weddellomyces comprises 11 species occurring on saxicolous lichens. The
species have been treated by Calatayud & Navarro-Rosinés (1998) and Navarro-Rosinés
& Roux (1995). The perithecial wall in this genus is composed of cephalothecoid plates,
but Alstrup & Hawksworth (1990) also included one species without such plates. A
recent collection from Turkey differs significantly from previously described taxa, and is
described here as a new species.

Methods

Sections were prepared by hand, and examined in Congo Red (1% solution in water,
mixed 1: 1 with 10% KOH), I (Lugol’s Iodine: 10.5 g, KI 1.5 g, water 100 ml), and Brilliant
Cresyl Blue in water. The pigment of the ascomatal wall was investigated following the
methods of Meyer & Printzen (2000).

The species

Weddellomyces turcicus Halici & Orange sp. nov. Figs. 1-2

Fungus lichenicola. Ascomata globosa, 390-490 um diam., nigra. Excipulum superum
ex segmentis cephalothecoideis constructum. Hamathecium ex hyphis ramosis,
anastomosantibus et septatis compositum. Asci maturi 2-spori. Ascosporae brunneae, 3-
septatae, 50-61(-69) x (16.5-)18.5-21.5(-22) um, verruculosae.

250

Typus: Turkey, Kayseri, Aladaglar Milli Parki, Hacer Ormanlari, 37°47°N, 35°18 'E, alt.
1648 m, on thallus of Acarospora sp. on exposed limestone rocks, 20 November 2004,
M.G. Halici 0.2018 (NMW C.2005.013.1-holotypus).

Lichenicolous, on dead and decolourized areas of the host thallus. Ascomata perithecioid,
immersed in host thallus, erumpent, the apex visible through an irregularly shaped split
in the host cortex, later the upper half of the perithecium exposed by the break up of the
dead host tissue; ascomata globose, 390-490 um diam., black, matt, slightly roughened,
without setae, apex opening by a minute irregularly shaped depression, often with a
few irregular radiating cracks. Exciple in surface view of polygonal cephalothecoid
plates 30-105 x 30-50 um, comprising dark-pigmented areas separated by pale areas,
plates becoming indistinct in the lower part of exciple; in vertical section exciple
24-40 um wide at sides and base, 40-60 um thick near apex; cells slightly tangentially
compressed, mostly 5.5-16.5 x 4-15 um, the walls 1-2.5 um thick, outermost layers
of cells dark-pigmented except at the junctions of the plates, pigment within cell wall,
unevenly distributed in inner cells of the pigmented layer, obscuring cell outlines in
outer cells; pigment dark (slightly reddish) brown in water, K + dark greyish brown, HCl
+ reddish brown; after treatment with N, the colour in K is similar to the colour in water
(Atra-brown). Subhymenium c. 20 um thick. Hamathecium of richly branched and
anastomosing interascal filaments 2-3.5 um wide, with frequent septa. Asci cylindrical,
140-160 x 23-27 um, initially up to 8-spored, but 2-spored at maturity, wall gradually
thickened towards apex, I -, ocular chamber present. Ascospores (2-)3-septate, 50-
55.6-61(-69) x (16.5-)18.5-19.9-21.5(-22) um, length/breadth ratio (2.3-)2.6-2.8-
3.0(-3.2) [n = 33]; brown, terminal cells concolorous or very slightly paler than central
cells; surface verruculose, perispore not detected in mature spores, torus inconspicuous
at all stages; wall of semi-mature to mature spores I + dilute blue (partly masked by
brown pigment).

Discussion

The species of Weddellomyces are distinguished mainly by features of the ascospores,
including size, shape, septation, and surface ornamentation; and by the identity of the
host. Weddellomyces turcicus differs from all other members of the genus in the asci 2-
spored at maturity, although the asci initially have 6-7 ascospores visible, and it is likely
that 8 are present. It is also the first species in the genus to be recorded from Acarospora.
It is known only from the type collection. W. turcicus is likely to be pathogenic, as it
occurs on two small, bleached areas of host thallus, but further collections are necessary
to confirm this. The currently unidentified host has a grey, placodioid thallus which is
K + yellow, C -.

Acknowledgments

We would like to thank Prof. David L. Hawksworth and Dr Paul Diederich for reviewing this paper
and for their helpful comments.

Zot

Fig. 1 — Weddellomyces turcicus (Holotype). Line drawings. a. section of part of upper exciple,
showing parts of four cephalothecoid plates. b. ascospores (outlines). c. ascospore, showing surface
ornament. Bar = 50 um.

References

Alstrup V, Hawksworth DL. 1990. The lichenicolous fungi of Greenland. Meddel. Gronland,
Bioscience 31: 1-90.

Calatayud V, Navarro-Rosinés P. 1998. Weddellomyces xanthoparmeliae sp. nov. and additions to
the chorology of other species of the genus. Mycotaxon 69: 503-514.

Meyer B, Printzen C. 2000. Proposal for a standardized nomenclature and characterization of
insoluble lichen pigments. Lichenologist 32: 571-583.

Navarro-Rosinés P, Roux C. 1995. Le genre Weddellomyces (Dothideales, Dacampiaceae) en
Catalogne et en Provence. Mycotaxon 53: 161-187.

Zod

u
3
t
;
;
2

Fig. 2 — Weddellomyces turcicus (Holotype). Asci in water: three immature and one (far right)
mature.

Bar = 50 um.

MYCOTAXON
Volume 94, pp. 253-263 October-December 2005

Cordyceps spegazzinii sp. nov., a new species of the
C. militaris group

Monica S. TORRES’, JAMES F. WHITE, JR.’ & JOSEPH E. BISCHOFF’

jwhite@aesop.rutgers.edu
‘Department of Plant Biology and Pathology, Rutgers University
New Brunswick, New Jersey 08901

National Center for Biotechnology Information, National Institutes of Health
Bethesda, Maryland 20894

Abstract—The proposed new species, Cordyceps spegazzinii sp nov., was collected on
Barro Colorado Island, Panama. It is characterized by simple stromata with cylindrical to
clavate heads, perithecia superficial to partially immersed, ascospores not fragmenting
into part-spores and a Evlachovaea sp. anamorphic state. We compared C. spegazzinii
to similar species in the C. militaris group. We determined that C. spegazzinii belongs
to the C. militaris group, based on examination of morphological features and cultural
characteristics, combined with phylogenetic analyses using LSU rDNA sequences.

Key words—Clavicipitales, taxonomy

Introduction

Members of the family Clavicipitaceae (Hypocreales) display a wide range of life strategies
ranging from insect endoparasites to pathogens of grasses and endophytes (Spatafora et
al. 1993). The entomogeneous fungal genus Cordyceps (Fr.) includes approximately 450
described species (Sung 2004, Stensrud et al. 2005) that are known to be endoparasites of
several orders of arthropods and parasitic on hart’s truffles (Elaphomyces spp.) (Kobayasi
1982, Mains 1957) while other species live on the sclerotia of plant pathogenic Claviceps
species. In addition, a few species are known to utilize seeds of higher plants (Fukatsu
& Nikoh 2003).

The genus Cordyceps has also received significant attention due to the importance
of some species in the production of bioactive compounds. ‘The species C. sinensis
(Berk.) Sacc. and C. sobolifera (Hill) Berk. & Broome have been used in traditional
Chinese medicine (Liu et al. 2002) and C. kyusyuensis Kawam. has recently received
attention due to production of bioactive compounds with anti-tumor activity (Sun et
al. 2003). Other species, like C. brongniartii Shimazu and C. bassiana Z.Z. Li et al. have
been connected with their anamorphic stages, Beauveria brongniartii (Sacc.) Petch and
Beauveria bassiana (Bals.-Criv.) Vuill., respectively, both with potential for biocontrol of
insects (Shimazu et al. 1988, Li et al. 2001, Rehner et al. 2005).

254

There have been several attempts to better characterize the genus (Kobayasi 1982).
Four subgenera have been proposed based on morphological characters: subgenera
Ophiocordyceps, Eucordyceps, Neocordyceps (Kobayasi 1982) and Bolacordyceps
(Erikkson 1986). However, identification and classification of Cordyceps species based
exclusively on morphological and cultural data is a difficult task due to the large number
of species that compose the genus, possible synonymies, presence of several anamorphs
and inability to locate type specimens (Sung 2004, Sung & Spatafora 2004, Stensrud et
al. 2005). Increasingly, phylogenetic studies have employed sequence data to shed light
on the phylogenetic relationships and species delimitation in the genus Cordyceps (Sung
et al. 2001; Nikoh & Fukatsu 2000, Sung et al. 2004, Stensrud et al. 2005). Sung et al.
(2001) employed nuclear rDNA sequences (SSU and LSU) in the revision of Verticillium
sect Prostrata. They determined that Cordyceps was not monophyletic and recognized
two distinct clades, C. militaris sensu stricto and C. ophioglossoides clade. Stensrud et al.
(2005) using ITS rDNA sequences of 72 clavicipitalean taxa also found Cordyceps to not
be monophyletic and recognized four separate Cordyceps evolutionary lineages.

In 2003 a specimen of Cordyceps was collected on Barro Colorado Island, Panama.
Morphological examination and phylogenetic placement of our material revealed that
its features are not consistent with previously described Cordyceps species, and a new
species is proposed.

Materials and Methods

Field collection: J.F. Bischoff and J.R White in August 2003 made the collection
on Barro Colorado Island, Panama. The material was associated with insect eggs on
partially rolled leaves of an unknown dicotyledonous tree. The eggs were identified as
belonging to Order Diptera by Karl Kjer (Department of Ecology and Evolution, Rutgers
University). The material was brought to the field station and isolated on Potato Dextrose
Agar (PDA; Difco, Inc.) with antibiotics (gentamicin 40 mg/L, streptomycin 40 mg/L;
penicillin 20 mg/L). Stromata were kept in 90% alcohol. Specimens of the collections
were submitted to the Rutgers University Plant Pathology Herbarium (RUTPP).

Morphological observations: Microscopic examinations of anamorphic characters
were made from cultures maintained on PDA and potato carrot-agar (PCA), at room
temperature (23°C) for 10 days. Slide preparations were mounted in lactic acid-cotton
blue or water. Twenty measurements were made for each morphological feature.

To observe the structure of perithecia, specimens were fixed in 95% ethanol,
dehydrated in 100% ethanol and infiltrated with LR White® acrylic embedding medium
for 24 hours. Specimens were oriented in capsules containing embedding medium and
cured in an oven (60°C) for 24 hours. Sections approximately 1 um thick were made
using glass knives and stained in aniline blue (0.1% aqueous) followed by toluidine blue
(0.1% aqueous). Photographs were made using a Nikon Coolpix digital camera.

Cultural studies: Growth was measured on several media: PDA, PCA, malt-extract agar
(MEA), Czapek cellulose agar (CCA) and corn meal dextrose peptone (CMDP). All
media were inoculated using 7mm plugs cut from margins of colonies growing on PDA

290

plates. Plates were maintained at 23°C in dark and measured after 5 days. Representative
cultures were sent to the ATCC in Manassas, Virginia (MYA-3684) and USDA-ARS
Collection of Entompathogenic Fungal Cultures (ARSEF) (ARSEF 7850).

Sequence data: DNA extraction was carried on from fresh perithecia taken in the field
and from fresh mycelium growing on PDA media overlaid with cellulose acetate sheets.
Genomic DNA was extracted using the DNeasy’ Plant Mini Kit (Qiagen). Internal
transcribed spacer (ITS) regions 1 and 2, 5.8s, and the 5’ end of the large subunit
LSU rDNA were amplified from 4 uL of genomic DNA using primers ITS5 and ITS4
(Sullivan et al. 2000) in a 50 uL reaction. PCR reactions, sequencing reactions to amplify
the ITS and LSU regions, and reaction analyses were performed as described by Sullivan
et al. (2000). The rDNA LSU and ITS1-5.8s-ITS2 regions were submitted to GenBank
(accession number DQ196435).

Phylogenetic analysis: Sequencher (Genecodes, Ann Arbor, MI) was used to analyze,
edit and construct consensus sequence from sequence products. Forty LSU sequences to
represent Cordyceps species and others representatives of Clavicipitaceae were selected.
GenBank accession numbers are listed in Table 1. Members of the family Hypocreaceae
were used as outgroup taxa based on the work of Spatafora et al. (1993) and Nikoh et al.
(2000). Sequences were aligned by hand using the secondary structure of Saccharomyces
cerevisiae (U53879) from the comparative RNA Web site (CRW) database (Cannone
et al. 2002). The matrix was annotated as described by Kjer (1995). Sequences were
analyzed using the program PAUP v4.0 (Swofford 2002) by maximum likelihood and
Bayesian analysis. ModelTest v.3.06 (Posada & Crandall 1998) was used to select the
best fitting model of sequence evolution determined by Akaike information criterion
(Akaike 1974). The model selected was GTR with proportion of invariable sites (I)
and gamma distribution (G). The parameters include base frequencies A=0.2804,
C=0.2443, G=0.373, T=0.1680; rate matrix [A-C]=0.4817, [A-G]=1.4368, [A-T]=1.021,
[C-G]=1.0609, [C-T]=7.4863; [G-T]=1; I=0.6130 and G=0.5932 and this model was
incorporated into PAUPy.4.0. The most likely tree (-In 3703.8447) is shown in Fig. 11.
Bayesian inference was used to estimate branch support (posterior probability) under
likelihood using Mr Bayes 3.0 (Huelsenbeck 2000) (Fig. 11). Bayesian analysis was
run three times with four mcmc (Markov Chain Monte Carlo) chains for 1,000,000
generations, sampling every 100 generations. The 30,000 trees resulting from the three
runs were pooled and 28,500 were imported into PAUP to construct a majority rule
consensus tree after discarding the asymptotic trees (burn in).

Five complete ITS sequences were selected based on being included in C. militaris
clade or morphological similarities. GenBank accession numbers are listed in Table
1. Sequences were aligned using ClustalX (Thompson et al. 1997) and their similarity
compared (Table 2).

256

Table 1. Taxa used in LSU and ITS analyses

Taxa

Atkinsonella hypoxylon
Balansia henningsiana
Balansia strangulans
Beauveria brongniartii
Claviceps fusiformis
Claviceps paspali
Claviceps purpurea
Cordyceps capitata
Cordyceps cardinalis 1
Cordyceps cardinalis 2
Cordyceps gunniti
Cordyceps inegoensis
Cordyceps japonica
Cordyceps kanzashiana
Cordyceps kyusyuensis
Cordyceps militaris
Cordyceps ophioglossoides
Cordyceps prolifica
Cordyceps pruinosa
Cordyceps pseudomilitaris
Cordyceps ramosopulvinata
Cordyceps sinensis
Cordyceps spegazzinii
Cordyceps subsessilis
Cordyceps takaomontana
Cordyceps tuberculata
Dussiella tuberiformis
Epichloe amarillans
Epichloe typhina
Hypocrea lutea

Hypocrea schweinitzii
Hypomyces armeniacus
Hypomyces orthosporus
Lecanicillium lecanii 1
Lecanicillium lecanii 2

Neotyphodium coenophialum

Paecilomyces farinosus
Paecilomyces tenuipes

Tolypocladium cylindrosporum

Tolypocladium inflatum

LSU

U57087
U57678
U57679
AB027381
U17402
U47826
U57085
U57086
AY 184965
AY 184964
AF339522
AB027368
AB027367
AB027371
AY465959
AB027379
U47827
AB027370
AB044635
AF327376
AB027372
AB067737
DQ196435
AF373285
AB044637
AF327384
U57083
U57680
U17396
AB027384
U47833
AF160293
AF160241
U17414
U17421
AF160241
DQ067297
AB027380
AF245301
AB103381

ITS

AJ536552

AY781661
AJ786573

AJ786589

DQ196435

AB044637

27,

Taxonomic Description

Cordyceps spegazzinii M.S. Torres, J.F. White & J.F. Bischoff sp. nov.

FIGURES 1-4, 5-10
Stromata solitaria, simplicia in ovis insectorum (Diptera), 7-9 mm altus. Stipes tenuis,
glabro. Zone fertilis terminalis, cylindricea vel clavata (1x2-3 mm). Perithecia agregata,
laxe immersa, 400-460 x 200-260 um ovata vel obclavata. Asci cylindracei, 200-250 x 2.5-
3 um, hyalini. Ascosporae hyalinie, filiformes, flexuosae, multiseptatae, 100-250 x 0.5-1
um, in ascis numquam individuales in partes secedentes. Status anamorphicus in cultura
PDA, celeriter crescens, mycelio aerio gossypino, hyphis vegetativis ramosis, septatis, albis,
1-2 um latis, reverso cremeo. Cellulae conidiogenae monophialidicae, hyalinae, leves, 7-15
um, ad septum 1-2. Conidia hyalina, aseptata, levia, ellipsoidea, 4-5 x 2 um, catenulata
Etymology: this species is named after the mycologist and naturalist Carlos L. Spegazzini.
Holotype: Barro Colorado Island (BCI), Panama; insect eggs (Diptera) on leaves
of unknown dicotyledonous plant; August 2003; J.F. Bischoff & J.F. White; Rutgers
Mycological Herbarium (RUTPP).

Stromata solitary, simple, associated to dipteran eggs, measuring 7-9 mm from base to
tip, consisting of white, slender smooth stipe and yellowish, cylindrical to clavate head
(measuring 1 x 3-4 mm) (Fig 1 and 5). Perithecia crowded, 400-460 x 200-240 um,
ovate to obclavate, superficial to partially immersed, with perithecial necks protruding;
asci 200-250 x 2.5-3 um (Fig. 6 and 7), cylindrical with a refractive apical cap (Fig. 3),
containing 8 ascospores. Ascospores filiform, running in parallel, hyaline, irregularly
multiseptate, 100-250 x 0.5-1 um not fragmenting into partspores.

Colonies on PDA fast growing (20 mm in 5 days at 25°C; 14 mm in MEA, 15 mm in
PCA, 18 mm in CMDP and 13 mm CCA), smooth surface, white, cottony, dense, with
abundant sporulation; reverse cream to yellowish and smooth. Evlachovaea Borisov &
Tarasov (Borisov & Tarasov 1999) anamorphic state developing in culture (Fig. 4, 8-10).
Conidiogenous cells flask shaped (phialide), 7-15 um long, swollen at the base, base
3 um wide, and gradually narrowed to a distinct neck (Fig. 4). Phialides borne singly,
grouped in pairs or in loose clusters (Fig. 8). Conidia hyaline, unicellular, smooth, oval
to fusoid shaped, 4-5 x 2 um, forming short dry chains with zipper-like morphology due
to alternating oblique orientation of successive conidia when formed (Fig. 4 and 8).

Discussion

The features of C. spegazzinii do not match any previously described species of
Cordyceps. Cordyceps spegazzinii is comparable to C. takaomontana Yakush. & Kumaz,
C. memorabilis (Ces.) Sacc., C. pseudomilitaris Hywel-Jones & Sivichai and C. cardinalis
G.H. Sung & Spatafora, all morphologicaly similar and closely related species in the
Cordyceps s.s clade (Sung & Spatafora 2004).

Nevertheless, C. spegazzinii is easily separated by morphological and microscopic
characteristics from C. takaomontana and C. memorabilis, species that are characterized
by capitate stromata and superficial perithecia while C. spegazzinii is non-capitate with a
much less distinct fertile head. Further, the species C. takaomontana, and C. memorabilis
are parasites of Coleoptera while C. spegazzini was found associated to Diptera eggs.

258

+> ot O5

3 a PS
> exes cs
yew

naan, Aas
>,

RrPv>,? wea

304
Pag

ane
v,*
Try
>»?
*

an*
>?
24, 24%
* a

ocd
og Se ae

a
ae
eenaene a}

ke
tye re

Figs. 1-4. Morphological features of C. spegazzinii and its Evlachovaea sp. anamorph. 1. Stroma
(bar=lmm). 2. Arrangement of perithecia in the stroma (bar=160um). 3. Tip of ascus showing

the cap (bar= 3m). 4. Typical phialides and conidia of the anamorph from culture on PDA (bar=
3m).

Cordyceps pseudomilitaris shares many morphological features with C. spegazzinii
such as small stromata, superficial to partially immersed perithecia, smooth filiform
ascospores that do not break into partspores. Although Hywel-Jones (1994) stated in
his description that there exists a wide variation in size and shape in the specimens
collected, C. pseudomilitaris presents slightly longer and wider asci and elongated
ellipsoid to elongated ovoid perithecia while C. spegazzinii is characterized by ovate
to obclavate perithecia and slightly shorter and thinner asci. Also C. pseudomilitaris
was associated with a Hirsutella-like anamorph (Hywel-Jones 1994), and leptidopteran
host. Cordyceps cardinalis differs from C. spegazzinii in that the fertile area of the former
is reddish orange to reddish, cylindrical, elliptical to fusiform and those of the latter
are yellowish cylindrical to clavate. Conidial state of C. cardinalis and C. spegazzinii
are closely similar. The anamorph of C. cardinalis is characterized by phialides with
swollen basal portions and producing conidia in partially imbricate chains and it
was best described as being Clonostachys-like or Mariannaea-like (Sung & Spatafora
2004). Cordyceps spegazzinii anamorph present flask shaped phialide, with conidia
forming short dry chains with zipper-like morphology. Humber et al. (2002) proposed

259

1 mm). 6. Cross section of stroma with perithecia.

Fig. 5-10. Cordyceps spegazzinii. 9. Stroma (bar =
70um). 8. Phialides (bar = 15um). 9. Conidia (bar

(bar = 150 um). 7. Detail of perithecium (bar =
= 5 um). 10. Seven-day-old colony on PDA:

260

100 Tolypocladium cylindrosporum
100 ;Cordyceps subsessilis
Tolypocladium inflatum
Cordyceps ophioglossoides
Cordyceps capitata
Cordyceps inegoensis
Cordyceps gunnii
98 Cordyceps japonica
79 Cordyceps sinensis
100 Cordyceps kanzashiana
100 Cordyceps ramosopulvinata
Cordyceps prolifica
gg [7 Atkinsonella hypoxylon
99 Balansia henningsiana
Balansia strangulans
69r— Epichloe amarillans
92 Neotyphodium coenophialum
Epichloé typhina
100 Claviceps paspali
99 Claviceps fusiformis
99 Claviceps purpurea
Dussiella tuberiformis
Lecanicillium lecanii 1
8 Cordyceps pseudomilitaris
68 100; Cordyceps cardinalis |
Cordyceps cardinalis 2
Paecilomyces farinosus
Lecanicillium lecanii 2
99 Cordyceps tuberculata
Beauveria brongniartii
Cordyceps pruinosa
100 Cordyceps takaomontana

94 uSYUeNSIS
Cordyceps militaris
Hypomyces armeniacus
Hypomyces armeniacus
100 Hypocrea lutea
Hypocrea schweinitzit
——m 0.005 Substitutions/site

outgroup

Fig 11. The most likely tree based on rDNA LSU sequence data analysis using GTR+I+G model of
evolution. The numbers on the branches indicate posterior probabilities

261

that morphological characteristics and entomopathogenic habit of Evlachovaea could
suggest a teleomorph connection with Cordyceps species and certainly this is the case for
C. spegazzinii. Cordyceps cardinals anamorph belongs to Evlachovaea genus (R. Humber,
personal communication).

Host range of Cordyceps species may be of low significance as a phylogenetic character
(Stensrud et al. 2005). Several Cordyceps species have been previously reported on hosts
from Order Diptera, including C. dipterigena Berk. & Broome, C. sakishimensis Kobayasi
& Shimizu, C. discoideocapitata Kobayasi & Shimizu, C. bicephala Berk., C. iriomoteana
Kobayasi & Shimizu and C. novoguineensis Kobayasi & Shimizu. However, none of these
species are grouped in subsection Pseudoimmersae (Kobayasi 1982) where C. spegazzinti
would be placed based on its stromatic features.

Although the interrelationship of groups changed to some extent our analyses
recognized the same general clades reported by Sung et al. 2001 and Sung & Spatafora
2004 (Fig.11). The Cordyceps s.s. clade (99% posterior probabilities) was identical to that
observed by Sung & Spatafora (2004) and Stensrud et al. (2005) except for the addition
of C. spegazzinii. Within this clade, C. spegazzinii grouped closely (99% posterior
probabilities) with C. takaomontana and its anamorph Paecilomyces tenuipes (Peck)
Samson (Luangsa-ard et al. 2005) and it is closely related to C. kyusyuensis Kawam. and
C. militaris (L.) Fr. Cordyceps spegazzinii was compared to C. kyusyuensis and C. militaris.
Morphologically, C. spegazzinii is distinguished from C. kyusyuensis in having ovate to
obclavate superficial perithecia, and Diptera host while the later present ovoid immersed
perithecia, Verticillium-like anamorphic state (Sung, personal communication) and
leptidopteran host. Cordyceps militaris differs form C. spegazzinii in that the ascospores
of the former disarticulate and those of the latter do not disarticulate. Additionally, C.
militaris is characterized by a Lecanicillium W. Gams & Zare anamorph and brightly
colored stromata. :

In our analysis of ITS sequences similarities (Table 2), C. takaomontana was 93.2% and
C. gunnii was only 78.3% similar to C. spegazzinii.

Table 2. Similarity matrix derived from the sequence data of the ITS] region in six
Cordyceps species.

ses, (1) (2) (3) (4) (5) (6)

(1) C. spegazziniit ait

(2) C. takaomontana 93.2 cae

(3) C. militaris 92.8 99.6 —
(4) C. kyusyuensis . O27, 99.4 99.7 ---
(5) C. pseudomilitaris 90.2 94 94.2 93.5 a5

(6) C. gunnit 78.3 85 86.5 82.6 87.2 ---

262

Acknowledgements

This research was supported in part by Fulbright Comission-Bunge & Born (Argentina, Grant
1512034) to M.S.T. We are grateful to Drs. Z.Q. Liang and R.A. Humber for review versions of the
manuscript. We would like to acknowledge Dr. R.A. Humber for bringing the description of the
genus Evlachovaea to our attention.

Literature cited

Akaike H. 1974. A new look at the statistical model identification. IEEE Transactions on Automatic
Control 19:716-723.

Borisov BA, Tarasov KL. 1999. Notes on biodiversity of causal agents of invertebrate mycoses in
Adjaria (southwestern Georgia). I. Evlachovaea kintrischica gen et sp. nov. (Hyphomycetes)
from Kintrishi reservation. Mikol. Fitopatol. 33:248-256.

Cannone JJ, Subramanian S, Schnare MN, Collet JR, D’Souza LM, Du Y, Feng B, Lin N, Madabusi
LY, Muller KM, Pande N, Shang Z, Yu N, Gutell RR. 2002. The comparative RNA Web (CRW)
site: an online database of comparative sequence and structure information for ribosomal,
intron, and other RNAs. BMC Bioinformatics 3:2.

Eriksson OE. 1986. Notes on ascomycete systematics. Systema Ascomycetum 5:113-174.

Huelsenbeck JP. 2000. MrBayes: Bayesian inference of phylogeny. Distributed by the author.
Department of Biology, University of Rochester.

Humber RA, MR Tanzini, Alves SB. 2002. Evlachovaea: First reports of an unusual and little known
entomopathogenic fungal genus from the new world. 35th Annual Meeting of the Society for
Invertebrate Pathology, Fos do Iguassu, Brazil.

Hywel-jones NL. 1994. Cordyceps khaoyaiensis and C. pseudomilitaris, two new pathogens of
lepidopteran larvae from Thailand. Mycological Research 98:939-942.

Kjer KM. 1995. Use of rRNA secondary structure in phylogenetic studies to identify homologous
positions: an example of alignment and data presentation from the frogs. Molecular
Phylogenetics and Evolution 4:314-330.

Kobayasi Y. 1982. Keys to the taxa of the genera Cordyceps and Torrubiella. Trans. Mycol. Soc.
Japan 23:329-364.

Li Z, Li C, Huang B, Fan M. 2001. Discovery and demonstration of the teleomorph of Beauveria
bassiana (Bals.) Vuill. , an important entomogeneous fungus. Chinese Science Bulletin
46:751-753.

Liu Z, Liang Z, Liu A, Yao Y, Hyde K, Yu Z. 2002. Molecular evidence for teleomorph-anamorph
connections in Cordyceps based on ITS-5.8S rDNA sequences. Mycological Research
106:1100-1108.

Luangsa-ard JJ, Hywel-Jones NL, Manoch L, Samson R. 2005. On the relationships of Paecilomyces
sect. Isarioidea species. Mycological Research 109:581-589.

Mains EB. 1957. Species of Cordyceps parasitic on Elaphomyces. Bulletin of the Torrey Botanical
Club 84:243-251.

Nikoh N, Fukatsu T. 2000. Interkingdom host jumping underground: phylogenetic analysis
of entomoparasitic fungi of the genus Cordyceps. Molecular Biology and Evolution
17(4):629-638.

Pukatsu T, Nikoh N. 2003. Interkingdom host shift in the Cordyceps fungi. In: Clavicipitalean fungi:
evolutionary biology, chemistry, biocontrol and cultural impacts. Marcell-Dekker, New York.
Pp. 311-327.

Posada D, Crandall KA. 1998. Modeltest: testing the model of DNA substitution. Bioinformatics
14:817-818.

263

Rehner SA, Buckley E. 2005. A Beauveria phylogeny inferred from nuclear ITS and EFl-a
sequences: evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia
97:84-98.

Shimazu M, Mitsuhashi W, Hashimoto H. 1988. Cordyceps brongniartii sp. nov. the teleomorph of
Beauveria brongniartii. Transactions of the Mycological Society of Japan 29:323-330

Spatafora JW, Blackwell M. 1993. Molecular systematics of unitunicate perithecial ascomycetes:
The Clavicipitales-Hypocreales connection. Mycologia 85:912-922.

Stensrud O, Hywell-Jones N, Schumacher T. 2005. Towards a phylogenetic classification of
Cordyceps. Mycological Research 100:41-56.

Sullivan RE, Bills GE, Hywel-Jones N, White JF Jr. 2000. Hyperdermium a new clavicipitalean genus
for some tropical epibionts of dicotyledonous plants. Mycologia 92:908-918.

Sun Y, Ling L, Zhang J, Chen H, Zang C. 2003. Nucleoside from Cordyceps kyushuensis and
the distribution of two active components in its different parts. Acta Pharmaceutica Sinica
38(9):690-694.

Sung GH, Spatafora JW, Zare R, Hodge KT, Gams W. 2001. A revision of Verticillium section
Prostrata. II. Phylogenetic analyses of SSU and LSU nuclear rDNA sequences from anamorphs
and teleomorphs of the Clavicipitaceae. Nova Hedwigia 72: 311-328.

Sung GH, Spatafora JW. 2004. Cordyceps cardinalis sp. nov., a new species of Cordyceps with a east
Asian-eastern North American distribution. Mycologia 96: 658-666.

Sung J. 2004. Cordyceps diversity and its preservation in Korea. Supplement to Mycologia
55(4):1-3.

Swofford DL. 2002. PAUP”. Phylogenetic analysis Using Parsimony (*and Other Methods), Version
4, Sinauer Associates, Sunderland, Massachusetts.

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The ClustalX windows
interface: flexible strategies for multiple alignment aided by quality analysis tools. Nucleic Acids
Res 25:4876-4882.

MYCOTAXON

Volume 94, pp. 265-292 October-December 2005

A phylogeny of Ramariopsis and allied taxa

RICARDO GARCIA-SANDOVAL
JOAQUIN CIFUENTES

garcia_s@ciencias.unam.mx
Herbario FCME, UNAM, Apdo. Post. 70-181
México DF, 04510, México

EFRAIN DE LUNA

Instituto de Ecologia A.C., Apdo. Post. 63
Xalapa Veracruz, 91000, México

ARTURO ESTRADA— TORRES

CICB, Universidad Autonoma de Tlaxcala, Apdo. Post. 183
Tlaxcala, 90000, México

MARGARITA VILLEGAS

Herbario FCME, UNAM, Apdo. Post. 70-181
Mexico DE, 04510, México

Abstract—The phylogenetic relationships of Ramariopsis and related taxa were studied
through a cladistic analysis of 36 morphological, cytological, and biochemical characters
among 23 species in six genera. Two of these genera were directly studied as groups
of interest, three as external taxonomic outgroups, and one as operative outgroup.
Representatives of Ramariopsis sensu Corner formed a monophyletic group, supported
by the cyanophilous nature of their basidiospores and derivation of their ornamentation
from the tunica. The new combination, Clavulinopsis antillarum, is proposed.

Key words— Clavariaceae, Homobasidiomycetes, spore ultrastructure, outgroup
sampling, taxonomy

Introduction

Ramariopsis was described as a subgenus of Clavaria by Donk (1933), who selected
Clavaria kunzei Fr. as the type species; the name refers to its macromorphological
similarity to the genus Ramaria (Donk 1954). The taxa originally included the type
species, Clavaria angulispora Pat. & Gaillard, Clavaria pulchella Boud., Clavaria pyxidata

Pers. and C. subtilis Pers.

266

Corner (1950) elevated the taxon to genus level and included several fibulate species
with branched, whitish basidiomes, monomitic hyphal systems, and echinulate spores.
He retained Clavaria kunzei [= Ramariopsis kunzei (Fr.) Corner] as the type species,
removing three species—C. angulispora, C. pyxidata and C. subtilis—and adding eight
more for a total of ten species in the genus. Petersen (1964) added two more species after
examining the type specimens of various species of the genus Clavulinopsis.

Petersen (1966) emended the original delimitation of the genus, to include taxa with
smooth spores and hysterochroic basidiomes. Petersen considered the size of the
basidia, the thickness of the spore wall, the composition of the ornamentation—when
present—and the pattern of coloration of the basidiomes as the relevant characters
for circumscribing the genus. He proposed dividing Ramariopsis into two subgenera:
Laevispora, typified by Ramariopsis minutula (Bourdot & Galzin) R.H. Petersen, for
species with smooth-spores, and Ramariopsis, consisting of species with echinulate
spores.

Corner (1970) maintained the original circumscription of the genus, recognizing that it
might be an artificial group, closely related to Scytinopogon and Clavulinopsis. Corner
argued that his circumscription conformed to a homogeneous group that was of more
utility for fieldwork.

Petersen (1978a) proposed a new delimitation for the genera Ramariopsis, Clavulinopsis,
and Clavaria based on the size of the hilar appendix, the type of pigments present in the
basidiome and the number of nuclei remaining in the basidium after the formation of
spores. He transferred species with globose spores and a conspicuous hilar appendix
from Clavulinopsis to Ramariopsis, and species with elongate spores and a small hilar
appendix from Clavulinopsis to a new subgenus: Clavaria subg. Clavulinopsis. He also
proposed designating Clavaria corniculata Schaeff. [= Ramariopsis corniculata (Schaeft.)
R.H. Petersen] as the type species of Ramariopsis.

Based on Petersen’s arguments, Ramariopsis should include hysterochroic species
with branched or simples basidiomes, with whitish or bright coloration, globose or
subglobose and smooth or ornamented spores, and a conspicuous hilar appendix (see
Fig. 1). Petersen argued that this circumscription permits a continuum among related
species, from smooth-spored species with a large basidiome, to species with a small
basidiome and echinulate spores.

There are only a few additional contributions to this polemic. Jiilich (1985) transferred
all species of Ramariopsis to Clavulinopsis based on nomenclatural arguments, but
this interpretation apparently has not been followed by the majority of taxonomists
(Hawksworth et al. 1995, Kirk et al. 2001). Pegler & Young (1985), in an electron
microscopy (EM) study of several species of Ramariopsis, Clavulinopsis, and
Scytinopogon, described three ultrastructural patterns of spore ornamentation that
corresponded with the three genera mentioned before. They also observed that several
apparently smooth-spored species, such as Ramariopsis californica R.H. Petersen,
actually possessed ornamentation. The observed ornamentation was very small and
covered by a thin myxosporium, such that the spores appear smooth under a light
microscope even at magnifications above 1000x. Pegler & Young (1985) recognized

267

Figure 1. Four species representative of the variation observed in Ramariopsis and Clavulinopsis.
a) Clavulinopsis corniculata, b) Ramariopsis pulchella, c) Ramariopsis kunzei and d) Clavulinopsis
fusiformis. Photos a: J. Cifuentes, b: A. Estrada-Torres, c: J. Cifuentes, d: J. Cifuentes.

the delimitation proposed by Corner (1950) for Ramariopsis, but not the relationship
between this genus and Scytinopogon.

The genus Ramariopsis has been included in the Clavariaceae in the majority of the
treatments of this family (Donk 1964, Corner 1970, Julich 1981, Hawksworth et al.
1995), with the exception of Petersen (1978a, 1988a) and Kirk et al. (2001), who placed
Ramariopsis in Gomphaceae.

A phylogenetic study of Gomphaceae (Villegas et al. 1999), however, indicates that
Ramariopsis—at least sensu Corner—should not be considered part of that family.
Pine et al. (1999), on the other hand, studied the clavarioid and cantharelloid
Homobasidiomycetes, and found that Clavulinopsis fusiformis (Sowerby) Corner
[= Ramariopsis fusiformis (Sowerby) R.H. Petersen] nested within the euagaric
clade, forming a monophyletic group with Clavaria acuta Sowerby, indicating that
Ramariopsis subgenus Laevispora is related to Clavaria, or at least to representatives
of Clavaria subgenus Holocoryne. Additionally results of Larsson et al. (2004) indicate
close relationships among Clavulinopsis helvola (Pers.) Corner, Clavaria argillacea
Pers.-Clavaria subgenus Holocoryne-and Clavaria fumosa Pers.-subgenus Clavaria-

268

on a monophyletic group nested in the euagaric clade. This results points to a close
relationship between Clavulinopsis and at least some part of Clavaria.

There are currently only a few works, that have attempted to study the phylogeny of
clavarioid and gomphoid macromycetes in general (Pine et al. 1999, Villegas et al. 1999,
Humpert et al. 2001), and there is no consensus about the phylogenetic relationships of
these taxa.

Given that there is no consensus delimitation for Ramariopsis, the number of species in
this genus depends on the source consulted (i.e. Jiilich 1981, 1985; Hawksworth et al.
1995; Kirk et al. 2001). This number varies from 24 to 45 species, with a distribution that
stretches from sub-Arctic regions to the forests of New Zealand (Corner 1950, 1967a,
1970; Thin 1961; Petersen 1968, 1969, 1971a, 1978b, 1979, 1988a, 1989; Pilat 1971;
Gomez 1972; Garcia-Sandoval et al. 2002).

The principal objective of the present work is to suggest a more robust delimitation
of Ramariopsis, based on a phylogenetic analysis of the available information and new
morphological characters derived from direct observation of herbarium specimens.
The use of morphological characters presents some advantages (see Jenner 2004, Wiens
2004, for an extensive up-to-date review) and for this particular case, these include the
possibility of a wide sampling of species because of the availability of herbarium material
and the opportunity to directly test the hypothesis of homology for diverse characters
considered taxonomically relevant.

Materials and Methods

Selection of outgroups and taxonomic sampling. The selection of outgroups was critical for
the present study since a reference phylogenetic framework is lacking and an inadequate
or insufficient selection of external groups could result in the artificial interpretation
of monophyly of the group of interest (Nixon & Carpenter 1993, Hopple & Vilgalys
1999). Selection was based on three criteria: a) a phylogenetic survey of the family
Clavariaceae sensu lato (results not shown), b) previous phylogenies of the clavarioid
Homobasidiomycetes, and c) previous classification proposals that include the genus
Ramariopsis in some specific family.

The phylogenetic survey was conducted based on diverse delimitations of the family
Clavariaceae (Donk 1964, Corner 1970, Jiilich 1981, Hawksworth et al. 1995). All of
the genera included in these proposals were considered, and representatives of the
observed variation were selected for study. A matrix of 26 taxa and 30 morphological
characters was constructed, and an initial selection of taxonomic outgroups and an
operative outgroup was performed based on the strict consensus of the trees obtained
from the analysis. The selection of outgroups, especially the operative outgroup, was
based partially on the phylogenetic analyses by Hibbett et al. (1997), Pine et al. (1999),
Humpert et al. (2001) and Binder & Hibbett (2002). Based on Petersen’s (1978a, 1988a)
proposals of the phylogenetic affinities of Ramariopsis, one additional representative of
Gomphus was selected to complete the taxonomic outgroups. Sampling of the ingroup
was based on Petersen's (1978a) proposed delimitation of Ramariopsis, which includes
the species considered by Corner (1950). Taxa representative of the observed variation,
and with available herbarium specimens, were chosen for analysis.

269

For a few confusing species [Clavaria sulcata (Overeem) R-H. Petersen, Clavaria
vermicularis Sw., Clavaria amoena Zoll. & Moritzi and Clavaria aurantiocinnabarina
Schwein.], assignment of specific epithets and the concepts used to delimit species
followed Petersen (1967, 1976, 1979, 1980a, 1988a).

Analysis of characters and elaboration of the data matrix. Morphological observations
were analyzed and interpreted in the framework of cladistic ontology (Hennig 1966,
Farris 1983, de Pinna 1991, De Luna & Mishler 1996). The selection and analysis of
characters were based on the variation observed among sampled species, without —
excluding a priori any sources of information (Poe & Wiens 2000). Hypotheses of
homology were elaborated based on the homology criteria proposed by de Pinna
(1991), employing similarity, conjunction, independence, variability, and heritability as
auxiliary criteria (Patterson 1988, Rieppel 1988, Brower & Schawaroch 1996, Hawkins
et al. 1997, Rieppel & Kearney 2002).

Codification of characters followed the criteria proposed by de Pinna (1991) and
later additions (Hawkins et al. 1997, Hawkins 2000, Kluge 2003, Grant & Kluge 2004).
Characters were not ordered nor polarized a priori to avoid bias in the exploration of tree
space (Hauser & Presch 1991). Similarly, no weighting scheme was applied a priori to
avoid ad hoc hypotheses that would constrain the results (Farris 1983). Character states
were analyzed by directly observing herbarium specimens from distinct collections (see
Table 1); these data were complemented by previous descriptions (Coker 1923; Singer
1945, 1986; Corner 1950, 1957, 1966, 1967a, b, 1970; Thin 1961; Petersen 1964, 1965,
1966, 1967a, 1968, 1969, 1971a, b, 1978b, c, d, 1979, 1980b, 1984, 1985, 1988a, b, 1989;
Petersen & Olexia 1967, 1969; Bataile 1969; Fiasson et al. 1970; Schild 1971; Kihner
1977; Hubbard & Petersen 1979; Claus 1983; Pegler & Young 1985; Gill & Steglich 1987;
Hansen & Knudsen 1997; Garcia-Sandoval et al. 2002; Gill 2003; Bertagnolli & Novello
2004). A matrix of 36 characters (see Appendices 1 and 2) was constructed, that included
observations of macro- and micro-morphology, macro- and micro-chemical reactions,
and biochemical, cytological, and ultrastructural characters. Information for the
homology hypothesis came primarily from direct observation of herbarium specimens
and only in few cases were based on previously reported data (see Appendices).

Tree searches, robustness, and topology test. A series of heuristic searches were performed
with 1,000 replicates in PAUP* 4.0b10 (Swofford 2002), using TBR, random addition,
and MAXTREE set to auto-increase. A branch and bound search was performed using
as an upper limit the observed tree length from the heuristic searches, and characters
were optimized with the ACCTRAN option.

Interpretation of the change of character states along phylogenies was made in
WinClada (Nixon 2002), using one of the most parsimonious trees encountered in the
branch and bound search.

Bremer’s support (Bremer 1994) was calculated to evaluate the robustness of the
observed clades. The analysis was conducted using AutoDecay 4.0 (Eriksson 1999) with
100 heuristic replicates per search, using random addition, MAXTREE set to auto-
increase, the ACCTRAN option for optimization, and equally weighted characters.
Bootstrap values (Felsenstein 1985) were also calculated using 10,000 replicates
sampling all characters, with 10 heuristic searches for each bootstrap replicate, TBR
branch rearrangement, and MAXTREE set to 100 trees.

270

Table 1. List of specimens examined.

Species

Clavaria amoena
Clavaria aurantiocinnabarina

Clavaria gibbsiae Ramsb.
Clavaria sulcata

Clavaria vermicularis

Clavaria zollingeri Lév.

Clavariadelphus pistillaris
(L.) Donk

Clavulinopsis corniculata
(Schaeff.) Corner

Clavulinopsis fusiformis

Clavulinopsis helvola

Clavulinopsis laeticolor (Berk. &
M.A. Curtis) R.H. Petersen

Gomphus clavatus (Pers.) Gray
Gomphus floccosus

(Schwein.) Singer
Lactarius indigo (Schwein.) Fr.

Ramariopsis californica
Ramariopsis crocea (Pers.) Corner

Ramariopsis kunzei

Ramariopsis pulchella
(Boud.) Corner

Ramariopsis tenuiramosa Corner

Scytinopogon dealbatus
(Berk.) Corner

Scytinopogon echinosporus
(Berk. & Broome) Corner

Scytinopogon robustus
(Rick) Corner

Scytinopogon pallescens
(Bres.) Singer

TO
TO

TO
L@
TO

LO
LO

TC)

LO)

Specimens

Corner CLAVARIA-4 (E); Donk 13690 (L)
Cifuentes 2004-94 (FCME); Corner RSNB-8376 (L); Corner
RSNB-8378A (L); Corner ICTA-1501 (E)

Corner 442 (L); Corner 24165 (L); Corner—Singer 24165 (E)
Hongo 705 (L); Corner s.n. (E); Corner 1676 (E)

Brit. Mycol. Soc. 12099 (L); Kotlaba s.n. (L); Corner NG 192 (E);
Corner RSS 1439 (E)

Corner s.n. (E); Corner s.n. (E)

Meyer 3700 (TENN); Petersen 4920 (TENN)

Piepenbroek & Piepenbroek 876 (L); Mass Geesteranus 14580
(L); Villegas 1144 (FCME); Lopez 782 (ENCB); Aranda-Breceda
4 (FCME); Corner & Thind 206 (E)

Guzman U-482 (XAL); Cooke & Cooke 45644 (XAL); Cooke

& Cooke 39815 (XAL); Hongo 764 (L); Villegas 1313 (FCME);
Villegas 1305 (FCME); Heredia 371 (XAL); Heredia 371 (XAL);
Santillan s.n (XAL); Guzman & Ventura 5835 (ENCB); Ventura
13281 (ENCB); Villegas 1438 (FCME)

Bas 6730 (L); Maas Geesteranus 13887 (L)

Corner 452 (L); Donk 13896 (L); Villegas 1803 (FCME);
Hernandez 188 (IBUG); Altamirano 628 (TLXM); Villegas 1450
(FCME).

Petersen 1797 (TENN); Arias-Montes s.n (FCME)

Cifuentes 111 (FCME); Moreno-Fuentes 418 (FCME); Villegas
1109 (FCME); Fajardo s.n (FCME).

Mendoza 9-09-1983 (FCME)
Petersen 3006 (TENN); Petersen 280109 (TENN)
Loerakker s.n. (L); Jalink & Nauta 6384 (L); de Vries s.n. (L)

Bas 5105 (L); Corner RSNB-8291; Petersen 3909 (TENN);
Guzman U-399 (ENCB); Petersen s.n. (TENN); Villegas 1804
(FCME); Pérez-Ramirez 280 (FCME); Rodriguez s.n. (ENCB);
Guzman-Davalos 2848 (IBUG); Guzman 22666 (ENCB);
Guzman 6969 (ENCB); Valenzuela 1197 (ENCB); Corner NG-
237 (E); Corner NG-229 (E); Ruiz & Herrera 3494 (MEXU)

Corner NG-217 (E); Altamirano 148 (TLXM); Altamirano 157
(TLXM)

Donk 11421 (L); Mass Geesteranus 9576 (L); Geesink 1504 (L);
Corner NG-124 (E)

Corner s.n. (E)

Corner 1517 (E)

Cifuentes 676 (FCME); Cifuentes 2004-26 (FCME)

Martinez-C. s.n (ENCB)

Herbaria: E = Royal Botanic Garden, Edinburgh, Scotland, United Kingdom; ENCB = Escuela Nacional de Ciencias Bioldgicas,
Instituto Politécnico Nacional, México; FCME = Facultad de Ciencias, UNAM, México; IBUG = Instituto de Botanica, Universidad
de Guadalajara, México; L = National Herbarium Nederland, Leiden University Branch, Nederlands; MEXU = Instituto de Biologia,
UNAM, México; TENN = University of Tennessee, Knoxville, EUA; TLXM = Centro de Investigacién en Ciencias Bioldgicas,
Universidad Auténoma de Tlaxcala, México; XAL = Instituto de Ecologia, A.C., Xalapa, México; IG = Ingroup (= group of interest);
TO = Taxonomical outgroup; OO = Operative outroup.

274

These parameters were selected to allow for a large number of bootstrap replicates
and a reasonably accurate search procedure for each replicate (as opposed to the “fast
bootstrap” option), thus avoiding the underestimation of clade support (DeBry &
Olmstead 2000; Mort et al. 2000).

Templeton’s topology test (Templeton 1983) was used to evaluate differences between
the observed phylogenetic hypothesis and that of Petersen (1978a), employing a two-
tailed Wilcoxon's signed rank test following Templeton (1983). To conduct the test, a
branch and bound search was performed constraining monophyly of the representatives
of Ramariopsis sensu Petersen. To select a subgroup of equally parsimonious trees for
topology testing, a second branch and bound search was conducted using ACCTRAN
to optimize characters and successive weighting (Farris 1969) following Carpenter
(1988, 1994), using the RI to calculate reweighting. Each of the most parsimonious trees
thus encountered was compared with each of the most parsimonious trees from the
branch and bound search with successive weights (see above) using the Templeton test
implemented in PAUP*b10 (Swofford 2002), and the results were compared to tables of
critical values of T for the Wilcoxon test.

Diverse methods exist to evaluate the stability of a phylogeny with respect to the
inclusion/exclusion of taxa (see Grant & Kluge 2003 for an extensive review). The
present study assessed the impact of taxonomic outgroups sampling with a selective
inclusion/exclusion of those taxa, followed with branch and bound searches of all of the
combinations of taxonomic outgroups: Clavaria, Clavariadelphus, Gomphus, Lactarius,
and Scytinopogon.

Results

Twenty-three species were chosen for analysis based on the criteria employed for
outgroup selection, taxonomic sampling, and character analysis (Table 1). The branch
and bound search resulted in 12 trees of 80 steps in length (CI = 0.4875, RI = 0.7153,
RC = 0.3487). The strict consensus of these (see Fig. 2) shows Ramariopsis sensu Corner
(1950, 1970) as a monophyletic group.

This group forms a monophyletic clade with the representatives of Scytinopogon.
Bootstrap analysis indicated a generally low level of support across the observed
clades (see Fig. 2); only the clades containing representatives of Ramariopsis Corner,
and Scytinopogon showed bootstrap support above 50%. Interestingly, there was no
significant support for the clade that includes most of the representatives of Clavaria
sensu Petersen. Bremer support was also relatively low for most of the clades, and the
highest values corresponded to the clade of Scytinopogon.

During the constrained analysis conducted for topology tests, 1540 equally parsimonious
trees of length 85 (CI = 0.4535, RI = 0.6781, RC = 0.3075) were found, five steps longer
than those in the unconstrained search.

The application of successive weightings allowed selection of a subset of 8 most
parsimonious trees from those found in the original branch and bound search.
Application of the topology test, however, did not indicate significant differences
between the hypotheses. Comparison of all topologies resulted in no significant values
of N = 16-14, T = 53-39.5, P = 0.4545-0.4220.

27 2,

Gomphus clavatus
Gomphus floccosus
Lactarius indigo
Clavaria zollingeri
Clavaria gibbsiae
Clavulinopsis corniculata
Clavariadelphus pistillaris
Ciavulinopsis fusiformis
Clavulinopsis laeticolor
Clavulinopsis helvola
Clavaria amoena
Clavaria aurantio-cinnabarina
Clavaria vermicularis
Clavaria sulcata
81 Scytinopogon robustus
Scytinopogon dealbatus
Scytinopogon pallescens
Scytinopogon echinosporus

Ramariopsis pulchella
56 Ramariopsis crocea
4° Ramariopsis californica

Ramariopsis kunzei
Ramariopsis tenuiramosa

Figure 2. Strict consensus of the 12 trees of 80 steps (CI = 0.4875, RI = 0.7153, RC = 0.3487) found
during the branch and bound search. Numbers below branches indicate Bremer support indices,
and numbers above branches indicate bootstrap support values.

The combinations of selective inclusion/exclusion tested (not shown) did not modify the
monophyly of Ramariopsis sensu Corner, but decreased the resolution of the topology.

Discussion

The phylogenetic analyses performed support the monophyly of of Ramariopsis sensu
Corner (1950), though with moderate bootstrap support (56%). Based on these results,
Ramariopsis is limited to species with branched basidiomes, echinulate spores, and
cyanophilous spore ornamentation derived from the tunica (Pegler & Young 1985).

The ultrastructural composition of the ornamentation is a synapomorphy for the
group (see Fig. 3), but a large part of the cladogram was optimized as ambiguous for
this character because of the lack of information for several species —e.g. information
for any of the species of Scytinopogon included is not available. Although Corner did
not include Ramariopsis californica in his most recent treatment of the genus (Corner
1970), this species exhibits all of the distinctive characters of the genus and the present
results support its inclusion in this taxon. On the other hand, Petersen (1978a) included
Clavulinopsis helvola in Ramariopsis [= Ramariopsis helvola (Pers.) R.H. Petersen],
although this species has simple basidiomes and spores with thick tuberculous
ornamentation. Pegler & Young (1985) established that this ornamentation is formed
from growth of the corium, whereas ornamentation in Ramariopsis is formed via growth
of the tunica. The results of the present study support the segregation of C. helvola from
Ramariopsis.

The representatives of Scytinopogon form a well-supported group (81% bootstrap
support), consistent with the original delimitation of Singer (1945) based on the presence
of branched, thelephoroid basidiomes and verrucose spore ornamentation. In our
results, Ramariopsis sensu Corner forms a monophyletic group with the representatives
of Scytinopogon. These taxa all have cyanophilous spores with ornamentation partially
derived from the tunica, though in Scytinopogon the ornamentation also seems to be
composed of a thick core of corium (Pegler & Young 1985). It is worth mentioning
that most of the species of Scytinopogon included in the present analysis have not been
studied ultrastructurally—such data exist for only a single species of the genus, whose
taxonomic status is in doubt.

The observed relationship between Ramariopsis and Scytinopogon was first suggested by
Corner (1970), but this link should only be considered tentative as the taxonomic sampling
of this analysis was designed to resolve a robust delimitation of the genus Ramariopsis,
and not to identify its sister taxon. Furthermore, the clade Ramariopsis+Scytinopogon
does not show bootstrap support. Thus, without a broader taxonomic sampling designed
to establish the affinities of Ramariopsis with other taxa, it is preferable to consider these
results as preliminary.

One of the principal consequences of this study is that Ramariopsis sensu Petersen is a
paraphyletic group —i.e. a grade— because it was defined by simplesiomorphic characters.
Petersen (1978a) used diverse sources of information for his delimitation, including
the absence of carotenoid pigments. Pigment composition has been a frequently-used
auxiliary character in fungal systematics (Arpin & Fiasson 1971, Tyler 1971, Gill &
Steglich 1987, Frisvad et al. 1998, Gill 2003), but recent studies indicate that phylogenetic
patterns inferred in the Homobasidiomycetes based on this type of character are often
incongruent with the results obtained using other sources of information (Hibbett &
Thorn 2001, Pine et al. 1999).

Nonetheless, the presence of certain types of pigments can be a very useful auxiliary
character in studies aimed at generic delimitation (e.g. Feibelman et al. 1997, Weinstein
et al. 2002), and the taxonomic relevance of this type of characters should not be
completely discarded, but perhaps restricted to use at lower taxonomic levels. In the
case of Ramariopsis, the delimitation proposed by Petersen (1978a) was based on the
absence of carotenoid compounds, without specify the nature of the pigments present
and without an explicit reference to a concrete character; the inferred pattern thus
cannot be directly confirmed or refuted. In the present study this character was coded
as the presence or absence of carotenoid pigments—character 11. (See Appendices for
character argumentation.)

This character does not show evidence of homoplasy in the present study based on
its observed distribution (CI = 1.0), although optimization of the character is not
definitive due to the absence of information in several of the considered species (see
Fig. 4). Additionally, the distribution of carotenoids in the present study supports the
relationship among Clavaria aurantiocinnabarina, C. amoena and C. sulcata, and is
congruent with a monophyletic group that includes representatives of Clavaria (see Fig.
2). This latter group is consistent with Petersen's (1978a, 1988a) delimitation of Clavaria.
It is worth mentioning that the aforementioned results regarding Clavaria should be

274

Gomphus clavatus

Gomphus floccosus
22a 2B ’ s
; Lactarius indigo
B
@. 8 i, i ;
64% ese tievella zollingeri
erate Clavaria gibbsiae
idee!)
3% Clavulinopsis corniculata
8 4 5 19 31 ‘ ‘
One Clavariadelphus pistillaris
2X

Character 29.
Four remanent nuclei

a*
ae

2 Ot

Clavulinopsis fusiformis

§ 2A 27 x * .
b s Clavulinopsis laeticolor
;

OO =

Clavulinopsis helvola

OOR

22
Ciavaria amoena

Clavaria aurantio-cinnabarina
5 %6 2310

B fO Clavaria vermicularis
O

oO a
O98
2

44
Clavaria sulcata
es Scytinopogon robustus
Y m8)
ea ee Scytinopogon echinosporus
162 Scytinopogon dealbatus

Scytinopogon pallescens

a0 8
OO #

Ramariopsis pulchella

Ramariopsis crocea

6
196 FO
4

4
Ramariopsis californica
Ramariopsis kunzei

Ramariopsis tenuiramosa

Clavate Cylindrical

Character 25. Basidial shape

Mainly from Mainly from

the corium the tunica

Character 34. Ry

Ultrastructure of spore ornamentation HV ovo oo

| oe oe ©
o °

Radial Flatened
pattern pattern

Character 7. Branching pattern

Figure 3. One of the most parsimonious trees encountered during the branch and bound search,
showing the character states that can be unambiguously optimized. Numbers above dots indicate
the character and numbers below dots the character state. Apomorphic states are shown in black
dots and homoplastic states in white dots. Selected character transformations are illustrated close
to the branch were change occur (see appendix | for character argumentation).

considered as preliminary due to the lack of bootstrap support and the taxonomic
sampling of the present study.

Another relevant character used by Petersen (1978a) was the presence of spores with
a conspicuous hilar appendix. Several species of Clavulinopsis subgenus Cornicularia

275

was transferred by Petersen to Ramariopsis based—in addition to the other mentioned
character—on the presence of a conspicuous hilar appendix. In this study, this
- character was included (character 31) and their optimization is depicted in figure 4
(see also Appendices for character argumentation). The present results show it as a
simplesiomorphy.

Farris (1991) provided an explicit criterion to recognize paraphyletic groups by tracing
the status of the character used to define it; in the case of Ramariopsis prominent hilar
appendix and absence of carotenoid pigments were used by Petersen in order to define
the genus, both characters are plesiomorphic and shared -simplesiomorphic-— (see
Fig. 4). In the strict sense, the present results show Ramariopsis sensu Petersen as a
paraphyletic group.

Petersen (1978a) also employed the presence of chiastic basidia with a post-meiotic
mitotic division and four nuclei remaining in the basidia after spore formation as a
cytological pattern that supported the delimitation of Ramariopsis. Recent phylogenetic
studies (Hibbett et al. 1997, Pine et al. 1999) confirm the utility of cytological characters
in the delimitation of taxonomic groups among the clavarioid and cantharelloid
Homobasidiomycetes, but while the stictic pattern appears phylogenetically informative,
the chiastic condition, which is widely distributed among the Homobasidiomycetes,
does not seem to follow a clear phylogenetic pattern (Hibbett & Thorn 2001). As with
the presence of carotenoid pigments, the utility of the chiastic condition in our analyses
is noted, though more studies are necessary.

The pattern of four remaining nuclei reported for Ramariopsis crocea (Penancier 1961)
results from a post-meiotic mitotic division. Post-meiotic mitotic divisions resulting in
four nuclei remaining in basidia following spore formation are reported for a diversity
of other taxa (Penancier 1961, Duncan & Galbraith 1972, Restivo & Petersen 1976,
Kiihner 1977, Mueller & Ammirati 1993). Both the meiotic pattern (chiastic/stictic) and
the number of remaining nuclei (see Appendices for discussion and codification) were
included as characters in the present study.

All of the species in our study for which data were available present a chiastic pattern, so
it was not informative for addressing our questions. Very possibly this character could
have relevance at other hierarchical levels when studying the taxonomic affinities of the
genus Ramariopsis.

The number of remaining nuclei (character 29 CI = 1.0) did not present a homoplasious
distribution, though, similar to the situation for carotenoid pigments, optimization
of this character should be considered preliminary since data were not available for
all species considered, and this lack of information results in a severely ambiguous
optimization (results no shown).

Our finding of a monophyletic group that includes representatives of Clavulinopsis and
representatives of Clavaria is congruent with the results of Pine et al. (1999). However,
relationships among Clavariadelphus pistillaris, Clavaria zollingeri and C. gibbsiae are
not consistent with previous classifications (see Fig. 2), and Clavariadelphus is found in
a position incongruent with previous studies (Hibbett et al. 1997, Pine et al. 1999).

276

Ramariopsis puichella Ramariopsis pulchella
(a) Ramariopsis crocea (b) Ramariopsis crocea
Ramariopsis kuncei Ramariopsis kunzet
Ramariopsis teniramosa Ramariopsis tenuiramosa
Ramariopsis californica Ramariopsis californica
gone Sovtingpogon FOBUSTUS Seytinopogon robustus
_ pes Seytinopogon dealbatus Seytinopegon dealbatus
Semmes Somnopogon pallescens Scytinopogon pallescens
tenner Sovtinopogon echinosporus Scytinopogon echinosporus
pomemmnncnmomanamnns { Tapariadelphus pistilaris Clavariadelphus pistilaris
Clavulinopsis laeticolor Clavwlinapsis laeticolor
Clavulinopsis helvola ww mmm omen (Laviutinapsis helvola

geenenesonccees { Tavlinopsis amoena
ss 1 sees (Tayvulinopsis aurantio-cinnabarina
= Clavaria vermicularis
sewer Clavaria suleata

» Clavulinopsis amoena
Clavulinopsis aurantio-cinnabarina

Clavaria vermicularis

Clavaria sulcata

Clavulinopsis fusiformis Clavulinopsis fusiformis
Clavulinopsis corniculata Clavidinopsis corniculata
Clavaria gibhsiae Clavaria gibbsiae
wan nto omen Clavaria collingeri Clavaria zollingert

Lactarius indigo Lactarius indigo
Gomphus floccasus Gomphus floecosus
Gomphus clavatus Gomphrus clavatus

sme INCONsSpicuoUs ee equivecal

ems prominent asm present

ommm absent
Character 31 Size of the hilar appendix Character 11 Carotenoid pigments
Figure 4. Optimization of two characters used by Petersen (1978a) to define Ramariopsis, onto one
of the most parsimonious trees. a) Optimization of character 31 showing prominent hilar appendix
as a simplesiomorphy; b) optimization of character 11 showing the absence of carotenoid pigments
as a symplesiomorphy.

The position of Clavariadelphus pistillaris could be an artifact, due to the fact that
the present sampling of taxonomic outgroups included distantly related groups —e.g.
Gomphus in the clade Gomphoide-Phalloide sensu Hibbett & Thorn (2001).

To explore this possibility, a branch and bound search was performed excluding
Clavariadelphus, and the monophyletic group of Ramariopsis sensu Corner+Scytinopogon
obtained in the main analysis was recovered (results not shown).

It has not been possible to clearly elucidate the phylogenetic affinity of Clavaria
zollingeri. This taxon was included in the analysis of clavarioid and cantharelloid
Homobasidiomycetes by Pine et al. (1999), but their results were inconclusive and this
species was located outside of any recognized clade in the strict consensus analysis of
combined genes. In spite of this, indicated that the current delimitation of Clavaria
(Corner 1970) -simple or branched basidiomes, monomitic hyphae in the context,
clamp connections absent in the context, and present or absent of clamp connections
at the base of the basidia~ was not a monophyletic group. The results of our study are
congruent with those of Pine et al. (1999).

Clavaria gibbsiae in the present results is located next to C. zollingeri, out of any large
clade -e.g. Clavaria sensu Petersen or Ramariopsis sensu Corner. This species is
traditionally included in Clavaria subgenus Holocoryne (Corner 1970, Petersen 1988a).
We could expect a relationship between Clavulinopsis and representatives of Clavaria
based on previous results (Pine et al. 1999, Larsson et al. 2004), but these studies also
indicate that Clavaria is not a monophyletic group (Pine et al. 1999). Our results are
congruent with these previous studies and show a core group that includes part of
Clavaria and all the included representatives of Clavulinopsis. These results should be
considered as preliminary due to the lack of bootstrap support for this group and the
taxonomic sampling of the present study.

DRE

One important result from the present study is the proposal of nomenclatural changes in
Ramariopsis. At the present time, phylogenies seem to be divorced from classifications
since few phylogenetic hypotheses are used as the foundation for newer classifications.
This may result in the undesirable situation in which robust phylogenetic papers have
little impact on the daily practice of taxonomists (for a broader discussion on this issue
see Wheeler 2004, Franz 2005). Phylogeneticists are frequently reluctant to introduce
changes in the classification due to the nature of the phylogenetic research—e.g.
occasionally the relative position of a clade undergoes modifications with the addition
of new data. In the present case, we decided to make taxonomical decisions based on our
phylogenetic results by introducing changes only when we felt confident to do it.

Our results are robust enough to restrict Ramariopsis to species with ornamented
spores—which show the characteristic ultrastructural pattern. The only problem arises
when we try to identify the species that meet those requirements since in some species
spore ornamentation is difficult to see. There are cases in which some taxa originally
described with smooth spores are demonstrated to have ornamented spores—one
example of this is Ramariopsis californica R.H. Petersen (Pegler & Joung 1985). For
this reason, and until we have more information—e.g. SEM and TEM studies of
the spores—we avoid proposing new combinations for species with smooth spores
originally described in Ramariopsis (see Appendix 3). We only recommend the use of
combinations previously proposed, that are congruent with our results (see Appendix
3). The only exception is Ramariopsis antillarum (Pat.) R.H. Petersen. This taxon was
originally described as Clavaria fusiformis var. antillarum Pat.; subsequently, Petersen
(1988a) proposed to raise it to species rank based on the differences in the ontogenetic
patterns of the basidiomes between yet the species and the variety. We concur with
Petersen's proposal, yet we consider that the correct placement for this species is in
Clavulinopsis based on the presence of simple club basidiomes and globose, smooth
spores. Our current knowledge of this species leads us to propose the combination

Clavulinopsis antillarum (Pat.) Garcia-Sandoval & Cifuentes, comb. nov.
Basionym: Clavulinopsis fusiformis var. antillarum Pat., in Duss, Enum. Methodique

des champignons recueilles a la Guadeloupe a la Martinique (Lons-le-Saunier): 14
(1903).

We have included a checklist of available species names for Ramariopsis and their
correct combinations according to the present results (see appendix 3). The list is
divided in three parts: a) species confidently placed in Ramariopsis sensu stricto; b) taxa
once included in Ramariopsis that do not belong to Ramariopsis according to our results
and available information; and c) species originally described in Ramariopsis that need
further examination before a new combination be proposed. We think that this checklist
provides practical applications, avoiding the proposal of unjustifiable new combinations
that may result in unstable nomenclatural changes.

Two combinations are excluded from the list:

a) Ramariopsis bizzozeriana (Sacc.) Schild. (= Clavaria bizzozeriana Sacc.). C.
bizzozeriana was recognized as a taxonomic synonym of Ramariopsis pulchella by
Corner (1950); later the combination Ramariopsis bizzozeriana was incorrectly preferred
over Ramariopsis pulchella by Schild (1972). This last combination should not be used

278

because C. bizzozeriana is currently considered a taxonomic synonym of R. pulchella
(for details see Corner 1950, Petersen 1978b).

b) Ramariopsis lentofragilis (= Clavaria lentofragilis Atk.). Corner (1950 p. 640)
considered Clavaria lentofragilis Atk. a taxonomic synonym of Ramariopsis kunzei,
although he kept doubts. In his description of Ramariopsis lentofragilis f. propera
(Bourdot) R.H. Petersen, Petersen (1969 p. 550) used the combination Ramariopsis
lentofragilis without making any reference to the authority of the combination. In a
subsequent article Petersen (1978a p.669) acknowledged Corner as the author of the
combination. However, Ramariopsis lentofragilis was not considered by Corner (1950,
1970), who only referred to the species as a taxonomic synonym of R. kunzei. Whether C.
lentofragilis is a synonym of R. kunzei or not is a matter that needs further investigation.
For that reason we prefer to exclude that possible combination from the checklist.

In conclusion, the present study indicates that the delimitation of Ramariopsis proposed
by Corner (1950, 1970) is robust, given currently available data. Although the topological
comparisons did not find significant differences between this hypothesis and that
proposed by Petersen (1978a), our analysis indicates that Ramariopsis sensu Corner
represents a more parsimonious hypothesis (five steps shorter), in accordance with
ultrastructural data on spore ornamentation and patterns of cyanophilous reaction in
the spores. Additionally, the test of sensitivity of the taxonomic sampling indicated that
the results obtained were not an artifact of taxon selection and are stable across various
resamplings of the data. Relationships among taxa outside of the clade Ramariopsis
sensu Corner should be taken as tentative, given that the sampling of the present study
was designed for other objectives. Recently Dentinger & McLaughlin (2005) addressed
the relationships of Clavariaceae and Pterulaceae; in their sampling they included
representatives of Ramariopsis sensu Petersen and Clavaria sensu Petersen. Their results
agree with our study and show Ramariopsis sensu Petersen as a paraphyletic group while
also showing support for a clade congruent with Clavaria subgenus Clavulinopsis. In
our results, we also find a clade congruent with the mentioned subgenus of Clavaria,
but with non-bootstrap support. Future studies addressing Clavariaceae question are
needed, but current findings (e.g. Dentinger & McLaughlin 2005) provide important
insights about this questions.

Acknowledgments

The authors wish to thank Dr. Gregory Mueller of the Field Museum of Chicago and Dra. Laura
Guzman-Davalos, from Universidad de Guadalajara for peer-review of this manuscript. Also we
thank Dr. David S. Hibbett of Clark University in Massachusetts for revision and commentary on
a preliminary version of this manuscript; Dr. Ronald H. Petersen of the University of Tennessee
for comments and suggestions on a previous version of this work presented at the 2004 Annual
Meeting of the Mycological Society of America; Bryn C. Dentinger, of the University of Minnesota,
for sharing a copy of their poster presented at the 2005 Annual MSA Meeting; the curators of the
herbaria E, ENCB, IBUG, L, MEXU, TENN, TLXM, XAL, especially Dr. Ronald H. Petersen for the
facilities and specimens offered, Dr. Roy Watling (E) for the facilities offered for the revision of the
collection of Dr. E.J.H. Corner, Dr. Machiel Noordeloos (L) and Evelyn Turnbull (E) for their help
during visits to their herbaria. Funds for the present work were provided by CONACYT 34313-V,
and DGAPA IN 209605-3. R. G.-S. would also like to thank support from the Programa de Becas
Nacionales de Posgrado UNAM. The authors would like to note that conclusions presented in this
work are not necessarily those of colleagues that commented earlier versions of this work.

279

Appendix 1. Characters and character states.

Morphological characters of the basidiome

1.- Simple clavate basidiome. This type of basidiome corresponds to what Petersen (1988a) defined
as clavarioid —holobasidiomycetes, in simple erect columns- excluding the branched forms which
show a distinct ontogenetic pattern as described by Corner (1950). This includes intergradations
from simple clavate forms to those with some amount of apical branching (bifurcated towards the
apex). Within this general pattern are several ontogenetic variants (Corner 1950, Clémengon et al.
2004) that could be phylogenetically informative, but to date there are too few data to recognize
discrete patterns; in the present study only the general pattern was considered. States: 0: present,
1: absent.

2.- Profusely branched basidiomes. This character corresponds to what Petersen (1988a) described
as clavarioid (see character 1), but is confined to the branched forms, since this corresponds to an
ontogenetic pattern distinct from the simple forms (Corner 1950). A basidiome was considered
profusely branched when it exhibited three or more levels of branching coming from the middle or
below the middle of the basidiome. States: 0: present, 1: absent.

3.- Basidiome pileate-stipitate. Corner (1966) defines the pileus as an apical expansion developed
from a diageotropic growth that generates fan or umbrella shaped forms. This differs from the
cantharelloids in the configuration of the hymenophore and the absence of a thickened hymenium.
In the present study any basidiome exhibiting a pileus sensu Corner (1966) and a stipe sensu
Kirk et al. (2001) was considered as pileate-stipitate, independent of the conformation of the
hymenophore. States: 0: present, 1: absent.

4.- Form of the hymenophore. For the present study the hymenophore was defined following
Clémencon et al. (2004) as the portion of the context that supports the hymenium -the layer of
basidia, basidiospores, and sterile elements— in contrast to the proposal of Kirk et al. (2001), who
considered the hymenophore the structure which supports spores —e.g. a basidiome. In the present
study the hymenophore was considered to exhibit variation in form independent of that of the
basidiome, and as such is an independent character (Mickevich 1982, Mickevich and Limpscomb
1991, Limpscomb 1992, Mabee 1993, O'Keefe & Wagner 2001) -against Clémencon et al. (2004)
see character three- for example a smooth hymenophore can be present in a simple, clavate, or
corticioid basidiome. The recognized states correspond in the case of gills to the description of
Singer (1986), for a hymenophore in folds to Corner (1966) in cantharelloid fungi, for a smooth
hymenophore to Clémengon et al. (2004), and for a wrinkled hymenophore to the description
of some species of Clavariadelphus by Corner (1950) though with a lesser grade of organization.
States 0: gills, 1: folds, 2: wrinkles, 3: smooth.

5.- Longitudinally sulcate in simple clavate basidiomes. This character corresponds to the description
by Petersen (1988a) and represents those basidiomes that exhibit a furrow or longitudinal fold
along the fertile part of the basidiome; it differs from a wrinkled hymenophore in that the furrow
or fold is singular. States: 0: present, 1: absent.

6.- Development of the context at the level of the hymenium. This character corresponds to the
presence or absence of the condition described as fistular or hollow by Kirk et al. (2001), but confined
to the context at the level of the hymenium. The portion of the context below the hymenophore
and subhymenium can exhibit distinct grades of development with two clearly recognizable states:
when it is well developed, the basidiome exhibits a solid aspect in transverse section, but when
poorly developed the basidiome appears hollow or fistulate in transverse section. States 0: fistulate,
1: solid.

7.- Pattern of branching. Profusely branched basidiomes exhibit different patterns of branching
derived from differences in ontogenetic development (Corner 1950). The nomenclature and
patterns described by Corner (1950) were followed for the present study. Only two states were
observed among the included species in the present analysis. States 0: radial, 1: flattened.

280

8.- Mycelial cords. Aggregates of linear hyphae growing away from the basidiome and visible to the
naked eye were considered mycelial cords. Clémengon et al. (2004) and Boddy (1999) distinguished
between mycelial cords and rhizomorphs based on the level of organization and the type of growth
of the structure. In the present study no distinctive apical growth was identified, and the observed
structures were thus only characterized as mycelial cords in the general sense of Cairney et al.
(1991). States: 0: present, 1: absent.

9.- Mycelium at the base of the stipe. Basidiomes growing from a patch or pillow of mycelium
were considered as exhibiting mycelia at the base of the stipe. The mycelial growth was always ©
conspicuous and found above the substrate; this mycelium covers the base of the stipe and exhibits
different types of generative hyphae. Petersen (1988a) described subiculate as a patch of mycelia
in the substrate from where the basidiome grows, but Clémencon et al. (2004) restricted the term
subiculate to the thick layer of mycelia from which the corticioid basidiomes develop. We treat the
character as equivalent to what Petersen (1988a) denominates subiculate, but since Clémencon
et al. (2004) employed the term in a different manner, the descriptor subiculate is not used in the
present study. States: 0: present, 1: absent.

10.- Reaction of hymenium to iron salts. The reaction to iron salts is a widely used character in
the systematics of clavarioid fungi (Corner 1950; Donk 1964; Petersen 1978a, 1988a). The reagent
contains ferric chloride in a 10% aqueous solution (Petersen 1988a), and is applied directly to the
hymenium. A positive reaction is recognized by a color change to olive-green or gray-green. This
reaction is considered indicative of the presence of the compound pistillarine (Steglich et al. 1984).
A positive reaction to this reagent can exhibit other color changes due to the presence of distinct
compounds (Gill & Steglich 1987, Singer 1986). In the present study only positive reactions that
engendered olive-green or gray-green color changes were considered. Observations were made in
dryed exemplars. In our experience species with positive reaction in fresh material also react when
dry. States 0: positive, 1: negative.

11.- Carotenoid pigments in the basidiome. Along with sesquiterpinoids, carotenoids are the only
pigments present in the macromycetes derived from the mevalonate pathway (Gill & Steglich 1987,
Gill 2003). This character was coded as a nominal variable -sensu Hawkins (2000)- based on the
aviable information for the species considered since other types of coding would require additional
data about the specific metabolic pathways generating the compound (e.g. Barkman 2001). States
0: present, 1: absent.

Micromorphological characters distinct from the hymenium and the spores

12.- Lacticiferous hyphae. This structure corresponds to what Singer (1986) described as lacticiferous
in the strict sense -hyphae that produce latex. These hyphae can exhibit nuclei and septa and thus
correspond to a specialized type of heteroplera sensu Clémencon et al. (2004). States 0: present, 1:
absent.

13.- Inflated hyphae. Inflated hyphae are those generative hyphae that exhibit increased growth
behind the point of lateral growth, widening and elongating significantly (Corner 1950, Kirk et al.
2001). They are recognizable by having a considerably greater diameter than the rest of the hyphae,
and by having constrictions in the zone of the septa; they may or may not have clamp connections.
Corner (1950) distinguished two types of monomitic contexts that present inflated hyphae based
on the presence of secondary septa and clamps. In the present study this classification was not used,
since it mixes two independently varying characters. States: 0: present, 1: absent.

14.- Crystals in the hyphae of the basal mycelia. The hyphae of the mycelia at the base of the stipe
sometimes present amorphous crystals, similar to those reported in the context of the base of the
stipe for Ramariopsis pulchella (Petersen 1988a) -5-20um, hyaline or yellowish, and do not dissolve

281

in 5% KOH. The crystals are found covering the exterior surface of the hyphae and are not easily
removed. States: 0: present, 1: absent.

15.- Degree of thickening in the hyphal wall. Thickening of the hyphal wall was considered only
in the generative hyphae. The presence of generative hyphae with thickened walls has been a
relevant systematic character in several genera (Corner 1966, Pegler 1996). In the present study
three qualitative degrees of thickening were recognized due to the difficulty in making precise
quantitative measurements. States: 0: none, 1: scarce, 2: conspicuous.

16.- Simple fibulae. Simple fibulae -clamp connections, clamp cells— are frequently observed in
Basidiomycetes. Clémencon et al. (2004) recognized three types of simple fibulae, of which two were
observed in the present study: closed and ring or medallion fibulae. Both types were considered
equivalent since there were insufficient elements to determine discrete states, due the continuous
variation observed. States: 0: present, 1: absent.

17.- Geniculate fibulae. Geniculate fibulae are those that exhibit a marked bend at the point of
inflection, giving the appearance of a bent knee. The bend partially deforms the profile of the
fibulae, allowing them to be easily differentiated from simple fibulae. These structures correspond
to those described in various species of Clavulinopsis by Petersen (1968). Geniculate fibulae are
not homologous to simple fibulae since both structures are found simultaneously in the same
basidiome and are thus independent characters according to the conjunction test (Patterson 1988,
Rieppel 1988, De Luna & Mishler 1996, Rieppel & Kearney 2002, Grant & Kluge 2004). States: 0:
present, 1: absent.

18.- H connections. These connections are structures formed by the union of two parallel hyphae
through a third, transverse, hypha. They can be considered functional homologous -biologically
homologous following Roth (1988)- to fibulae, but are not phylogenetically homologous sensu de
Pinna (1991), since they are both present simultaneously with distinct types of fibulae. They should
thus be considered independent characters following the conjunction test (Patterson 1988, Rieppel
1988, De Luna & Mishler 1996, Rieppel & Kearney 2002, Grant & Kluge 2004). States: 0: present,
1: absent.

19.- Ampulliform fibulae. This type of fibula is characterized by the presence of a marked widening,
giving the appearance of an inflated fibula similar to the inflated hyphae. This corresponds to the
description by Petersen (1988a) as a characteristic of Ramaria subg. Lentoramaria Corner. This
type of fibula is not phylogenetically homologous to the other types of fibulae described since it can
be found present simultaneously with those other structures and should therefore be considered
as an independent character by the conjunction test (Patterson 1988, Rieppel 1988, De Luna &
Mishler 1996, Rieppel & Kearney 2002, Grant & Kluge 2004). States: 0: present, 1: absent.

Hymenial characters

20.- Subhymenium clearly differentiated. The subhymenium was considered to be the layer of
generative hyphae growing below the hymenium (Kirk et al. 2001) and from which the hymenium
forms (Petersen 1988a). Several distinct anatomical patterns of the subhymenium have been
described (Clémencon et al. 2004), and in the case of the clavarioid fungi, Petersen (1988a)
considered three types. The variation observed in the present study; did not permit differentiation
of distinct types of subhymenium; only the conspicuous presence or absence of a subhymenium
was considered. States: 0: present, 1: absent.

21.- Thickening of the hymenium. Corner (1950) described the thickening of the hymenium as
a pattern resulting from the sympodial growth of the hyphae of the subhymenium, generating
successive superimposed layers of hymenium, collapsing the preceding basidia. No additional
patterns of variation of this type have been described to date, and in the present study no further
variation was observed. States: 0: present, 1: absent.

282

22.- Cystidia of the hymenium. Cystidia are sterile hyphal apices, generally with a distinctive form
and found in variable locations in the basidiome (Kirk et al. 2001, Clémencon et al. 2004). The
form and anatomic disposition of the cystidia have been used as taxonomic characters, but only the
cystidia in the hymenium were considered for the present study, as no other cystidia were observed
in the species studied. States: 0: present, 1: absent.

23.- Fibulate basidia. Clamp connections on basidia are restricted to the base of the basidia. The
presence on the basidia is independent of the presence of fibulae in the rest of the hyphae of the
basidiome. As such, it was considered as an independent character. In the case of Clavaria subgenus
Holocoryne the basidia exhibit a fibula described as broadly free (Corner 1950) or bifurcated
(Petersen 1988a). States: 0: present, 1: absent.

24.- Basidia with refringent contents. This character refers to basidia with an oily, yellowish,
appearance of its content, which is homogeneous and refringent in 10% KOH. It corresponds
partially to what Petersen (1988a) described as gloeoplerotic, excluding the foamy appearance.
Similarly, it corresponds partially to what Clémencon et al. (2004) described as oil-producing -
resinous content- and to what Singer (1986) describes as oil-producing sensu Fayoid, but without
the positive sulfovainillin reaction. States: 0: present, 1: absent.

25.- Shape of the basidia. The variation observed during the present study permitted recognition
of two forms or general profiles of basidia: cylindrical and clavate. These terms correspond to the
definitions of Kirk et al. (2001). States 0: clavate, 1: cylindrical.

26.- Base of clavate basidia. Clavate basidia exhibit variation in the size of the base. Variation of
the size was coded as an independent character because it refers to a property or feature of an
anatomical region particular to clavate basidia and is not homologous with terete basidia (de Pinna
1991, De Luna & Mishler 1996, Rieppel & Kearney 2002, Grant & Kluge 2004). Additionally, this
coding reflects the variation observed as it describes properties with independent variation. The
size of the basidia exhibits variation logically independent of the form and thus can be coded as
an independent character (Hawkins et al. 1997, Hawkins 2000, O’Keefe & Wagner 2001, Rieppel &
Kearney 2002). States 0: short, 1: long.

27.- Geniculate basidia. These basidia exhibit a point of inflection in the middle part, and thus a
marked bend giving the appearance of a flexed knee. This bend conspicuously deforms the profile
of the basidia allowing them to be clearly differentiated. This pattern corresponds to that described
in various species of Clavulinopsis by Petersen (1968). Geniculate basidia do not constitute a
pattern or form homologous in the phylogenetic sense (de Pinna, 1991), since both structures are
simultaneously present in the same basidiome and thus constitute independent characters by the
conjunction test (Patterson 1988, Rieppel 1988, De Luna & Mishler 1996, Rieppel & Kearney 2002,
Grant & Kluge 2004). States: 0: present 1: absent.

28.- Orientation of the achromatic spindle. Juel (1898) described two basic patterns of orientation
of the meiotic spindle of basidia during meiosis: chiastic -transversal to the principal axis and
situated in the apex- and stictic —parallel to the principal axis and situated in the middle. Boidin
(1958) recognized an intermediate pattern that he called hemichiastic; Donk (1964) later qualified
this as a homologous variant of the chiastic form. In the present study only the chiastic and stictic
patterns were considered, given that those are the only patterns reported for the species studied.
States: 0: chiastic, 1: stictic.

29.- Four remaining nuclei. After meiosis a third nuclear division sometimes occurs, producing a
total of eight nuclei. In some species four of these nuclei disintegrate and are termed remaining
nuclei (Penancier 1961). This pattern has been reported for several of the species considered in the
present study and corresponds to that described as post-meiotic pattern “A” by Duncan & Galbraith
(1972) and to that described by Kiihner (1977). The data available for the species considered in

283

the present study only allowed recognition of the presence of a third division -exhibiting pattern
“A’— and the absence of this division (only four nuclei form); this character was thus coded as a
nominal variably (Hawkins 2000). States: 0: present, 1: absent.

Characters of the basidiospores

30.- Spore form. The variation observed during the present study allowed the recognition of three
spore forms: globose, subglobose, and elongate. States were assigned qualitatively, excluding the
deformations produced by ornamentation when present, and correspond to the forms described
by Kirk et al. (2001), except for the fusiform and ellipsoid forms, which are considered as elongated
spores. States: 0: subglobose, 1: globose, 2: elongate.

31.- Size of the hilar appendix. The hilar appendix -also called the apicule, sterigmal appendix
or apophysis (Kirk et al. 2001, Clémencgon et al. 2004)- is the small conical or papilla-shaped
projection, which is the point of connection between the spore and the sterigma. This structure
is involved in the active liberation of the spores (Clémencon et al. 2004). Based on the observed
variation in the species studied, two qualitative states were recognized to describe the size of the
appendix. States: 0: prominent, 1: inconspicuous.

32.- Thickness of the spore wall. The species considered in the present study do not exhibit significantly
thickened spore walls, but some species show a slight thickening. Based on the observed variation
two qualitative states were recognized. States: 0: slightly thickened, 1: thin.

33.- Smooth spores. Spore ornamentation has been a relevant taxonomic character for Ramariopsis
(Corner 1950), but several studies have shown that ornamentation can be derived from different
layers of the spore wall. Treating the presence of ornamentation as homologous in different taxa
could thus fail the test of similarity (Rieppel 1988, Nelson 1994, Rieppel & Kearny 2002). The
presence of smooth spores -spores without modifications or deformations in the wall- was
observed in preparations mounted in 5% KOH using a bright field light microscope at 1000x
magnification. States: 0: present, 1: absent.

34.- Ultrastructure of spore ornamentation. The spore wall has been characterized in different studies
using different sources of information -light and electron microscopy- that generated different
terms to denominate the observed ultrastructural patterns (Clémencon et al. 2004). It is known
that seemingly similar forms can exhibit different ultrastructural patterns (Clémencon et al., 2004),
and as such regarding these forms as homologous sensu de Pinna (1991) would be incorrect by
the test of similarity (Rieppel & Kearney 2002, Grant & Kluge 2004). Based on this knowledge, the
ultrastructure of the ornamentation was coded instead by the morphological patterns observed. In
the present study the nomenclature of Pegler & Young (1985) was used, which also corresponds to
the descriptions of Hawksworth et al. (1995). States: 0: tunica, 1: corium.

35.- Cyanophilous reaction of the spores. For the present study a cyanophilous reaction was
considered positive when the wall of the spore stains with cotton blue, following the nomenclature
proposed by Kotlaba & Pouzar (in Donk 1964). During the present study the reagent was prepared
dissolving 1.6 g of cotton blue in 10 ml of lactic acid. After adding the reagent, the preparation was
heated until boiling and then left to cool for 10 minutes before observations were made. States: 0:
positive, 1: negative.

36.- Pattern of cyanophylly in the spores. The positive reaction to cotton blue (cyanophylly)
exhibits two patterns of coloring: homogeneous or more intense in the ornamentation. States: 0:
homogeneous coloring, 1: ornamentation more cyanophilous.

284

0 I 0 Z = I I 3 I I I I 0 - cee | 0 I suaasayjvd uosodouydrg
Saas oe eg ee es oe ee ae a es y Coe et ea feo bE ee eS ne en pee
ee: abe pe ee ae eae eee ear re mee sy eg ee a eae sacs ee
even Ce eee eae Ge eo es a a oe Be Se eee ete Sete
852 eh Eo ae Soe ea ee ee Se aah ea oS Peg ee ey eae a i ae
hace oe ee ee a eS ee ee ee ooo en ae eee Sao a ep Gn ones
yes t= iS Saar Ge Ce eee Eas Soe pee ore ea Sa as Bo. tet eee
Are eee RD eee ee oe vee fe pee oe ae ees a AE ae ee
es Ree Geo Se ee a ery ae vee oe Seer er se ee St ea ae

I I
0 I
I I
0 0
0 0
0 0
0 I
0 0 0
I 0 I

0 - I 0 I € 0 SILDINIIWLAIA DIADADID
ee Begs ae oe eo ao Soe tee a saps Gp eee ee a ga ee ge
eS ee ee er ee a ee ee ea a eer fee ee oe Sea ro
ao” 0 0 € 0
eo a < ooe oo ears a ee ee eae ees : : i : Be eat

6 G 14 I

‘T xipuaddy aas saqeis Jajereyp pur siajereyp oy Jo uordisdsap JoJ “eyep afqeotddeut = — ‘eyep SUISSIU = 3
"s1ajoeIeYyO 9¢ pure satdads €Z dU} OF XIJeU ee °Z 9IQUI,

xlujyew e}eq °7 XIpueddy

285

i=)

SK)

i=)

suaasayod uosodouyArg

i>)
i=)

ofS

pyjayand sisdo1swuoy

j=)

panuljuoo ‘Z 2190].

286

Appendix 3. Checklist of species names.

Part 1. Species of Ramariopsis sensu stricto

Ramariopsis asterella (G.F. Atk) Corner
= Clavaria asterella G.F. Atk.
Ramariopsis avellanea R.H. Petersen
Ramariopsis avellaneainversa R.H. Petersen
Ramariopsis biformis (G.F. Atk.) R.H. Petersen
= Clavaria biformis G.F. Atk.
Ramariopsis californica R.H. Petersen
Ramariopsis cinnamomea R.H. Petersen
Ramariopsis cinnamomipes R.H. Petersen
Ramariopsis citrina Schild
Ramariopsis clavuligera (R. Heim) Corner
= Clavaria clavuligera R. Heim
Ramariopsis costaricensis L.D. Gomez
Ramariopsis crocea (Pers.) Corner
= Clavaria crocea Pers.
Ramariopsis curta (Fr.) Corner
= Clavaria curta Fr.
Ramariopsis flavescens R.H. Petersen
Ramariopsis hibernica Corner
Ramariopsis kunzei (Fr.) Corner
= Clavaria kunzei Fr.
Ramariopsis longipes R.H. Petersen
Ramariopsis novahibernica Corner
Ramariopsis pulchella (Boud.) Corner
= Clavaria pulchella Boud.
Ramariopsis ramarioides R.H. Petersen
Ramariopsis rufipes (G.E. Atk.) R.H. Petersen
= Clavaria rufipes G.F. Atk.
Ramariopsis subarctica Pilat
Ramariopsis tenuicula (Bourdot & Galzin) R.H. Petersen
= Clavaria tenuicula Bourdot & Galzin
Ramariopsis tenuiramosa Corner
Ramariopsis tortuosa R.H. Petersen
Ramariopsis vestitipes (Peck) Corner
= Clavaria vestitipes Peck

Part 2. Species sometimes placed in Ramariopsis that belong in other genera

Clavaria L.
Clavaria asperulospora G.F. Atk.
= Ramariopsis asperulospora (G.E. Atk.) Corner

Clavulinopsis Overeem

Clavulinopsis antillarum (Pat.) Garcia-Sandoval & Cifuentes, comb. nov.
= Clavaria fusiformis var. antillarum Pat.
= Ramariopsis antillarum (Pat.) R.H. Petersen

Clavulinopsis corniculata (Schaeff.) Corner
= Clavaria corniculata Schaeff.

287

= Ramariopsis corniculata (Scaeff.) R.H. Petersen
Clavulinopsis depokensis (Overeem) Corner

= Clavaria depokensis Overeem

= Ramariopsis depokensis (Overeem) R.H. Petersen

Clavulinopsis dichotoma (Godey) Corner

= Clavaria dichotoma Godey

= Ramariopsis dichotoma (Godey) R.H. Petersen
Clavulinopsis fusiformis (Sowerby) Corner

= Clavaria fusiformis Sowerby

= Ramariopsis fusiformis (Sowerby) R.H. Petersen
Clavulinopsis helvola (Pers.) Corner

= Clavaria helvola Pers.

= Ramariopsis helvola (Pers.) R.H. Petersen
Clavulinopsis holmskiodii (Oudem.) Corner

= Clavaria holmskiodii Oudem.

= Ramariopsis holmskiodii (OQudem.) R.H. Petersen
Clavulinopsis laeticolor (Berk. & M.A. Curtis) R.H. Petersen

= Clavaria laeticolor Berk. & M.A. Curtis

= Ramariopsis laeticolor (Berk. & M.A. Curtis) R.H. Petersen
Clavulinopsis luteo-ochracea (Cavara) Corner

= Clavaria luteo-ochracea Cavara

= Ramariopsis luteo-ochracea (Cavara) R.H. Petersen
Clavulinopsis luteotenerrima (Overeem) Corner

= Clavaria luteotenerrima Overeem

= Ramariopsis luteotenerrima (Overeem) R.H. Petersen
Clavulinopsis minutula (Bourdot & Galzin) Corner

= Clavaria minutula Bourdot & Galzin

= Ramariopsis minutula (Bourdot & Galzin) R.H. Petersen
Clavulinopsis subtilis (Pers.) Corner

= Clavaria subtilis Pers.

= Ramariopsis subtilis (Pers.) R.H. Petersen
Clavulinopsis umbrinella (Sacc.) Corner

= Clavaria umbrinella Sacc.

= Ramariopsis umbrinella (Sacc.) R.H. Petersen

Ramaria Fr.

Ramaria lorithamnus (Berk.) R.H. Petersen
= Clavaria lorithamnus Berk.
= Ramariopsis lorithamnus (Berk.) Corner

Scytinopogon Singer
Scytinopogon dealbatus (Berk.) Corner
= Clavaria dealbata Berk.
= Ramariopsis dealbata (Berk.) R.H. Petersen

Part 3. Species initially described in Ramariopsis that require further examination

Ramariopsis agglutinata R.H. Petersen
Ramariopsis alutacea R.H. Petersen
Ramariopsis aurantio-olivacea R.H. Petersen
Ramariopsis bicolor R.H. Petersen
Ramariopsis cremicolor R.H. Petersen

288

Ramariopsis junquillea R.H. Petersen
Ramariopsis lignicola R.H. Petersen
Ramariopsis ovispora R.H. Petersen
Ramariopsis pseudosubtilis R.H. Petersen
Ramariopsis simplex R.H. Petersen

References

Arpin N, Fiasson J-L. 1971. The pigments of basidiomycetes: their chemiotaxonomic interest. In:
Petersen RH (ed.). Evolution in the higher Basidiomycetes: An international symposium. The
University of Tennessee Press, Knoxville.

Barkman TJ. 2001. Character coding of secondary chemical variation for use in phylogenetic
analyses. Biochem. Syst. Ecol. 29: 1-20.

Bataile F. 1969. Les reactions macrochimiques chez les champignons. J. Cramer, Vaduz.

Bertagnolli R, Novello LA. 2004. Su alcune Clavariaceae interessanti. Rev. Mycol. 48: 3-24.

Binder M, Hibbett DS. 2002. Higer-level phylogenetic relationships of Homobasidiomycetes
(mushroom forming fungi) inferred from four rDNA regions. Mol. Phyl. Evol. 22: 76-90.

Boidin J. 1958. Essai biotaxonomique sur les hydnés résupinés et les corticiés: etude spéciale du
comportement nucléaire et des mycéliums. Rev. Mycol. Mém. 6: 1-387.

Boddy L. 1999. Saprophytic cord-forming fungi: meeting the challenge of heterogeneous
environments. Mycologia 91: 13-32.

Bremer K. 1994. Branch support and tree stability. Cladistics 10: 295-304.

Brower AVZ, Schawaroch V. 1996. Three steps in homology assessment. Cladistics 12: 265-272.

Cairney JWG, Jennings DH, Agerer R. 1991. The nomenclature of fungal multi-hyphal linear
aggregates. Crypt. Bot. 2: 246-251.

Carpenter JM. 1988. Choosing among equally parsimonious cladograms. Cladistics 4: 291-296.

Carpenter JM. 1994. Successive weighting, reliability and evidence. Cladistics 10: 215-220.

Claus G. 1983. L ancient genere Clavaria Fr. (ss. lato B.-C.). Docs. Mycol. 13: 17-43.

Clémencon H, Emmett V, Emmett EE. 2004. Cytology and plectology of the Hymenomycetes.
J. Cramer, Berlin.

Coker WC. 1923. The clavarias of the United States and Canada. The University of North Carolina
Press, North Carolina.

Corner EJH. 1950. A monograph of Clavaria and allied genera. Ann. Bot. Memm. 1: 1-740.

Corner EJH. 1957. Some clavarias from Argentina. Darwiniana 11: 193-206.

Corner EJH. 1966. A monograph of cantharelloid fungi. Oxford University Press, Oxford.

Corner EJH. 1967a. Clavarioid fungi of Solomon Islands. Proc. Linnean Soc. Lond. 178: 91-106.

Corner EJH. 1967b. Notes on Clavaria. Trans. Brit. Mycol. Soc. 50: 33-44.

Corner EJH. 1970. Supplement to “A monograph of Clavaria and allied genera’ J. Cramer,
Stuttgart.

De Luna E, Mishler B. 1996. El concepto de homologia filogenética y la seleccién de caracteres
taxondomicos. Bol. Soc. Bot. Mex. 59: 131-146.

De Pinna MCC. 1991. Concepts and test of homology in the cladistic paradigm. Cladistics 7:
367-394.

DeBry RW, Olmstead RG. 2000. A simulation study of reduced tree-search effort in bootstrap
resampling analysis. Syst. Biol. 49: 171-179.

Dentinger BC, McLaughlin DJ. 2005. Homoplastic surgery: reconstructing the classification of two
coral mushroom families (Clavariaceae and Pterulaceae) Inoculum 56: 16.

289

Donk MA. 1933. Revision der Niederlandischen Homobasidiomycetae—Aphyllophoraceae II.
Mededeel. Bot. Mus. Herb. Rijksuniv. Utrecht 9: 1-278.

Donk MA. 1954. The generic names proposed for Hymenomycetes III. Clavariaceae. Reinwardtia
2: 441-493.

Donk MA. 1964. A conspectus of the families. of Aphyllophorales. Persoonia 3: 199-324.

Duncan EG, Galbraith MH. 1972. Post-meiotic events in the Holobasidiomycetidae. Trans. Brit.
Mycol. Soc. 60: 463-470.

Eriksson T. 1999. AutoDecay, version 4.0. Bergius Foundation, Royal Academy of Sciences.

Fiasson J-L, Petersen RH, Bouchez M-P, Arpin N. 1970. Contribution biochimique a la connaissance
taxonomique des certains champignons cantareloides et clavarioides. Rev. Mycol. 34: 357-364.

Farris JS. 1969. A successive approximation approach to character weighting. Syst. Zool. 18:
374-385.

Farris JS. 1983. The logical basis of phylogenetic analysis. In Platnic NI, Funk VA (eds.). Advances
in cladistics, Volume 2. Columbia University Press, New York.

Farris JS. 1991. Hennig defined paraphyly. Cladistics 7: 297-304.

Feibelman TP, Doudrick RL, Cibula WG, Bennett JW. 1997. Phylogenetic relationships within the
Cantharellaceae inferred from sequence analysis of the nuclear large subunit rDNA. Mycol.
Res. 101: 1423-1430.

Felsenstein J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution
LEW fats vad

Franz NM. 2005. On the lack of good scientific reasons for the growing phylogeny/ classification
gap. Cladistics 21: 495-500.

Frisvad JC, Bridge PD, Arora DK. 1998. Chemical fungal taxonomy. Marcel Dekker, New York.

Gill M. 2003. Pigments of fungi (Macromycetes). Nat. Prod. 20: 615-639.

Gill M, Steglich W. 1987. Pigments of fungi (Macromycetes). Prog. Chem. Org. Nat. Prod. 51:
1-317.

Garcia-Sandoval R, Villegas M, Cifuentes J. 2002. New records of Ramariopsis from Mexico.
Mycotaxon 82: 323-333.

Gomez LD. 1972. Fungi costarricense nonnulli, I.: “Clavariaceae” novae. Darwiniana 17: 393-396.

Grant T, Kluge AG. 2003. Data exploration in phylogenetic inference: scientific, heuristic, or
neither. Cladistics 19: 379-418.

Grant T, Kluge AG. 2004. Transformation series as an ideographic character concept. Cladistics
203237 34x

Hansen L, Knudsen H. 1997. Nordic macromycetes. Vol. 3. Heterobasidioid, Aphyllophoroid and
Gasteromycetoid Basidiomycetes. Nordsvamp, Copenhagen.

Hauser DL, Presch W. 1991. The effect of ordered characters on phylogenetic reconstruction.
Cladistics 7: 243-265.

Hawkins JA. 2000. A survey of primary homology assessment: different botanist perceive and define
characters in different ways. In Scotland R, Pennington RT (eds.). Homology and Systematics.
Taylor & Francis, London.

Hawkins JA, Hughes CE, Scotland RW. 1997. Primary homology assessment, characters and
character states. Cladistics 13: 275-283.

Hawksworth DL, Kirk PM, Sutton BC, Pegler DN. 1995. Ainsworth & Bisby’s Dictionary of the
Fungi. 8" ed. International Mycological Intitute, CAB International, Wallingford.

Hennig W. 1966. Phylogenetic systematics. University of Illinois Press, Urbana.

Hibbett DS, Pine E, Langer E, Langer G, Donoghue MJ. 1997. Evolution of gilled mushrooms
and puftballs inferred from ribosomal DNA sequences. Proc. Nati. Acad. Sci. USA 94:
12002-12006.

290

Hibbett DS, Thorn RG. 2001. Basidiomycota: Homobasidiomycetes. In McLaughlin DJ, McLaughlin
EG, Lemke PA (eds.). The Mycota VII. Systematics and Evolution. Part B. Springer, Berlin.
Hopple JSJ, Vilgalys R. 1999. Phylogenetic relationships in the mushroom genus Coprinus and
dark-spored based on sequence data from the nuclear gene coding for the large ribosomal

subunit RNA: divergent domains, outgroups, and monophyly. Mol. Phylogen. Evol. 13: 1-19.

Hubbard M, Petersen RH. 1979. Studies in basidial nuclear behavior of selected species of clavarioid
and cantharelloid fungi. Sydowia 8:209-223.

Humpert AJ, Muench EL, Giachini AJ, Castellano MA, Spatafora JW. 2001. Molecular phylogenetics
of Ramaria and related genera: evidence from nuclear large subunit and mitochondrial small
subunit rDNA sequences. Mycologia 93: 465-477.

Jenner RA. 2004. Accepting partnership by submission? Morphological phylogenetics in a
molecular millennium. Syst. Biol. 53: 333-342.

Juel HO. 1898. Die kernteilungen in den basidien un die phylogenie der Basidiomyceten. Jahrb.
Wiss. Bot. 32: 361-388.

Julich W. 1981. Higher taxa of the Basidiomycetes. J. Cramer, Leiden.

Jiilich W. 1985. Bemerkungen zu Clavulinopsis und Ramariopsis. Int. J. Mycol. Lichenol. 2: 119-
We

Kirk PM, Cannon PF, David JD, Stalpers JA. 2001. Ainsworth & Bisby’s Dictionary of the Fungi. 9"
ed. International Mycological Institute, CAB International, Wallingford.

Kluge AG. 2003. The repugnant and the mature in phylogenetic inference: atemporal similarity
and historical identity. Cladistics 19: 356-368.

Kiihner R. 1977. Variation of nuclear behaviour in the Homobasidiomycetes. Trans. Brit. Mycol.
Soc. 68: 1-16.

Larsson KH, Larsson E, Koljalg U. 2004. High phylogenetic diversity among corticioid
homobasidiomycetes. Mycol. Res. 108: 983-1002.

Limpscomb DL. 1992. Parsimony, homology and the analysis of multistate characters. Cladistics
8:45-65.

Mabee PM. 1993. Phylogenetic interpretation of ontogenetic change: sorting out the actual and
artefactual in an empirical case study of centrarchid fishes. Zool. J. Linnean Soc. 107: 175-291.

Mickevich ME. 1982. Transformation series analysis. Syst. Zool. 31: 461-478.

Mickevich MF, Limpscomb D. 1991. Parsimony and the choice between different transformations
for the same character set. Cladistics 7: 111-139.
Mort ME, Soltis PS, Soltis DE, Mabry ML. 2000. Comparison of three methods for estimating

internal support on phylogenetic trees. Syst. Biol. 49: 160-171.

Mueller GM, Ammirati JF. 1993. Cytological studies in Laccaria (Agaricales). II. Assesing
phylogenetic relationships among Laccaria, Hydnangium, and other Agaricales. Am. J. Bot. 80:
322-329.

Nelson G. 1994. Homology and systematics: the hierarchical basis of comparative biology. In Hall
BK (ed.). Homology. Academic Press, San Diego.

Nixon KC. 2002. WinClada ver 1.00.08 Published by the author, Ithaca.

Nixon KC, Carpenter JM. 1993. On outgroups. Cladistics 9: 413-426.

O’Keefe FR, Wagner PJ. 2001. Inferring and testing hypotheses of cladistic character dependence
by using character compatibility. Syst. Biol. 50: 657-675.

Patterson C. 1988. Homology in classical and molecular biology. Mol. Biol. and Evol. 5: 603-625.

Pegler DN, Young WK. 1985. Basidiospore structure in Ramariopsis (Clavariaceae). Trans. Brit.
Mycol. Soc. 84: 207-214.

Pegler DN. 1996. Hyphal analysis of basidiomata. Mycol. Res. 100: 129-142.

Penancier N. 1961. Recherches sur lorientation des fuseaux mitotiques dans la baside des
Aphyllophorales. Trav. Lab. La Jaysinia 2: 57-71.

Petersen RH. 1964. Notes on clavarioid fungi. II. Corrections in the genera Ramariopsis and
Clavaria. Bull. Torr. Bot. Club 91: 274-280.

Petersen RH. 1965. Notes on clavarioid fungi. IV. Nomenclature and synonymy of Clavulinopsis
pulchra and Clavaria laeticolor. Mycologia 58: 201-207.

Petersen RH. 1966. Notes on clavarioid fungi. V. Emendation and additions to Ramariopsis.
Mycologia 58: 201-207.

Petersen RH. 1967. Type studies in Clavariaceae. Sydowia 21: 105-122.

Petersen RH. 1968. The genus Clavulinopsis in North America. Mycologia Memm. 2: 1-40.

Petersen RH. 1969. Notes on clavarioid fungi. X. New species and type studies in Ramariopsis, with
a key to species in North America. Mycologia 61: 549-559.

Petersen RH. 1971a. Notes on clavarioid fungi. IX. Addendum to Clavulinopsis in North America.
Persoonia 6: 219-229.

Petersen RH. 1971b. Type studies on clavarioid fungi IV. Specimens from Herbarium Fries at
Uppsala. Friesia 9: 369-388.

Petersen RH. 1976. The correct name for the type species of Clavulinopsis. Taxon 25: 515-516.

Petersen RH. 1978a. Notes on clavarioid fungi. XV. Reorganization of Clavaria, Clavulinopsis and
Ramariopsis. Mycologia 70: 660-671.

Petersen RH. 1978b. The genus Ramariopsis in South-eastern Australia. Aus. J. Bot. 26: 425-431.

Petersen RH. 1978c. The genus Clavaria in South-eastern Australia. Aus. J. Bot. 26: 415-424.

Petersen RH. 1978d. Type studies in clavarioid fungi. V. A few Australian taxa. Mycotaxon 7:
386-392.

Petersen RH. 1979. Notes in clavarioid fungi XVII. Clavulinopsis taxa in south-eastern Australia.
Sydowia 32: 209-223.

Petersen RH. 1980a. Type studies in the Clavariaceae. V1. Four pivotal types from the Pacific
tropics. Mycotaxon 12: 281-216.

Petersen RH. 1980b. Type studies in clavarioid fungi. VI. The taxa described by Caspar van
Overeem. Reinwardtia 9: 415-420.

Petersen RH. 1984. Type studies in the clavarioid fungi VIII. Persoonia 12: 225-237.

Petersen RH. 1985. Notes on clavarioid fungi. XIX. Colored illustrations of selected taxa, with
comments on Cantharellus. Nova Hedwigia 42: 151-160.

Petersen RH. 1988a. The clavarioid fungi of New Zealand. DSIR Science Information Publishing
Centre, Wellington.

Petersen RH. 1988b. Notes on clavarioid fungi. XXII. Three interesting South American collections.
Mycologia 80: 571-576.

Petersen RH. 1989. Some clavarioid fungi from Northern China. Mycosistema 2: 159-173.

Petersen RH, Olexia PO. 1967. Type studies in the clavarioid fungi I. The taxa described by Charles
Horton Peck. Mycologia 59: 767-802.

Petersen RH, Olexia PD. 1969. Notes on clavarioid fungi. XI. Miscellaneous notes on Clavaria. Can.
J. Bot. 47: 1133-1142.

Pilat A. 1971. Species nova turficola generis Ramariopsis (Donk) Corner: Ramariopsis subartica sp.
nov. Ceska Mycol. 25: 10-11.

Pine E, Hibbett DS, Donoghue MJ. 1999. Phylogenetic relationships of canthareloid and clavarioid
Homobasidiomycetes based on mitochondrial and nuclear rDNA sequences. Mycologia 91:
944-963.

Poe S, Wiens JJ. 2000. Character selection and the methodology of morphological phylogenetics.

292

In Wiens JJ (ed.). Phylogenetic analysis of morphological data. Smithsonian Institution Press,
Washington.

Restivo JH, Petersen RH. 1976. Studies on nuclear division and behavior within basidial I. Hydnum
umbilicatum. Mycologia 68: 666-672.

Rieppel O. 1988. Fundamentals of comparative biology. Birkhauser Verlag, Basel.

Rieppel O, Kearney M. 2002. Similarity. Biol. J. Linnean Soc. 75: 59-82.

Roth L. 1988. The biological basis of homology. In Humphries CJ (ed.). Ontogeny and Hiab
Columbia University Press, New York.

Schild E. 1971. Fungorum rariorum icones colorate. Pars V. Clavariales. J. Cramer, Lehre.

Schild E. 1972. Ein seltener Korallenpilz. Z. Pilzk. 38: 23-29.

Singer R. 1945. New genera of fungi-II. Lloydia 8: 138-144.

Singer R. 1986. The Agaricales in modern taxonomy, 4" edition. Koeltz Scientific Books,
Koenigstein.

Steglich W, Steffan B, Stroech K, Wolf M. 1984. Pistillarin, ein charakteristischer Inhaltsstoff der
Herkuleskeule (Clavariadelphus pistillaris) und einiger Ramaria—Arten (Basidiomycetes). Zeit.
Natur. 39c: 10-12.

Swofford DL. 2002. PAUP*. Phylogenetic analysis using parsimony (*and other metods), version
4.0b10. Sinauer.

Thind KS. 1961. The Clavariaceae of India. Indian Council of Agricultural Research, New Delhi.

Templeton AR. 1983. Phylogenetic inference from restriction endonuclease cleavage site maps with
particular reference to the evolution of humans and apes. Evolution 37: 221-244.

Tyler VEJ. 1971. Chemiotaxonomy in the Basidiomycetes. In Petersen RH (ed.). Evolution in the
higher Basidiomycetes. The University of Tennessee Press, Knoxville: 29-58.

Villegas M, De Luna E, Cifuentes J, Estrada-Torres E. 1999. Phylogenetic studies in Gomphaceae
sensu lato (Fungi: Basidiomycetes). Mycotaxon 70: 127-147.

Wheeler QD. 2004. Taxonomic triage and the poverty of phylogeny. Phil. Trans. R. Soc. Lond.
B 359: 571-583:

Weinstein RN, Pfister DH, Iturriaga T. 2002. A phylogenetic study of the genus Cookeina. Mycologia
94: 673-682.

Wiens JJ. 2004. The role of morphological data in phylogeny reconstruction. Syst. Biol. 53:
653-661.

MYCOTAZXON

Volume 94, pp. 293-301 October-December 2005

A dichotomous key to Scutellospora species
(Gigasporaceae, Glomeromycota)
using morphological characters

GLADSTONE A. SILVA!; LEONOR C. MAIA’ & SIDNEY L. STURMER?

*leonorcmaia@yahoo.com. br
gladstonesilva@yahoo.com
‘Departamento de Micologia, CCB, UFPE
Av. Prof. Nelson Chaves, s/n, 50670-420, Recife, PE, Brazil

sturmer@furb.br
*Departamento de Ciéncias Naturais, FURB
Cx.P. 1507, 89010-971, Blumenau, SC, Brazil

- Abstract—A key to the genus Scutellospora (Order Glomerales, Phylum Glomeromycota)
is compiled based on the protologues of species descriptions and information on type
cultures of INVAM website.

Key words—arbuscular mycorrhizal fungi, Glomerales, identification, spore wall

Introduction

The genus Scutellospora was separated from the genus Gigaspora by Walker & Sanders
(1986) based on differences in germination characteristics, subcellular structure within
spores, and morphology of extraradical auxiliary cells. Weight was assigned most heavily
to germination properties, with germ tubes formed from the inner warty surface of the
spore wall in Gigaspora and from a novel germination shield formed on flexible layers
independent of the spore wall in Scutellospora. Etymology of Scutellospora affirms these
criteria, as the name derives from scutellum, or small shield. The germination shield
differentiates on a bi-layered flexible germinal wall unique to glomeromycotan fungi.
When more than one of these germinal walls are present, the germination shield forms
always on the innermost one. Cellular organization of spores consists of spore wall and
one to three of these flexible germinal walls in Scutellospora while only the spore wall
in Gigaspora species. Vegetative criteria for genus-level separation reside in auxiliary
cells, which have a knobby surface in Scutellospora and distinctly echinulate surface in
Gigaspora.

In their classification of arbuscular mycorrhizal fungi (AMF), Morton & Benny
(1990) placed Gigaspora and Scutellospora within the family Gigasporaceae, suborder
Gigasporineae and order Glomerales. Members of Gigasporaceae were grouped by
densely staining arbuscules, knobby coiled hyphae, unique soil-borne auxiliary cells
and formation of spores on unique sporogenous cells. Gigasporaceae currently is
grouped in the order Diversisporales (Schufler et al. 2001) which consists of an eclectic

294

mix of families with no discernible morphological evolutionary pattern as classified.
Therefore, at the order level, the morphological evolution conflicts with the 18S rRNA
gene sequence phylogeny. Patterns and processes in spore ontogenesis (Franke &
Morton, 1994; Morton, 1995) provided useful insights into the origins and boundaries
of spore subcellular characters for the family Gigasporaceae. These works provided the
foundation for reinterpretations and resolution of species-level characters. Stiirmer &
Morton (1999) subsequently described a new species, Scutellospora rubra, based on
spore ontogenetic data.

Species of Scutellospora are geographically widespread with a pandemic distribution.
Species of this genus have been reported from North America (Koske, 1987) South
America (Siqueira et al. 1989; Stiirmer & Bellei 1994; Yano-Melo et al. 2003; Silva et al.
2005), Europe (Blaszkowski 1989), Africa (Ba et al. 1996), Asia (Saito & Varga 1991)
and Australia (Koske 1975). Although they are commonly associated with hosts in
sand dunes, (Koske & Walker 1985, 1986; Koske & Gemma 1996; Blaszkowski 1991),
they also are found in other natural ecosystems such as West Java tropical rain forests
(Kramadibrata et al. 2000), Venezuela sclerophyllous shrublands (Herrera-Peraza et
al. 2001), USA tall grassland (Hetrick & Bloom 1983) and Germany alpine ecosystem
(Blaschke 1991), Brazil savanna-like “cerrado” (Walker & Diederichs 1989) and “caatinga”
vegetation (Souza et al. 2003) as well as in brazilian degraded areas (Yano-Melo et al.
2003; Silva et al. 2005). Nevertheless, species of Scutellospora have also been registered
from diverse agroecosystems (Hetrick & Bloom, 1983; Miller et al., 1985; Siqueira et al.,
1989; An et al., 1993).

Early keys for identification of arbuscular mycorrhizal fungi were developed by Hall &
Fish (1979) and Trappe (1982). Koske & Walker (1985) provided a key for a subset of
Scutellospora species with ornamented spore walls. With a substantial increase in the
number of new species described and the robust morphological delineation amongst
species, we deemed it an appropriate time to erect a more comprehensive dichotomous
key to Scutellospora.

Material and Methods

Morphological characters of Scutellospora were obtained from species protologues
and from descriptions of reference isolates in the International Culture Collection of
Arbuscular Mycorrhizal Fungi (INVAM, West Virginia University, WV) webpages
(http://invam.caf.wvu.edu/speciesID.htm). Nomenclature in species descriptions
was revised and standardized according to that proposed by Morton et al. (1995).
Of 32 described Scutellospora species, 25 were incorporated in the key. The seven
unincorporated species were S. alborosea, S. gilmorei, S. minuta, S. nigra, S. reticulata,
S. savannicola and S. tricalypta, all of which were described before any standardized
terminology for spore structures was developed (Walker 1983). For the 25 species
considered in the key, characters of 14 species were obtained from INVAM web pages
and 11 from published species descriptions. Wherever possible, color designations (e.g.,
0/20/40/0) were based on the CMYK model (Cyan, Magenta, Yellow and Black) used
as the basis for the INVAM color chart (http://invam.caf-wvu.edu/otherinfo/articles/
colorchart.htm). Spelling of names follows recommendations of Walker & Trappe
(1993).

295

Results

DICHOTOMOUS KEY TO SOME SCUTELLOSPORA SPECIES

bay operes WilirOne Cerilinal Wall sre areata er att ieee rte. ater sree ee Es 2
PDs Vokes WiLuaiOre Lialoire Serminalawalla. a tieeiiietes ca lue. Needs, care rounn 2 omens 8
2avdayouriacei@hsporeiwallismootn cs BS of pir eae Hee tea lier teeth: . 2 3
Zbrourtace O1 spore wall ornamnentediaie. Oe Uy tre see eee) ate. Welt tree, 4

3a. (2a) Spores pale (0/0/5/0) to slightly darker cream (0/0/40/0) in color, with mean
diameter of 180 um (range 120-240 um), second layer (L2) of the spore wall 4.5-6

in rane a anal cy aaah Rhea hy CARP, cep heresnaty em + gs Arua se raed ayes Shanty Bd te, Mescort coe S. fulgida
3b. Spores chestnut (0/40/100/0) in color, with mean diameter of 300 um, second layer
PLZ OrspOLe Wall LU-2 orth) COlcKwaes ae corre gees ce eee a ona S. castanea
4a+@2b)sporewwall ornamented with \wartsweliad jab Hoe WAS) Ales oe a ee oe eee cle 5

4b. Spore wall ornamented with blunt tapering projections 1-3 um wide and 2 um high,
L2 of the spore wall swelling in acidic mountants and turning dark red-brown in
IMielZers TeAVelbins a5 gat hang aah fea be de Te se 4S oo ARs Fe EA S. biornata

5a. (4a) Color of mature spore ranging from pale-straw (0/10/10/0) to orange-brown

(0/60/100/0) or pale to dark copper (0/60/100/0 to 20/80/60/0).............. 6
5b. Color of mature spore darker than above, ranging from red-brown (20/80/100/10)
FORALL = DOW 1h (40/ D0) SU). O anne eee etna etn eee re ee Rent fa 7

6a. (5a) Spores pale to dark copper to darker cream color (20/60/70/10), 240-360 um in
diameter (mean = 313 um) with surface covered by rounded warts 0.5 um wide
and,0.2-0,5humi high 7.4%). Sse. Geidia Sarees Soe 22 PY eh ark ete S. persica
6b. Spores pale straw to orange brown, 220-360 um in diameter (mean = 308 um), with
surface covered with tightly packed warts < 1 um apart, 0.5-1.0 um wide and 0.5-
Tttimthigh MEG es SIYOIE | WOW ie YOUN ROOTS TOI. S. verrucosa

7a. (5b) Spore size of 260-480 um (mean = 362 um), spore surface covered with flattened

warts with angular margins (2-12 «um wide and 1-3 um high)...... S. coralloidea
7b. Spore size of 380-520 um (mean = 473 um), spore surface ornamented with rounded

warts (11-26 um wide and 3-7 um high)..... 5 ee tigate sear ote in Seach S. gregaria
San( LD) eporeswitntworcerminaliwallswaie orn ee ina et cro. eat lee anny Je 9
Sbyppores.withthree sermimalwwallsie yeaa toin? eae Otc es See EE rosea: + 24
Dar on moUliace OUSDOre WALL SLMOOL Agate aan teh ge to emnen ary secon a oe hee 10
Sb. Surtace-olspare WalkornamMented wat. Si ae EEN na eee eee nee oe. <. 18

10a. (9a) Spores pale to dark orange-brown (0/60/100/0) to red-brown (20/80/100/0)

10b. Spores lighter in color than above, color ranging from white/hyaline or pale yellow
(S/0/20/0)towvellows(0/04100/0) ane.) a. eeberse.e Weleers-reurese.. nrde: 12

226

lla. (10a) Spore size of 140-220 um (mean = 180 ttm). Second layer (L2) of the spore
wall 3.5-12 um thick staining dark red black (20/80/70/10) in Melzer’s reagent.
Second layer of germinal wall 2 is 0.6-1.4 um thick staining pale pinkish purple
(0/20/20/0) to darker pinkish purple (20/40/20/0) in Melzer’s reagent .. S. rubra

11b. Spore size of (200-) 240 (-360) x (180-) 230 (-290) um (mean = 235 um). Second
layer (L2) of the spore wall 0.8 -2.2 um not reacting in Melzer’s reagent. Second
layer of germinal wall 2 is 3 - 4 up to 25 um thick, with amorphous characteristics,

staining reddish purple (20/80/20/0) in Melzer’s reagent......... S. hawaiiensis
1247(10b) Spore wall not-reacting,in: Melzers reagent ¢: (Gia \io-giay. sete 1ae ta 13
12b; Spore wall reacting in: Melzercirea gent, Ve mete Ut) Os I) HD ema. 8. 15

13a. (12a) Spores pale yellow with a greenish tint (5/0/20/0). Spore size ranging from
120-240 um. Second layer (L2) of spore wall finely laminated, ranging from 1.8-
4.2 um thick. Germinal wall 2 reacting in Melzer’s reagent................... 14

13b. Spores pale yellow (5/0/20/0) to yellow (0/0/100/0) without a greenish tint. Spore
size ranging from 320-440 x 320-470 um. Second layer (L2) of spore wall coarsely
laminated, ranging from 6 -16 um thick. Germinal wall 2 not reacting in Melzer’s
REAG EI re th er a er gh a oan Nae ee ae S. aurigloba

14a. (13a) Spores with germinal wall 1 consisting of one hyaline layer 0.6-1.0 um thick,
staining light pink (0/20/20/0) in Melzer’s reagent and often adherent to spore
wall. Second layer (L2) of germinal wall 2 staining red-purple (20/80/20/0) to dark
red-purple.(40/80/60/0) 6. cys). oocyte Sedna ae S. dipurpurescens

14b. Spores with germinal wall 1 consisting of two hyaline adherent layers that together
are 0.9-2.0 um thick. Second layer (L2) of germinal wall 2 staining red-purple

(20/80/20/0) to dark red-purple (40/80/60/0) .................-.. S. calospora

15a. (12b) Spore color hyaline/white to pale pink (0/30/20/0) to deep pink (0/40/20/0)
RP OT Ce AS ier RNIN RUN Ea ORS NE RTS LT aca init Nae. Ilion a Ht 16
15b. Spore color apricot yellow and yellow brown (0/5/40/0) to orange brown
(0/60/45 OO/0) Ue tes geet recat ute Sa ONE cs tate? Sam aro Ore ere ae 17

16a. (15a) Spore color pale pink (0/30/20/0) to deep pink (0/40/20/0), turning hyaline
when the pink color fades. Spore wall color turns yellowish with a greenish tint
(0/0/80/). Second layer of germinal wall 2 turns pale pink (0/20/20/0) to light
purple(20/40/20/0)"nsMelzersTéagent her eet ee S. weresubiae

16b. Spore color hyaline/white. Spore wall: first layer (L1), hyaline, 1.8-5.0 um thick and
second layer (L2) 3.0-8.8 um thick. Spore wall turns dark red-purple (40/80/40/0)
to reddish-black (60/80/50/10) in Melzer’s reagent. Second layer (L2) of germinal
wall 2 with characteristics “amorphous” staining red purple (20/80/20/0) to dark
red purplen 40/80; 00/0) 1 WelZers Teagentn ta. cana wae enc S. pellucida

17a. (15b) Spore color apricot yellow to yellow brown (0/5/40/0). Spore wall turning
garnet red in Melzer’s reagent. Second layer (L2) of germinal wall 2 with
characteristics “amorphous” staining red purple (20/80/20/0) in Melzer’s reagent

ne Martie iat ioe chica ee tee ining a7 copgowree tur. | a wieteee Apa! Bahay hy ate h ab S. armeniaca

20)

17b. Spore color pale yellow-brown (0/10/20/0 to 0/10/60/0) to orange brown
(0/60/100/0). Spore wall turning dark red-brown in Melzer’s reagent. Second layer
(L2) of germinal wall 2 with characteristics “amorphous” staining dark reddish
purple(40780/40/0)in iMelzét's reagent). Aeneas Tee Lee L wath S. arenicola

18a. (9b) Spore color pale orange brown (0/60/80/0) and dark orange brown
MOL OURTUUL1 0) to FeceDrOw lin 20, OU) 100) O) a taeenae er ene mem ee 19

18b. Spore color lighter than above, ranging from hyaline/white, pale cream (0/10/40/0)
On cralile Cold t0/ 20/00) 0) see eee eee eee ed 20

19a. (18a) Spore surface ornamented with short rounded warts 1.0-2.5 um high. Second
layer (L2) of spore wall 5-9 um thick (mean = 7.4 um), staining dark red brown
(20/80/70/10)tmn Melzens reagent hs erne Bropees Anew: er S. heterogama

19b. Spore surface with two types of ornamentation: crowded small conical warts, 0.5-
1 um wide and 0.5-1.5 um high and hyaline, blunt, bacilliform large projections
1.5-3 um wide and 2-10 um high. Second layer (L2) of spore wall 3-8 um thick.
Reaction of spore wall to Melzer’s reagent unknown ............. S. dipapillosa

20a. (18b) Spore wall reacting on Melzer’s reagent turning dark red-purple (40/80/40/0)
eotreddish=black(60/80/50/:1 0) mec eee Re Sr eee Le VER RSE: eal

ZODTINOCIS ADOVC ne ee ee en ae ee 22

21a. (20a) Spore size of 220-380 um (mean = 300 um). Spore wall ornamented with
papilla rarely > 1 um high and 1-1.5 wm wide. Second layer (L2) of germinal wall
2 with characteristics of “amorphous” and stains red purple (20/80/20/0) to dark
rea punpie(40/80/60/0)andMelzers meavent aeiaia-i eer sad ac er S. cerradensis

21b. Spore size of 160-270 um (mean = 240 um). Spore wall ornamented with knobs
3.5 6.5um high and 7-10.5 um wide. Second layer (L2) of germinal wall 2 with
characteristics of “amorphous” and stains dark red purple (40/80/60/0) in Melzer’s
RCOGETI ES Ean oc Cee ANE ED ae Cee, Set PL, Ne ee S. nodosa

22a. (20b) Ornamentation of the spore wall 2-4 um high ........................ 23

22b..Ornamentation of the spore wall 3-6 um heigh and 3.6-10 um wide consisting of
dome-like sub-polygonal papillae. Spore wall not swelling in acidic mountants. L2
of the germinal wall 2 turning red purple (20/80/20/0) in Melzer’s reagent

LE per ae er ee ly ee ee pee an) eee Perro S. crenulata

23a. (22a) Spore ornamented with columnar protuberances 2-4 um long. Second layer
(L2) of germinal wall 2 staining purple (40/60/20/0) in Melzer’s reagent ...... S.
projecturata

23b. Spore ornamented with dense blunt spines 2-4 um long. Second layer (L2) of
germinal wall 2 staining red purple (20/80/20/0) in Melzer’s reagent............
S. spinosissima

24a. (8b) Spores hyaline/white to yellow brown (0/5/40/0) in older spores, 340-640 um
in diameter (mean = 495 um), with dark yellow-brown germination shield highly
contrasting with spore color. Spore wall not reacting in Melzer’s reagent. Second

298

layer (L2) of germinal wall 3 staining red purple (20/80/20/0) to dark red-purple
(40/80/60/O)iiniMielzers reagents, tysys fide ta taqevies bates nto hekle eerie S. scutata

24b. Spores red-brown (20/80/60/0) to dark red-brown (20/80/100/10), subglobose
to oblong, 160-320 um diameter (mean = 240 um). Spore wall not reacting in
Melzer’s reagent. Second layer (L2) of germinal wall 3 staining pinkish (0/40/20/0)
to pinkish purple(0/G0/S0/ 10) 2) wer toh pret tenis. 6. wea 4, eco S. erythropa

Discussion

This paper provides the first dichotomous key of Scutellospora since Koske & Walker's
key of approximately two decades ago for species with roughened (ornamented) spore
walls. The first character in the key is number of germinal walls present in the spore,
which can be readily detected by both beginning and experienced researchers once they
recognize the fundamental bi-layered organization of each wall. From there, properties
of spore wall layers (color, presence and type of ornamentation, etc.) discriminate
amongst species (Morton et al. 1995).

Spore wall structure was re-interpreted from published species descriptions of some
species according to developmental patterns (Morton et al. 1995). For example, Koske
& Walker (1985) described S. coralloidea, S. gregaria, S. verrucosa and S. persica as
possessing a hyaline, membranous wall. Developmental patterns indicate this structure
represents one germinal wall composed by two layers (Morton 1995). Based on this type
of comparison, S. hawaiiensis, S. aurigloba, S. weresubiae, S. dipapillosa, S. nodosa, S.
projecturata, S. spinosissima, S. arenicola and S. crenulata were considered to have two
germinal walls. To support this interpretation, Melzer’s reaction of germinal walls was
also considered. Scutellospora species with only one germinal wall shows no reaction in
Melzer’s (Morton, 1995) while those with two or three germinal walls have the second
layer of the innermost wall turning light to dark purple in Melzer’s reagent. For instance,
protologues of S. arenicola and S. crenulata are not straightforward about the number
of germinal walls, however, both become red purple in Melzer’s reagent; we therefore
interpreted these species as having two germinal walls. Establishment of these organisms
in single-species culture will help to clarify this interpretation.

The presence of one, two or three germinal walls defines groups of species within
Scutellospora. Within each group, new subgroupings emerge when considering
characteristics of spore wall and germinal wall. Therefore, within Scutellospora species
with one germinal wall, two subgroups are formed relative to ornamentation of spore
wall. One group is formed by S. fulgida and S. castanea, both of which have smooth
spore walls, whereas another group is formed by S. biornata, S. persica, S. verrucosa, S.
coralloidea and S. gregaria which produce a spore wall ornamented with blunt tapering
projection and warts. We are not suggesting that they represent new taxa (e.g., subgenus),
but this grouping is very useful during species identification.

Within Scutellospora species with two germinal walls, subgroupings based on spore
color and ornamentation also emerge. Therefore, there are species producing smooth
spore walls with dark spore color (e.g., S. rubra and S. hawaiiensis) and those with
pale spore color (e.g., S. aurigloba, S. dipurpurescens, S. calospora, S. weresubiae, S.
pellucida, S. armeniaca and S. arenicola). The third subgroup includes species producing

se al

222)

ornamented spores (S. heterogama, S. dipapillosa, S. cerradensis, S. nodosa, S. crenulata,
S. projecturata and S. spinosissima). The third large group within the genus includes
species differentiating three germinal walls like S. scutata and S. erythropa, which can
be readily separated from each other based on spore color and size (hyaline/white larger
spores in the former and red-brown smaller spores in the latter).

Differences among some species now described in the genus Scutellospora can be small
so that species boundaries are not clear. For example, the main difference between S.
dipurpurescens and S. calospora is the presence of one or two layers in the first germinal
wall, respectively. Spore size, color and Melzer’s reaction of germinal wall 2 are identical
between these two species. On the same token, differences between S. heterogama and
S. dipapillosa reside mostly on the very small type of ornamentation occurring on the
latter, a characteristic already noticed by Koske & Walker (1985). Some spores of S.
dipapillosa are identical to S. heterogama, while others that show the variation described
by Koske & Walker (1985) are present in parasitized spores — so the difference may
be an artifact of parasitism rather than a heritable difference (J.B. Morton, personal
communication). Scutellospora pellucida and S. armeniaca are also very similar and may
represent the same species; both have the same range of spore size and Melzer’s reaction
of spore wall and germinal wall 2 are identical. Spore color can be used with caution to
separate both species, as S. armeniaca produces spores apricot yellow and yellow brown
while S. pellucida are hyaline. However, spores from the latter can be pale yellow brown
when older or extracted from roots in pot cultures or from the field, the condition where
spores from the former were described (J.B. Morton, personal communication).

We proposed this dichotomous key to help mycorrhizologists to identify Scutellospora
species during field surveys or for establishing isolates in single-species cultures. We
are aware that interpretation of spore wall structure for some species might not be
adequate, especially those not established in monospecific culture. Therefore, we suggest
that for further species description, spore wall characteristics should be described
using nomenclature based on spore developmental model as proposed by Morton et
al. (1995).

Acknowledgments

This work is part of the thesis of the first author, who received a scholarship from CAPES/Brazil to
obtain the degree of Doctor in Mycology. Leonor C. Maia acknowledges the support from CNPq/
Brazil. We are grateful to Dr. Joseph B. Morton (West Virginia University, WV) and Dr. Stephen P.
Bentivenga (University of Oshkosh, WI) for helpful pre-submission reviews.

Literature Cited

An ZQ, Guo BZ, Hendrix JW. 1993. Populations of spores and propagules of mycorrhizal fungi in
relation to the life cycles of tall fescue and tobacco. Soil Biol. Biochem. 25: 813-817.

Ba AM, Dalpe Y, Guissou T. 1996. Les Glomales d’Acacia holosericea at d’ Acacia mangium. Bois et
Forets des Tropiques (250): 5-18.

Bentivenga SP, Morton JB. 1995. A monograph of the genus Gigaspora, incorporating developmental
patterns of morphological characters. Mycologia 87: 720-732.

Blaschke H. 1991. Distribution, mycorrhizal infection, and structure of roots of calcicole floral
elements at treeline, Bavarian Alps, Germany. Arctic Alp. Res. 23: 444-450.

300

Blaszkowski J. 1989. The occurrence of the Endogonaceae in Poland. Agriculture, Ecosystems and
Environment 29: 45-50.

Blaszkowski J. 1991. Polish Glomales VIII. Scutellospora nodosa, a new species with knobby spores.
Mycologia 83: 537-542.

Franke M, Morton JB. 1994. Ontogenetic comparisons of arbuscular mycorrhizal fungi Scutellospora
heterogama and Scutellospora pellucida: revision of taxonomic character concepts, species
descriptions, and phylogenetic hypotheses. Can. J. Bot. 72: 122-134.

Hall IR, Fish BJ. 1979. A key to the Endogonaceae. Trans. Br. Mycol. Soc. 73: 261-270.

Herrera-Peraza RA, Cuenca G, Walker C. 2001. Scutellospora crenulata, a new species of Glomales
from La Gran Sabana, Venezuela. Can. J. Bot. 79: 674-678.

Hetrick BAD, Bloom J. 1983. Vesicular-arbuscular mycorrhizal fungi associated with native tall
grass prairie and cultivated winter wheat. Can. J. Bot. 61: 2140-2146.

Miller DD, Domoto PA, Walker C. 1985. Mycorrhizal fungi at eighteen apple rootstock plantings in
the United States. New Phytol. 100: 379-391.

Morton JB, Benny GL. 1990. Revised classifiation of arbuscular mycorrhizal fungi (Zygomycetes): a
new Order, Glomales, two new Suborders, Glomineae and Gigasporineae, and two new Families,
Acaulosporaceae and Gigasporaceae, with an emendation of Glomaceae. Mycotaxon 37: 471-
491.

Morton JB. 1995. Taxonomic and phylogenetic divergence among five Scutellospora species based
on comparative developmental sequences. Mycologia 87: 127-137.

Morton JB, Bentivenga SP, Bever JD. 1995. Discovery, measurement, and interpretation of diversity
in arbuscular endomycorrhizal fungi (Glomales, Zygomycetes). Can. J. Bot. 73: 25-32.

Koske RE. 1975. Endogone spores in Australian sand dunes. Can. J. Bot. 53: 668-672.

Koske RE. 1987. Distribution of VA mycorrhizal fungi along a latitudinal temperature gradient.
Mycologia 79: 55-68.

Koske RE, Walker C. 1985. Species of Gigaspora (Endogonaceae) with roughned outer walls.
Mycologia 77: 702-720.

Koske RE, Walker C. 1986. Species of Scutellospora (Endogonaceae) with smooth-walled spores
from maritime sand dunes: two new species and a redescription of the spores of Scutellospora
pellucida and Scutellospora calospora. Mycotaxon 27: 219-235.

Koske RE, Halvorson WL. 1989. Scutellospora arenicola and Glomus trimurales: two new species in
the Endogonaceae. Mycologia 81: 927-933.

Koske RE, Gemma JN. 1996. Arbuscular mycorrhizal fungi in Hawaiian sand dunes: Tava of
Kauai. Pacific Sci. 50: 36-45.

Kramadibrata K, Walker C, Schwarzott D, Schiifler A. 2000. A new species of Scutellospora with a
coiled germination shield. Ann. Bot. 86: 21-27.

Saito M, Vargas R. 1991. Vesicular-arbuscular mycorrhizal fungi in some humus-rich Ando soils of
Japan. Soil Microorg. 38: 3-15.

Schuler A., Schwarzott D, Walker C. 2001. A new fungal phylum, the Glomeromycota: phylogeny
and evolution. Mycol. Res. 105: 1413-1421.

Siqueira JO, Colozzi-Filho A, Oliveira E. 1989. Ocorréncia de micorrizas vesicular-arbusculares em
agro e ecossistemas do estado de Minas Gerais. Pesq. Agropec. Bras. 24: 1499-1506.

Silva GA, Trufem SFB, Saggin-Junior OF, Maia LC. 2005. Arbuscular Stes fungi in a
semiarid copper mining area in Brazil. Mycorrhiza 15: 47-53.

Souza RG, Maia LC, Sales MF, Trufem SFB. 2003. Diversidade e potencial de infectividade de
fungos micorrizicos arbusculares em area de caatinga, na Regido de Xing, Estado de Alagoas,
Brasil. Rev. Bras. Bot. 26: 49-60.

301

Stiirmer SL, Bellei MM. 1994. Composition and seasonal variation of spore populations of
arbuscular mycorrhizal fungi in dune soils on the Island of Santa Catarina, Brazil. Can. J. Bot.

— -72: 359-363.

Stiirmer SL, Morton JB. 1999. Scutellospora rubra, a new arbuscular mycorrhizal species from
Brazil. Mycol. Res. 103: 949-954.

Trappe JM. 1982. Synoptic key to the genera and species of Zygomycetous mycorrhizal fungi.
Phytopathology 72: 1102-1108.

Walker C. 1983. Taxonomic concepts in the Endogonaceae: spore wall characteristics in species
descriptions. Mycotaxon 18: 443-455.

Walker C, Sanders FE. 1986. Taxonomic concepts in the Endogonaceae: III. The separation of
Scutellospora gen. nov. from Gigaspora Gerd. & Trappe. Mycotaxon 27: 169-182.

Walker C, Diederichs C. 1989. Scutellospora scutata sp. nov., a newly described endomycorrhizal
fungus from Brazil. Mycotaxon 35: 357-361.

Walker C, Trappe JM. 1993. Names and epithets in the Glomales and Endogonales. Mycol. Res. 97:
339-344.

Yano-Melo AM, Trufem SFB, Maia LC. 2003. Arbuscular mycorrhizal fungi in salinized and
surrounded areas at the Sao Francisco Submedium Valley, Brazil. Hoehnea 30: 79-87.

Pees =

a a -.

’ fore aii: ini te
vite oo

Re es 2 .
my AEC Se

a J. alaecie ON ay a
sucha can (eek ena eonprte
a

ay)» Meeeha Ws Viena mcr Sentient RUBS Oma Wa aoe anes
- > leucla spill ella-tancuapbet "aon et, eee a8eT AY evibited D oe

ot aoe athe oF ratoupvaealsl a bre eriteasi agar rnds ang herpes
ra ie napintas bisa Such es terstereataone nib 2) fi
| Cee Os ae Ce | nbewins mS apes (oes ne piso AMES A ewpatgetay ip i"
} “a te fer focal ioscan ast ties eotea, fees:
eg th prea Marniv dl Lists, Rien ahenattint hey! ater iy. ed i rth ai fon git< ‘port hots i.

we saeniar=y" Mi: ia ed ede io Yh S@seatyt oS 4 On won" )

| , @
eta aie ogi lanka oe seta, age iba resallnacr dite eoaiageeet abit napers, Mi)
iJ a
. ; 1 : : ‘7 se es r “4 ioe
vi». = Fi :
‘ evil { ¥ th, bam ane ie a eae bghyie af ment a he enuence a ofy rat ¢g fet ~ uated ait a? “0 cual edie
/ i ; F '
} ae pe yap e line argh ity neat Mp) Nuet, Nay caliogiage= ip Leiys niyo ieee i :
w ' © oie + et ‘J P ; ‘a. i ie bs i > oa) ate s re ‘ ‘ vf
* ere xa “res SY Biggar 1s G9 on owen; meni ttoeat, agit ing oy pki oe tt chvvisine: ai
a? ; Hi eal CiRDCer L ates Cari (Lecruaties, ay my ith Can L Nae eae ar Lh Sel
; 7 é . ‘ ° a mt
; y > * _ ting 7” a ; iA a \ ; ; ;
Pe apn Ph APH PPPS we Pha whi Cees Ait. 2. Bi. 52: A(%-8D : 5
i : ' 1 - oF _ : i : _
ies i be rn a, $7 retrihats af yay Mr ueiay jal igs db wis ci! ial leno Serpe Aur prada)
’ * , ;
, rises ph Cy-e4 3 é — af? aan:
Ly a 4 i LF ~ Lhe hy e : > yf : as if
i io: +. cP i, is ‘j= nas
iad Eien ais A Sage APES OE NEO af Wnbsehe Pie i with ovehnad joer Was... F
Ay oRyy? r | iiniy ae Qh ia ar is
} J 4 i a , s 7 :
. ' hid } Y uF mls wi’ CEM oorti bipeby » ATL. CMD OIA- walle! at 7
be eee ) “lladh lak ae 7 arte
| ar de 3 aks Cre wl) DEW UGheiees PEM. @ JOO Sh e wl ie arog’ et Seteteginys
ry ns — wale ave - - 7
4 tpt J ICL: ( 7K. MAR ; wn Bee ah . bh, gs “ 1a t ve; oo
oS 1 Malar RSL. ball Bi 1, DVO), Scale aetstiegid Rt ‘ Cas mus rirwrals | Bee rnd Adper in
1 “ y 4 fy aj 4 7 -
i. ; é ms Fe ble i wyeon pee 428. - 2S}. ‘ s }
¥ ; a _ 7 . ; :
aay PAA Ps SAU TS. LP GR, aC a ivi bie | fungi 0!) Views ae in done tian ef Ks
1 ; wh FS are 7 ae ' he a
; ws*) 1" ina Tr eee ms i S - .? t »
Ashe "Use IPRaene es tery Be a4 » an -
-. ae hee © Maller 2; Sclhorasieanty Be, sor than 12500 JA sible Qe i pce at on 4 niches iy
. Fa ava
| vis oe MAS Caos S5id Cth Aga ‘Rat. hex SE Se, i | wei tet ee ” ae as :
Py - * : tinge shh, ope a) a ou Hae wut Nth ibe it paper * + hour *ianeonc Aly pot Ge
| ie 7 7 sf =
a vey : : ok a is i ag ~? Ay /_ on ‘

| a

Arse: aT 8 arew ee DB Welk G 200%. Waeye I vad ui et ‘the (Halbentmych oh: reeagent
vs ; ag mye ai. oy poo Rew, ie A <2 My des cra . - ras ?
nh! a va aaliias ae «sy Olineery Be Hey, ‘aelliiniisaieideiadasttae mciakdecelbgy:.
| ia tho + sciigerinaae dy ebb de hatin ied, Posey. J phepet: bras. da 8 iryders Yo, a
peat ni an A fraene i Pay deggie " OR btala he sins. As fetelies anes gival ment
pest as ites! dG aN bt rely wep ath hitroratigce 4S BTS 1 ame WY mee
dean i adhe: Bah; {aR Trudkee 'SP4, 5 ie

" >i i raat i abs senate

MYCOTAXON
Volume 94, pp. 303-324 October-December 2005

New species and phylogenetic relationships of Hypoxylon species
found in Thailand inferred from the internal transcribed spacer
regions of ribosomal DNA sequences

N. SUWANNASAI, S. RODTONG’,
S. THIENHIRUN? & A. J. S. WHALLEY?

*snuttika@hotmail.com
‘School of Microbiology, Institute of Science, Suranaree University of Technology
Nakhon Ratchasima 30000 Thailand

Forest Management and Forest Products Research Office Royal Forest Department
Chatuchak, Bangkok 10900 Thailand

°School of Biomolecular Sciences, Liverpool John Moores University
Liverpool L3 3AF U.K.

Abstract—Hypoxylon specimens collected from different forest areas in Thailand
were investigated and identified to species using both morphological and molecular
characteristics. Fifteen species, including three new species, H. kanchanapisekii,
H. sublenormandii, and H. suranareei, were recorded. The phylogenetic tree of the
Hypoxylon examined was constructed using the neighbour-joining method based on
the internal transcribed spacer (ITS) regions including 5.8S ribosomal DNA sequences.
The molecular results revealed clear separation among Hypoxylon species including
closely related species or on data based only on teleomorphic DNA. Three taxa in
Hypoxylon sect. Annulata—H. nitens, H. purpureonitens, and H. bovei var. microspora—
were grouped together, but the fourth species, H. cf. archeri, was separated. The
phylogenetic tree does not support the monophyletic group of sect. Annulata in this
study. In addition, these molecular data could be used to confirm the recognition of
new species based on morphological features and they are valuable for the creation of
the Hypoxylon DNA sequence database.

Key words—Xylariaceae, Annulohypoxylon, taxonomy

Introduction

Hypoxylon Bull. is a large complex genus of the family Xylariaceae which is a well known
family of the Ascomycota (Whalley 1996, Rogers 2000). They are distributed worldwide,
being especially common in subtropical and tropical regions. Their habitat is on wood.
Most Hypoxylon species are saprotrophs involved in the decay of wood or occasionally
being weak parasites in stressed host trees (Whalley1996, Edwards et al. 2003). Moreover
an increasing number of Hypoxylon species being reported as endophytes in a wide
range of living plants (Rodrigues & Petrini 1997; Rogers 2000; Edwards et al. 2003).

304

Traditionally, Hypoxylon has been characterized by morphological characteristics
based on stromatal structure, pigmentation, shape and features of the ascospore (Miller
1961; Martin 1968; Ju & Rogers 1996). Thus, the delimitation of the genus Hypoxylon
has been the subject of several rearrangements since the monograph of Miller (Miller
1961). Miller’s monograph divided the genus into four sections, Hypoxylon, Annulata,
Applanata and Papillata strongly relying on stromatal form, texture, colour, and ostiole
form (Miller 1961). Consequently, this monograph failed to recognize the relationships

among species and groups of species. The section Applanata sensu Miller has since

been redistributed between Camillea Fr. and Biscogniauxia Kuntze (Lzssge, Rogers &
Whalley 1989; Whalley, Leessoe & Kile 1990; Ju et al. 1998) whereas members of the
section Papillata subsection Primocinerea (Miller 1961) have been allocated to a range
of genera including Nemania Gray emend. Pouzar (Pouzar 1985), Rosellinia De Not.
(Petrini 1992), Kretzschmaria Fr. (Van der Gucht 1994), Kretzschmariella Viégas (Ju
& Rogers 1994), Entoleuca Syd. (Rogers & Ju 1996), and Euepixylon Fiisting (Lzessoe
& Spooner 1994). Recently, Hypoxylon was revised by Ju & Rogers (1996) using four
major criteria to define the genus: Nodulisporium-like anamorphs, stromata unipartite,
never erect, with a solid and homogenous basal tissue below the perithecial layer. They
divided Hypoxylon into sections Hypoxylon and Annulata separating them on the basis
of presence or absence of a layer of carbonaceous stromatal tissue enclosing perithecia.
Additional major characters used to separate the two sections included the perispore,
which if dehiscent, exhibits a visible thickened area positioned about one-third of the
length of the ascospore and on the same side of the germination slit in members of the
Annulata, and the presence or absence of an annular disc surrounding the ostiolum. Ju
& Rogers (1996) accepted at least 130 species and varieties and have since recognized a
further 16 species and one variety (Ju Rogers & Hsieh 2004). When revising the genus Ju
& Rogers (1996) were able to utilize data absent from the monograph of Miller (1961),
such as ascospore ornamentation using scanning electron microscopy, form of the
apical apparatus of the ascus, germination slit morphology, and the colour of stromatal
pigments extracted with 10% potassium hydroxide (KOH) solution. However, in spite
of their revision identification of certain Hypoxylon species remains problematic with
insufficient discriminatory morphological information to clearly delimit certain taxa
and for the confident identification of individual species. This has proved to be most
pronounced when considering tropical taxa of the Annulata especially Hypoxylon nitens
(Ces.) Y.-M. Ju & J.D. Rogers, H. moriforme Henn., H. bovei Speg. var. microspora J.H.
Miller and H. purpureonitens Y.-M. Ju & J.D. Rogers where, between them, there is
considerable variation and overlap in their morphological features.

Molecular studies based on DNA sequences are recognized as more reliable methods
to reveal genetic relationships, and can be used to evaluate the relationships of fungi
at any taxonomic rank (Bruns et al. 1991). Fungal ribosomal DNA (rDNA) genes are
frequently used because these genes contain highly conserved and variable regions, and
they are found in multiple copies per genome (Gardes & Bruns 1993). In the rDNA genes,
the regions of the internal transcribed spacers (ITS) 1 and 2 including 5.88 ribosomal
DNA gene have been extensively studied to differentiate taxonomic entities at the species
level in several fungal genera, such as Fusarium Link (O'Donnell 1992), Penicillium
Link (Skouboe et al. 1999), Xylaria Hill ex Schrank (Lee et al. 2000), and Hypoxylon
(Sanchez-Ballesteros et al. 2000, Mazzaglia et al. 2001). Sequence data of rDNA provides

— ———————E

305

a powerful tool for evaluating phylogenetic relationship among different taxa especially
at higher taxonomic levels. Moreover DNA sequence data from ITS1-5.8S-ITS2 region
has been used to develop specific oligonucleotide primers of pathogenic fungi such as
Penicillium marneffei Segr., Capp. & Sur. (LoBuglio & Taylor 1995).

In this study we elected to investigate the genetic variation within Hypoxylon
species in order to obtain correlations between their morphological and molecular
characteristics using DNA sequences of the ITS1-5.8S-ITS2 region. It is our belief that
the application of these data in conjunction with morphological features will provide a
better definition of species delimitation of Hypoxylon. Since our study was completed
Hsieh et al. (2005) have published on molecular phylogeny of Hypoxylon and closely
related genera based on f-tubulin and a-actin gene sequences. They proposed a new
genus Annulohypoxylon Y.-M. Ju, J.D. Rogers & H.-M. Hsieh to accommodate taxa
originally assigned to Hypoxylon sect. Annulata (Ju & Rogers 1996).

Materials and Methods
Fungal materials

Eighty-nine collections of Hypoxylon specimens were collected from different forest
areas in Thailand. They were classified and identified to species level using morphological
characters (Ju & Rogers 1996; Ju Rogers & Hsieh 2004), and cultures were obtained
whenever possible following ascospore discharge, germination and colony development.
The stromatal pigments of Hypoxylon were extracted by using 10% potassium hydroxide
(KOH) solution, left for one minute, and observed the colour compared to the colour
chart of Rayner (1970). Nine Hypoxylon isolates were additionally obtained from the
Royal Forest Department (Thailand). Two species (as teleomorphs) of H. nitens and H.
bovei var. microspora were provided by Dr. Yu-Ming Ju (National University of Taiwan,
Taiwan). Details of the representative cultures of the Hypoxylon species investigated
together with the two Taiwanese collections are listed in Table 1. All isolates were
routinely grown on potato dextrose agar at 25°C, and maintained in 15% glycerol at
-20°C.

DNA extraction, ITS1-5.8S-ITS2 region amplification and DNA sequencing

Genomic DNA was extracted from cultural mycelia and from stromatal herbarium
materials by using the method of Lee & Taylor (1990) with some modifications.
The internal transcribed spacer (ITS) regions 1 and 2 including 5.88 ribosomal
nucleotide sequence were amplified by polymerase chain reaction (PCR) with the
fungal specific primers ITS4 (5’--TCCTCCGCTTCTTGATAGC-3’) and ITS5 (5’-
GGAAGTAAAAGTCGTAACAAGG-3’) (White et al. 1990). The PCR reaction was
carried out in 50 ul mixtures containing 10 ng of DNA, 200 uM of each dNTP (dATP,
dGTP, dCTP, and dTTP), 2.5 uM of each primer, 2 mM of MgCl, and 1 unit of Taq
Polymerase (Sigma, U.S.A). The PCR cycle of ITS amplification consisted of 1 cycle of
95°C for 5 min; 35 cycles of 95°C for 30 sec, 53°C for 30 sec, 72°C for 1 min; and the
final cycle of 72°C for 10 min. PCR reactions were carried out in an automated thermal
cycler (BioRad, U.S.A).

Amplification products were purified through columns using the QIA quick PCR
Purification kit (Qiagen, U.S.A) and sequenced using the PCR primers as sequencing

306

primers with the Big Dye DNA Sequencing kit (Applied Biosystems, U.S.A). All
reactions were then run on a Perkin Elmer ABI PRISM ~ 377 DNA Sequencer (Applied
Biosystems, U.S.A).

Phylogenetic analysis

All DNA sequences of rDNA were determined and trimmed to remove all 18S and
28S sequences according to sequence boundaries defined by Sanchez-Ballesteros et
al. (2000). DNA sequences of ITS regions were analyzed and aligned manually using
ClustalW (Thompson et al. 1994) and Bioedit program version 4.7.1 created by Tom
Hall (Department of Microbiology, North Carolina State University, Raleigh, U.S.A).
Genetic distances for the neighbour-joining and conditional clustering, Kimura 2
parameter distances (Kimura 1980), were computed with the Dnadist module of the
PHYLIP software package (Felsenstein 1995). Selected ITS sequences of related species
in the GenBank database (http://www.ncbi.nlm.nih.org) were included for comparison
with sequences obtained in the current study. Strengths of internal branches of resulting
trees were statistically tested by the bootstrap analysis of 1000 replications.

Results
Fungal collection and identification

Eighty nine Hypoxylon collections were classified and identified as belonging to 15 species
including 3 unique new species, on the basis of their morphological characteristics
(Table 1). Details of the new species are given below under taxonomic descriptions.
The collections exhibited high variation in their morphological characteristics, e.g.
stromatal surface colour, ascospore size and shape, and germination slit morphology.
The morphological characteristics of representatives of each species recognized are
presented in Table 2.

Taxonomic Descriptions

Morphological features of the Thai collections identified as H. anthochroum, H. bovei var.
microspora, H. fendleri, H. haematostroma, H. lenormandii (except for two collections
on bamboo), H. monticulosum, H. nitens, H. purpureonitens, H. stygium, H. atroroseum
and H. rubiginosum were all in very close agreement with the descriptions for those
species (Ju & Rogers 1996) or with the characters of voucher specimens provided by
Dr. Yu-Ming Ju. Four collections initially considered being close to H. archeri grouped
together in clade II but were separated from the other annulate species suggesting that
they represent the same taxon. The presence of a white fringe surrounding their ostioles
and other minor deviations from typical H. archeri suggest that they all represent a new
taxon. Three collections from Ratchaburi Province are described as H. kanchanapisekii
named to honour the Royal Golden Jubilee Ph.D. Program, which provides the financial
support for this study. Two collections similar to H. lenormandii but growing on
bamboo are described as a new species named H. sublenormandii. Another new species,
H. suranareei, is named following the location of specimen collections at Suranaree
University of Technology, Thailand.

307

Hypoxylon kanchanapisekii Suwannasai, Rodtong, Thienhirun & Whalley, sp. nov.

FIGURES 1A-F
Stromata glomerata vel pulvinata, 0.5-2mm diam. X 0.1-0.2mm crassa; tumulis
peritheciorum inconspicuis vel conspicuis, externe obscure rubro-brunnea vel umbrinis in
KOH dissolutis; Perithecia globosa 0.1-0.2 mm diam. Ostiola plana vel parum elevata. Asci
105-120 um longitudine tota x 3.8-5 um crassa, partibus sporiferis 75-85 um longitudine
stipitibus 12.5-35 um longitudine annulo apicali in liquore iodato Melzeri cyanescente,
discoideo, 1.25 um alto x 2.5 um lato. Ascosporae brunneae, unicellulares, ellipsoideae
cum apicibus angustatis, 10-11.5(-12.5) x (1-)3.5-5 um, rima germinativa recta longa
praeditae; perisporium in KOH indehiscens, leve; episporium leve.

KEY CHARACTERS: Stromata glomerate to pulvinate, restricted and usually containing less
than 20 perithecia, perithecia occasionally almost free, 0.5-2 mm x 0.1-0.2 mm thick,
with perithecial mounds inconspicuous to 1/3 exposed, surface dull reddish brown with
KOH extractable pigments brown vinaceous (84), or umber (9); perithecia spherical
0.1-0.2 mm diam.; ostioles slightly higher or the same as the stromatal surface; asci 105-
120 um total length x 3.8-5 um broad, the spore bearing parts 75-85 um long with stipes
12.5-35 um; ascospores brown, unicellular, equilateral, with narrowly rounded ends,
10-11.5(-12.5) x (1-)3.5-5 um, with straight 2/3 length germ-slit; perispore indehiscent
in 10% KOH, smooth, epispore smooth; colonies on PDA covering 9-cm Petri dish in
two weeks at room temperature, 23-28°C, at first cream then buff, velvety to felty, with
concentric zones where aerial hyphal tufts develop; anamorph not formed.

SPECIMENS EXAMINED: THAILAND, Ratchaburi Province, the Royal Forest

Department, on bamboo, 28 August 2003, Suwannasai, N. (Holotype SUT069); SUT066;

SUT068.

Comments: Hypoxylon kanchanapisekii is close to H. parksianum Y.-M. Ju & J.D. Rogers
(Ju & Rogers 1996) except that the stromatal form of H. kanchanapisekii is normally
glomerate and contains less than 20 perithecia whereas H. parksianum is pulvinate to
effused-pulvinate with inconspicuous to conspicuous perithecial mounds. The colour of
granules, which beneath surface and between perithecia, of H. kanchanapisekii is dull
reddish brown but it is blackish in H. parksianum. ‘The perithecia of H. kanchanapisekii
are spherical with 0.1-0.2 mm in diameter, whereas H. parksianum perithecia are
spherical to tubular and larger size, 0.3-0.6 mm in diameter x 0.4-0.8 mm high. Asci
of H. parksianum are longer, 147-174 um total length x 6.5-7.5 um broad, than H.
kanchanapisekii, which are described above. Ascospores of H. kanchanapisekii are
slightly smaller than H. parksianum (11-14.5 x (4.5-) 5-6 um). Host of this new species
is known only from bamboo clump while the substrate of H. parksianum is on corticated
wood of Hibiscus.

Hypoxylon sublenormandii Suwannasai, Rodtong, Thienhirun & Whalley, sp. nov.
; FIGURES 2A-D

A Hypoxylo lenormandii differt in ascosporis 8.9-11.3 x 3.4-4.7 um et in rima germinativa
recta longa praeditae.

KEY CHARACTERS: Stromata glomerate to effused-pulvinate, often appearing almost
rosellinioid but joined by thin stromal tissue, conspicuous perithecial mounds, surface

308

reddish brown, reddish brown granules immediately beneath surface and between
perithecia, with KOH-extractable pigments brown vinaceous (84), or umber (9);
perithecia spherical, 0.2-0.4 mm diam., ostioles slightly higher than the stromatal
surface; asci 95-110 um total length x 3.8-5 um broad, the spore bearing parts 65-75
um long with stipes 30-42.5 um; ascospores brown, unicellular, ellipsoid-inequilateral,
with narrowly rounded ends, 8.9-11.3 x 3.4-4.7 um, with straight germ slit spore-length;
perispore dehiscent in 10% KOH, with inconspicuous coil-like ornamentation; epispore
smooth; colonies on PDA covering 9-cm Petri dish in two weeks at room temperature,
25°C, at first cream-coloured white then brown, felty, azonate, with diffuse margins;
anamorph not formed.

SPECIMENS EXAMINED: THAILAND, Kanchanaburi Province, Chong Kho Neab
Forest, on bamboo, 14 December 2003, Suwannasai, N. (Holotype SUT282); Trad
Province, Ta Gum Forest, on bamboo, 19 September 2003, Phosri, C. SUT250.

Comments: Hypoxylon sublenormandii is close to H. lenormandii (Ju & Rogers 1996) but
the stromatal surface of this new taxon is strongly reddish brown while H. lenormandii is
grayish sepia (106), fuscous (103), or brown vinaceous (84). Asci of H. lenormandii are
longer, 123-170 um total length x 6-9 um broad, than H. sublenormandii, which are 95-
110 um total length x 3.8-5 um broad. The germination slit form of H. sublenormandii
is straight spore-length whereas in H. lenormandii it is slightly sigmoid spore-length.
Ascospores of H. lenormandii are slightly larger, 9.5-15 (-16) x 4-6.5 (-7) um, than
those of H. sublenormandii. This new taxon is known only from bamboo clumps. Ju
& Rogers (1996) discussed the occurrence of H. lenormandii on both monocot and
dicot substrates suggesting that this wide host range and the broad range of ascospore
size indicate that the taxon might be subdivided into subtaxa. Hypoxylon suranareei
would therefore be one of these and according to Ju (pers. comm.) it might in the future
prove to be conspecific with H. disjunctum Rehm. collected originally on bamboo in
Philippines.

Hypoxylon suranareei Suwannasai, Rodtong, Thienhirun & Whalley, sp. nov.

FIGURES 2E-H
Stromata hemisphaerica vel effuso-pulvinata, tumulis peritheciorum conspicuis, externe
ferruginea; sub superficie et inter perithecia granulis aurantiacis conspersa, granulis
aurantiacis vel in KOH dissolutis; Perithecia globosa 0.2-0.4 mm diam. Ostiola plana vel
umbilicata. Asci 90-120 um longitudine tota x 3.8-5 um crassa, partibus sporiferis 70-85
um, longitudine stipitibus 30-50 um. longitudine annulo apicali in liquore iodato Melzeri
cyanescente, discoideo. Ascosporae brunneolae vel brunneae, unicellulares, ellipsoideo-
inequilaterales cum apicibus angustatis, (10-) 12.5-14 x 5-6.3 um, rima germinativa recta
longa praeditae; perisporium in KOH dehiscens; episprium leve.

KEY CHARACTERS: Stromata hemispherical to effused-pulvinate, often appearing almost
rosellinioid but joined by thin stromal tissue, conspicuous perithecial mounds, surface
fulvous (43), or rust (39), orange granules immediately beneath surface and between
perithecia, with KOH-extractable pigments orange (7) or scarlet (5); perithecia
obovoid, 0.2-0.4 mm diam; ostioles same or lower than the stromatal surface, with
white substance; asci 90-120 um total length x 3.8-5 um broad, the spore bearing parts

309

70-85 um long with stipes 30-50 um; ascospores brown to dark brown, unicellular,
ellipsoid-inequilateral, with narrowly rounded ends, (10-)12.5-14 x 5-6.3 um, with
straight germ slit spore-length; perispore dehiscent in 10% KOH, with inconspicuous
coil-like ornamentation; epispore smooth; colonies on PDA covering 9-cm Petri dish in
two weeks at room temperature, 25°C, at first cream-coloured white then pale grayish,
alternate rings, velvety, with diffuse margins; anamorph not formed.

SPECIMENS EXAMINED: THAILAND, Nakhon Ratchasima Province, Suranaree

University of Technology, on White Popinac (Leucaena leucocephalade Wit.), 17

November 2003, Suwannasai, N. (Holotype SUT182) SUT183, SUT184.

Comments: Hypoxylon suranareei is close to H. anomalum J.D. Rogers etal. (Juet al. 2005)
but their KOH-extractable pigments are different. Hypoxylon suranareei has orange (7)
or scarlet (5) pigments but in H. anomalum they are luteous (12). The colour of granules
beneath the surface and between the perithecia in H. suranareei is orange but in H.
anomalum the colour is reddish brown. Asci of H. anomalum are considerably longer
and broader, 140-160 um total length x 10-11.5 um broad, whereas in H. suranareei they
are 90-120 um total length x 3.8-5 um broad. Notably, the perispore ornamentation of
H. suranareei is inconspicuously coil-like whereas H. anomalum is smooth.

DNA amplification and sequence analysis

Approximately 600 to 900 base pair (bp) of the amplified ITS1-5.8S-ITS2 fragments
were achieved. Details of ITS sequences of each isolate are reported in Table 3. The
greatest variation in length and sequence was observed in the ITS1 region which ranged
from 156 bp (H. fendleri SUT280) to 506 bp (H. atroroseum SUT009). The ITS2 region
ranged from 160 bp (H. lendormandii) to 169 bp (H. purpureonitens). The length of
5.8S region was constant at 155 bp in all Hypoxylon isolates and highly conserved. The
extremely long ITS1 sequences (477 and 506 bp) were found in both isolates of H.
stygium (SUT058 and SUT243) and in H. atroroseum (SUT009 and SUTO10), and this
is in agreement with previous findings for H. stygium (AJ390409) and H. atroroseum
(AJ390397) respectively (Sanchez-Ballesteros et al. 2000). Hypoxylon stygium and H.
atroroseum appeared to be closely related as shown by their 93% identity. The ITS1-
5.8S-ITS2 sequence alignment of both species revealed the insertion and/or deletion
sequences of 28 bp (5° ATCTGCTCGAATAAAATTGCTTCAATAT 3’) within ITS1
region. This sequence fragment might be useful for the designer of a probes or markers
for species specific detection.

Phylogenetic relationships

Phylogenetic relationships among Hypoxylon specimens are presented from the
neighbour-joining analysis of the aligned ITS1-5.8S-ITS2 sequences except for sequences
of H. stygium (SUT058 and SUT243) and H. atroroseum (SUT009 and SUTO10)
because their extremely long ITS1 sequences could not be unambiguously aligned
correctly. Support for specific branches of the trees was assessed by the percentage
of the neighbour-joining trees of 1000 bootstrapped data sets forming the branch. In
Fig. 3, the tree assigned the taxa to three main clades. Clade I consisted of two species,

Fig. 1 Hypoxylon kanchanapisekii SUT069; a and b, stromatal form on bamboo (bars=1 mm and
0.2 mm respectively); c, ascospores (bar=10 um); d, apical apparatus with discoid form (arrow)
(bar=1 um); e, straight 2/3 length of germ slit (arrow) (bar=1 um); f, SEM micrograph of ascospore
(bar=1 um). Hypoxylon cf. archeri (SUT105); g, stromata with white fringe surrounding ostiolar
disks (bar= 0.2 mm); h, ascospores with thickening of perispores (arrow) (bar=2 jum); and I, SEM
micrograph of ascospores (bar=1 1m).

311

Fig. 2 Hypoxylon sublenormandii SUT250; a, stromatal form on bamboo (bar=0.2 mm); b,
ascospores (bar=5 jum); c, ascospores with perispores dehiscing in 10% KOH (arrow) (bar=4 pm);
d, SEM micrograph of ascospores (bar=1 pm). H. suranareei SUT182; e, stromatal form (bar=0.2
mm); f, ascospores (bar=4 um); g, ascospores with perispores dehiscing in 10% KOH (arrow)
(bar=5 um); and h, SEM micrograph of ascospores (bar=1 um).

ee ee ee

(puepieyy, ‘eouTAOIg LInqeYeY WIZ pajD2][09 uauidads) wmtreqs9H S.L.0S
(puepreyy,) wnteqray sjuowysedaq yse104 jeAoy

(purpreyy, eouTAoIg PlUTseYyoeY UOUPEN WoT pe}e][09 uaumtdeds) wmniregieaH S.LAS
(puepreyy, eourAoIg WnILIng Wor pe}d2[[09 uaumtdeds) wmtreqiaH S.LAS

(puepreyy, ‘eouTAoIg LInqeyyeY WO pa}da][O9 uaumtdeds) wimntreqiaH S.LAS
(puepreyy, SouTAoIg LNqeypyey WOIZ pa}de][O uaumtdeds) wmntreqiaH S.LAS
(purpieyy, ‘eouTAOIg LingeypyeYy WosZ payd2][O uauroads) uintreqi9H S.LAS
(puepreyy, ourAoIg LUNqeueypuey WOIF p2}D9[09 uaurtdeds) winireqiaH S.LNS
(purpieyy, ‘eouTAOIg Lingeurysuey WOT po}d2][09 uaudads) wmntreg49pH S$. LAS
(puepreyy, ‘eourAOIg UOYJOseX WOT pr}d2[09 uaumtoeds) wmnireqiey S.L.NS

(puepreyy, ourAo1g LNqeueysuery WoOrJ Pe}2][09 uauttoeds) wmntreqieaH S.LAS
(puepreyy, SouTAOIg UOYJOSeA WOIF pa}d2T[O uaurioads) wmtdeqiaH Ss. LAS

(pueprey, SouTAOIg UOYJOSeA WOIJ payda][O9 uaumtdeds) wmnireqiaH S.L.NS

(puepreyy, eouTAOIg UOY}OseA WOT pa}de]]O uauitdeds) wintreqgiaH S.L.NS

(puepreyy, eoutAo1g LNnqeypyey Wor po}de]]O uauttoeds) winiregia} S.LAS
(puepreyy) wntreqray sjuaursedaq 1s9104 jeAoy

(purpieyy) uniueqisay sjuawysedag ysar04 feAoy

(ueMIey) WINTIeqIaH Snf SUIY-1A

(puryreyy, souTAOIg eIUTseYydeY UOYyYeN WoT ps}2][05 uaumdeds) wintreqs9aH S.LAS
(puryreyy, eouTAOIg PlUTseYyd}eY UOYYRN WoIF ps}r2]]09 uauttseds) winireqgieH S.L.NS
(pueprey],) wnteqiey] sjuaunseda 1se104 jeAoy

(puepieyl) wntreqioy sjuaunseda 3s2104 jeAoy

(purpreyy, ouTAcIg e[ysUog Wo pe}2][09 uauidads) wmntreqi9aH S.L.0S

(puryreyy, ourAcIg e[YBUos wos pa}a][09 uaumdeds) wntreqiaH S.LAS

(pueyiey], eouTAOLg pes], WIJ p}da][O uaumdeds) uinireqiaH S.LAS

(purpieyy, ‘eouTAOIg per], Wory paydaT[09 uautdads) winteqieH 8..LNS

30INOS/UOT}LI0T

Sk2

poom ursadsorsuy
poom ursodsorsuy
poom ursadsorsuy
poom ursodsorsuy
dummy ooquieg
duno ooquieg
duinp ooquieg
poom uedsorsuy
poom ursadsorsuy
poom wadsorsuy
poom ursadsorsuy
poom wuadsorsuy
poom ursedsorsuy
poom wiuodsorsuy
poom wiadsoruy
poom wuadsorsuy
poom urrodsorsuy
[elePp ON

poom ursadsorsuy
poom uedsorsuy
poom ursadsorsuy
poom wuadsorsuy
poom ursadsorsuy
poom wuodsorsuy
poom urradsorsuy

poom wuodsorsuy

sO]

-ABZojouypay, Jo Ayisaatuy) = sareueING JS ‘ON

(ZEO.LNS) wnsojnayuom “HY
(FZETLS) Upuvwoual “YH
(O8L.LAS) upupwsoua] “YH
(9L0,.LAS) upubusoug] “H
(690,LMS) 1yasidvuvysuvy “H
(890,LAS) tyasidvuvysuvy *H
(990,LAS) Myasidvunyouvy *H
(€6Z.LAS) vuossojpuavy *H
(Z6Z,.LAS) VMO.LsoJDULADY *H
(FOLLAS) vulossojpuavy “H
(O8Z.LAS) /2/puaf “H

(S9OL.LNS) He1puaf “H

(Z9LLNS) #21pYaf H

(6ST.LAS) 142/pYaf H

(L90.LNS) “a1puaf “H

(SLSZ.LS) viodsosmu ‘eA 12409 *H
(90PZIS) vodsoustu “TeA 19009 “H
(uemIey) v1odsosgiU “IRA 1aA0q *H
(O10,LAS) wnasos0.yD ©
(600.LNS) wnasos0.qD *
(LZSTLS) 1404240 ‘JO °

(CEETLS) LaYI4D "O°

(SOL.LOS) #424940 “Jo

(€OT.LNS) 1424940 “JO °

(OFZ.LAS) Mno4syroyzUD ©
(Sez) wnosypoysuv uopdxoday

como he ot

satoads

Nee ee SE eee

9C
Sc
VC
€C
CC

eee CN bins OE IOM Oe Tet Oy = ae
Sy et eee eee et NUN

aHaeNnNnmnwtn OW WO

-Apnjs yuasard oy} Ul payesysoaul satoads uopdxoddH *T 2] Qe.

STS

(puepreyy, ‘eouraorg euNseyo}eY UOYYLN Woy poy] uaumtoads) wmireqiaH S.L0S
(purpreyy, ‘eoutaorg eUTIseYyd}eY UOYYLN WOT pry e]]O uaurads) umnireqiay S.L.AS
(purpieyy, ‘eouTAoIg Lnqeueysuey WO po}d9][09 uaurioads) umnireqiay S.LAS
(puryreyy, ‘SouTAOIg pes], WosJ p}da][OI uauridads) winizeqiay S.LNS

(purpieyy, eoUIAOIg pery, WO p}aT[09 uaursads) umnteqiaH{ S.LAS

(purpreyy, eoutAog LNgeyyey WosZ P}d2][09 uourads) umntreqiaH{ S.L.AS
(puryieyy, eouTAOIg per], WOIJ pe}da[09 uaurads) umniszeqiaH $.L.0S

(puryreyy, eoutAoIg per], WOIJ pa}daT[09 uaurtoeds) umnisreqiay S.LAS

(puepeyL) wnteqiay{ sjuawredaq 4se10,j [eAOY

(puepey) wniueqiay squourredag yse10, [eAOY

(puryreyy, SoUTAOIg pes], WosF po}a[[0F uauttdads) umntieqieH 8..LAS

(puepieyy, eouTAOIg UOYJOSeA WIJ pa}d2][O9 uauroads) umnisreqiay S.LAS

(purpieyy, ‘eourAosg eUTIsey}eY UOYYEN WOT poy e]][09 uourtdeds) umniszeqiay{ $.LNS
(pueprey,) wnieqiay sjuourjsredaq 1se10J jedoy

(pueprey) umntreqiay sjuawyiedaq yse10,J [eAoY

(ueMIe],) WMTIegIaH s.n{ SUTI-N

(purpieyy, ‘eouTAoIg B[YYBUoS Wor paydaT[O uaumtdeds) umnireqiaH S.LAS

(puepieyy, eouraorg eUNTSeYDIeY UOYYEN WosZ po}r2]]0° uaumdeds) umnieqiaH{ 8..LNS

39INOS/UOT}EIOT

(JIM apyjpydaz0mnay

puavonaT) seutdog atyM

(TIM apyjpydas0mnay

puavonaT) seuidog aM

duno ooquieg
dump ooquieg
poom uredsorsuy
poom wuadsorsuy
poom uedsorsuy
poom uedsosuy
poom wuedsorsuy
poom wiedsorsuy
poom wuodsorsuy
poom uedsoisuy
poom wuodsorsuy
poom wedsorsuy
poom uedsorsuy
[rey9P ON

poom uedsorsuy
poom wiuoedsorsuy

JsOH]

‘ASojouysay, Jo AistaaTuy) = sereURANG TS ‘ON

(€8T.LAS) fasouvins “H

(Z81.LOS) 1aasvuvans

(Z8Z,LNS) HpupuLsouajqns “H
(O57 L115) BPC e aie eas
(€PZ.LAS) wni84s “H
(8S0.LNS) wnisAis “H
(Z81,.LAS) wnsoussiqn4 “H
(SP 1.LAS) wnsoussiqns “H
(SgrzLs) suapuoasndand "Y
(SPPZ,.LS) suaptuoasndand *H
(Z9ZLNS) suanuoaindand "YH
(ZOL.LAS) suaguoaindand "H
(FOOLS) suanuoaindand "H
(EL¥7LS) Suanu “H

(€LE7ZLS) Suanu HH

(UBMIP],) SU9zIU “H

(OL LL EYS) MénsonaHy GMs Ft

(080,.LAS) wnsojnsiyu0U “HY

satoads

(G4

papnpouoo [ 2]qul,

314

win 8°¢€-G°Z X €'9-8°¢ Ja}ouIeIp UIT U0} UMOIq

yysugy yoy ‘spud papunol ATMoIeU Z'0-1'0 ‘adAy SNOadeATIO Ystppos YIM
IY] -Vjauodiag yoows yysreysg YM Jesoyepinbo-prosdyyyq -WNJDIUNAT, ystusar5 yspprlg "29RS (‘AIT) WUNIBAJs “FY
= BAe
Autys ouros
unl G-g"€ X OI-S'Z ‘spua JoJoureIp ‘QUO} UMOIG
yysuey [ny papunos AyMorreu YIM WU $'0-¢€'0 ajdind ysippar YIM s1ad0y C8 Nf
ayy-winisodsynpon yjooursg YsIe.1NS ‘TerayepInbout-prosdiyyfq ‘adAq-1aa0g snoadeulA, ysppeg “W-A suayiuoasndind “FH
unl G-g"¢ X OI-S°Z ‘spua JoJaUIeIp
yysuey [[Ny pepunos ApMorreu YIM WwW F0-€'0 snoaovaljo s1980y ‘C'[
dyy-wntiodsynpon Y}OOWS ses ‘qesajeyInbout-prosdiyyq ‘ad A}-1a40g ystusaty preg 8 AL WA (S9D) suajiu “Y
uinl G-8"¢€ X OT-S'Z ‘spua JoyoureIp
yysugy [ny pepunos AJMoreU YIM Wu /'0-¢'0 snosdeAr[O TTT “Hf
dyy-wintuodsynpon yoours ses ‘TeoyepInbout-prosdiyq ‘adAj-1a00g ystuseI5 yorjg vsodsosniw “eA 1aA0g “YH
uinl g°¢-S'Z X 8°8-€'9 JoJQUIeIP UU
ysugy [Ny ‘spua popunod AJMorIeU Z'0-1'0 odAy snoadeAl[oO Aei3
ayT-wintiodsynpon YJOOUIS Wyss —-yM Jesayepinbo-prosdyyq -WINJDIUNAT, ystuser5 snosseut, —- S19 OY “'{ WiNaso10.14v “Y
win ¢-g'¢
X (G LI-)01-3°8 ‘spua JoJoUIeIp WUT asULIJ oy
ysugy [[Ny popunos AyMoIIeU YIM Z'0-1'0 ‘adAy Y}IM UMOIG
dyy-winisodsynpon yJOOWS WYsIe.NS ‘Te1oyeInbaut-prosdiyyyq -WNJDIUNAT, jozeH ysryporyd "Yloag 14ayI4v ‘JO “YY
pyvjnuuy "yas uojAxodAY
IO]OO
IO]OO
yuoursid
ydioureuy aiodsiiag = WIS Wey a10dsoosy SIP Ie[ONSO Sami ee aoeyans satdeds
Nese ce [eyeUIoNs
“HO

‘payesysaaut satsads uojdxoddH ay} JO Sorjstsajoereyo [eos1sojoydsopy *Z 9IqeI,

ee eS SS SS

uoleyUsWeUIO wil c-8°¢€ X S'7I-O1 goeyins
IYI] -[I09 yysuey [nj ‘spue pepunos AyMoIIeU jeyewogys at}
snonoidsuosut prouisis YIM qeszayepinba 0} uey} Joysiy vidas sing “VW
ayt-wntsodsynpon YIM Juesstyaq Apyystys jesoyepimbour-prosdyfq ApyUsIS pow ystdeiy 3g Ylog upuvwsoug] “H
wil G-¢°¢(-T) govjins
X ($'ZI-)S'TT-OT ‘spue yeqewios}s ay} joquin uMOoIq
YJOOUIS yysugq [Ny pepunoi AyMorIeU YIM se ours of} 10 “snoooeurA Ysippol ‘aou “ds
umouyuy ‘uaosTyapuy yysIe1$ ‘TesoyepMbo-prosdy[yq zaysry Apystys uMoiq Ima iyasidvuvyIuvy “H
um 9°8
ysuey [oy -COX 6 Ls] spue goeyins
yjoouls proursis papunos A[MOIIeU YIM [eyewors ay} ysni
IYI] -VIJawoIiag uaodstyoq Apyqsts ‘eroyepmbaur-prosdyy[q uey} JaMOT asurlO IO aBUeIO ‘JUOW VIUOAJSOJVUAVY *H
uoneyUsWIeUIO ulin G-¢"¢ you
IYI]-]109 yysuey [Ny X ($'ZI-)S'T1-S°8 ‘spue goejans yrep 10
snonoidsuosut prouisis pepunol AyMorreu YIM [eqeulors ay} SnoodeulA
ayt[-wintsodsynpon YIM Juaostyaq Apysiys ‘Te1ayepInbout-prosdiyfq uey} JaMOT asurlO UMOIG YOO) xa “YIIg uajpuaf 72]
uole}UsWeUIO wml 9-7
IYI]-[109 X (FI-)ET-8'0T ‘spue goejans snoadeulA
snonoidsuosut ysu9y [Ny pepunoi AyMorIeU YIM yeyeUuIOI}s 9} uMOQ 10 sutoolg
ay-wntodsynpon YIM uaostyaqd ses ‘qesayepInbout-prosdiyq uey} IOMOT SnoddeATTO ynujsoyD «=—s-BesCHF!P'D WUNOLYIOYJUD “H
uojdxoddq “yas uojtxodAH
JO[OO
JOO
juouisid
ydioweuy aiodst13g WIS Way aiodsoosy dsIp IejONSO ae Ps es govyins satsods
ieee [eyeurons
—HOA

ee ee eee eg SAN eS a eS eee es eee

panuljuoo % ]quy,

ee ar mre nnn EEIDnS IEEE TETSU

a0ue\sqns dI4M

UOT eJUSUIeUIO unl ¢°9-S UIIM ‘ooRzns
IYI]-]109 XP1-S'TL(-O1) ‘spua yeyeuroyjs oy}
snonoidsuoout yysu2q [Ny pepunol A[MoIIeU YIM ue} IOMO] yopreos ysni
umouyuy) UIIM JusssTyaq WsIeNS ‘TeroyepInbaut-prosdryypq JO sues Jo as8ueIQ =: JO SnoAN ‘aou “ds 12aADUDANS “FY
uoNeUswWIeUIO unl G-8"€ X Z1-6 goeyins
IYI]-]109 ‘spua pepunol AjMoiseu yeyeurogs 94} Joquin
snonoidsuosut yysugy [ny YIM Jesoyepinba 0} uey} Joysiy JO SNOIDCUTA uUMOIQ
umouyuy) YIM Juaostyaq ses [eroyepinbaut-prosdiyq Anysys uMOIg ysippey ‘Ao ‘ds 14puvutsouaqns "H
uoT}eyUIUUIeUIO
eT T09 wn ¢-8"€
snonsidsuosul X 01-8'°8(-¢'Z) ‘spua aoeyins
0} YJOOUs YIM ysu2] [Ny pepunos AjMosseu YIM [eyeurosjs a4} SNOddeUIA
dyy-wnisodsynpon Yuaostyaq WYsIe1S ‘e1oyeyInbaut-prosdiyq uey)} JOMOT sy uMOIg ‘Iq (SIaq) WNSOULsIQns “HY
oinyeul
usyM
uOTeUSUIeUIO ayeqtided ysppryq
OT-[}09 wirig-g"€ X (€IT-) Apoynuyu uy}
snonsidsuosut ysugy [Ny 8°8-G°Z(-€°9) ‘spua pur sovjins SNOdoeUIA
0} YJOOUS YIM prowisis pepunoi AjMoiseu YIM [eyewols ay} ajdind uUMOIG
umouyUuQ, ‘quoosTyaq Anysqys ‘TeroyeTINbaut-prosdryypq uey) Joysty IO ssaj1O[OD 4sny ‘JUOWY WNSO[NIUOWU “HH
uojdxoddHY "yas uojdxoddy
ee eee eee
B (0) (0)2)
JOJO
yuoursid
ydioweuy a10dsi13g WIS Wey a1odsoosy OSIp Ie[ONSE sa8 Sr Bs goejins satoads
ales eh yeyewons
-HO

ee eee

papnjauod % aqui,

316

Sky.

H. monticulosum (SUT042, SUT080, and SUT116) and H. suranareei (SUT182 and
SUT183). Two representatives of H. monticulosum isolates, SUT042 and SUT080, were
without apparent KOH-extractable pigments as detailed by Ju & Rogers (1996) whereas
H. monticulosum SUT116 had a purple coloured extract. This does however agree with Ju
& Rogers (1996) who stated that “it is noteworthy that the purplish stromatal pigments
dark livid to dark vinaceous of H. monticulosum and H. submonticulosum are easily
detected in the young, rusty brown stromata but are hardly so in the mature, blackened
stromata’. The sequence alignment indicated 99% similarity and it is concluded that
they represent the same taxon regardless of extractable pigment in KOH. H. suranareei
(SUT182 and SUT183) isolates were separated from H. monticulosum with high
bootstrap support, which confirmed this new taxon.

Clade II contained three Annulata species, H. nitens (Taiwan, $T2475 and ST2313),
H. bovei var. microspora (Taiwan, ST2406 and ST2579), and H. purpureonitens
(SUT004, SUT167, SUT262, ST2448, and ST2485). Additionally six species consisting
of H. lenormandii (SUT016, SUT180, and ST2324), H. sublenormandii (SUT250 and
SUT282), H. haematostroma (SUT164, SUT292, and SUT293), H. anthochroum
(SUT233 and SUT240), H. kanchanapisekii (SUT066, SUT068, and SUT069), and H.
rubiginosum (SUT215 and SUT221), were also grouped together. The three Annulata
species are complex species and are very similar in morphological characteristics. The
two isolates of H. nitens from Thailand exhibited a 95% similarity to H. nitens from
Taiwan but they were closely linked, and they are therefore considered to be the same.
Hypoxylon purpureonitens showed 28% divergence to H. nitens. This is in agreement
with Ju and Rogers (1996) who reported that H. purpureonitens is very close to H.
nitens in its teleomorphic morphology except KOH-extractable pigments. Hypoxylon
purpureonitens is purple or livid whereas H. nitens is greenish olivaceous in 10% KOH.

Three isolates of H. lenormandii (ST2324, SUT016, and SUT180) closely matched
the description by Ju & Rogers (1996) and all collections grew on dicotyledonous wood
from different forest areas as detailed in Table 1. They were clearly separated from H.
sublenormandii (SUT250 and SUT282), with both collections occurring on bamboo,
with high bootstrap support (Fig. 3). They also differed in morphological characters
such as spore size (9-12 x 3.8-5 um), a more reddish brown stromatal surface color,
and a straight germ slit and on the basis of this and the sequence data a new species is
proposed. Three isolates of H. haematostroma (SUT164, SUT292, and SUT293) could
also be separated from the other taxa in the same clade because of their distinctive
teleomorphic characteristics having red or orange red stromatal granules. Hypoxylon
anthochroum (SUT233 and SUT240), H. kanchanapisekii (SUT066, SUT068, and
SUT069), and H. rubiginosum (SUT215 and SUT221) were separated from each other
with high bootstrap support. Although H. anthochroum was considered to be a synonym
of H. rubiginosum by Miller (1961), they differ in KOH-extractable pigment color. This
phylogenetic tree also confirmed the separate identity of a further new species, H.
kanchanapisekii, which was separated from other species examined.

Clade III consisted of three species, H. fendleri (AJ390400), H. cf. fendleri (SUT061,
SUT159, SUT162, SUT165, and SUT280) and H. cf. archeri (SUT103, SUT105, ST2333,
and ST2527). Initially, five H. cf. fendleri (SUT061, SUT159, SUT162, SUT165, and
SUT280) collections had been identified as H. fendleri since their morphological

318

Table 3. Sizes of ITS1 and ITS2 regions and 5.8S ribosomal nucleotide sequences.

No.

Hypoxylon anthochroum (SUT233) 180 5S 162 4

XO™ (COD ON, BO 1S Gh at

IRS RSS SR Se SS US Gs), Coy AOS ey TSS) (GS Gey ESS SY Re RS Oe TS RO Sy eee SS Ss ta ee ae i ee
OR ee ST eae New oro, Sain aon. KO ES NOSSO Sy 9 Te SC ee een Cre USSR OST SO ee ns Mo cl Sone nh See Co ae — 9 a)

Species

H. anthochroum (SUT240)
H. cf. archeri (SUT103)

H. cf. archeri (SUT105)

H. cf. archeri (ST2333)

H. cf. archeri (ST2527)

H. atroroseum (SUTO009)

H. atroroseum (SUTO10)

H. bovei var. microspora (Taiwan)
H. bovei var. microspora (ST2406)
H. bovei var. microspora (ST2579)
H. fendleri (SUT061)

H. fendleri (SUT159)

H. fendleri (SUT162)

H. fendleri (SUT165)

H. fendleri (SUT280)

H. haematostroma (SUT 164)
H. haematostroma (SUT292)
H. haematostroma (SUT293)
H. kanchanapisekii (SUT066)
H. kanchanapisekii (SUT068)
H. kanchanapisekii (SUT069)
H. lenormandii (SUT016)

H. lenormandii (SUT180)

H. lenormandii (ST2324)

H. monticulosum (SUT042)
H. monticulosum (SUT080)
H. monticulosum (SUT116)
H. nitens (Taiwan)

H. nitens (ST2313)

H. nitens (ST2473)

H. purpureonitens (SUT004)
H. purpureonitens (SUT167)
H. purpureonitens (SUT262)
H. purpureonitens (ST2448)

' H. purpureonitens (ST2485)

H. rubiginosum (SUT215)
H., rubiginosum (SUT221)
H. stygium (SUT058)

H. stygium (SUT243)

H. sublenormandii (SUT250)
H. sublenormandii (SUT282)
H. suranareei (SUT 182)

H. suranareei (SUT 183)

1TSt! <h! SoSoy TSAI oul ps
(bp) (bp) (bp) (bp) ladiNes
97 QD201125
180 155 162 497 QD201126
209 155 161 525. QD201121
209 155 161 5254, .OD201122
209 155 161 5suar OW20LI2a—
224 155 160 539 QD201124
506 155 164 825 DQ223733
506 155 164 825 DQ223734
226 155 167 548 QD201127
225 155 167 547. QD201128
226 155 167 548 QD201129
180 155 165 500 QD201130
183 155 164 502. QD201132
183 155 165 503. DQ223735
182 155 163 500 DQ223736
156 155 163 474. DQ223737
176 155 161 492 DQ223738
176 155 161 492 DQ223739
176 155 161 492 _DQ223740
209 155 162 526 DQ223741
209 155 162 526 DQ223742
209 155 162 526m »eDO224743
188 155 160 503. DQ223744
188 155 160 503. DQ223745
188 155 160 503 DQ223746
171 155 165 491 DQ223747
171 155 165 491 _DQ223748
Al 155 165 491 DQ223749
158 155 166 479 — DQ223750
158 155 166 479 DQ223751
158 155 166 479 DQ223752
OE 155 169 549. DQ223753
225 155 169 549 DQ223754
225 155 169 549 DQ223755
225 155 169 549 DQ223756
225 155 169 549 DQ223757
178 155 164 497 DQ223758
178 155 164 497 DQ223759
477 155 164 796 DQ223760
477 155 164 796 DQ223761
198 155 161 514 DQ223762
198 155 161 514 DQ223763
199 155 162 516 peeibO223764
199 155 162 516 DQ223765

100
79

400

4100

108

100
400

400

319

Diatype disformis
H, monticulosum (SUT042)
H. monticulosum (SUT080)
H, monticulosum (SUT116) l
400 H. suranareei (SUT182)
H. suranareei (SUT183)
400 H. nitens (Taiwan)
H. nitens (ST2473)
H. nitens (ST2313)
400 H. bovei var. microspora (Taiwan)
H. bovei var. microspora {(ST2406)
H. bovei var. microspora ($T2313)
H. purpureonitens (SUT262)
H. purpureonitens (SUT004)
H, purpureonitens (812485)
H. purpureonitens ($T2448)
H, purpureonitens (SUT167)
1400 H. lenormandii (SUT016)
H, lenormandij (SUT188)
H. lenormandii (812324) il
4106 H. sublenormandii (SUT282)
H. subfenormandii (SUT250)
H. haematostroma {(SUT292)
H. haematostroma (SUT164)
H. haematostroma (SUT293)
H. anthochroum (SUT233)
H. anthochroum {SUT240)
H. kanchanapisekii (SUT068)
H. kanchanapisekii (SUT069)
H. kanchanapisekii (SUT066)
H. rubiginosum {SUT215)
H. rubiginosum {$UT221)

400

. H. fendieri (45390400)
H. cf. fendleri (suT280)

106

H. cf. fendleri (SuT061}

4, H. cf. fendieri (SUT165)
H. cf. fendieri (SUT162) ill
H. cf. fendieri (SuT159}
400 H. cf. archeri (SUT105)
H. cf. archeri (SUT103)
H. cf. archeri ($T2333)
H, cf. archeri (812527)

0.1

Fig. 3 Phylogenetic tree construction based on ITS1-5.8S-ITS2 sequences of Hypoxylon species.
Branch lengths are scaled in terms of expected numbers of nucleotide substitution per site.
Numbers on branches are bootstrap values from 1000 replications.

characteristics matched H. fendleri (Ju and Rogers 1996). However, Ju and Rogers (1996)
pointed out that H. fendleri and H. retpela Van der Gucht & Van der Veken are very
similar stating “These two fungi differ mainly in the conspicuousness of their perispore
ornamentation’. The ornamentation in H. retpela is described as very conspicuously
coil-like. However all the Thai collections had similar coiling which was not noticeably
conspicuous. Thus the description for H. fendleri (Ju & Rogers 1996) is the nearest match.
The phylogenetic result showed that all the Thai isolates (SUT061, SUT159, SUT162,

320

SUT165, and SUT280) grouped together and were placed as a sister branch of H. fendleri
(AJ390400) based on the GenBank database sequence with high bootstrap support. The
percentage similarity of H. fendleri (AJ390400) to SUT061, SUT159, SUT162, SUT165,
and SUT280 isolates was 85%, 85%, 85%, 85%, and 80% respectively. They are therefore
quite different and as a result the Thai collections were recorded as H. cf. fendleri. This
might be the result of a wide range of H. fendleri descriptions (morphological) or genetic
variation within this taxon found in Thailand. More collections of specimens around
the world are required for a better understanding of species delimitation and genetic
variation within this taxon.

Four isolates of H. cf. archeri were grouped together. All of them had a small ostiolar
disc around 0.1-0.2 mm in diameter, and belonged to the section Annulata. They
appeared as a paraphyletic group with other isolates of the section Annulata also placed
in Clade II. Its morphological features were similar to those of H. archeri Berk. and
H. michelianum Ces. & De Not. Ascospore dimensions, stromatal form, and coloration
are indicative of H. archeri, but the distinctive white fringe surrounding the ostioles is
reminiscent of H. michelianum. However, H. cf. archeri examined, in the current study,
grouped in Clade III and were thus separated from the other species of the Annulata,
which grouped in Clade I. Unfortunately, no voucher material was available for DNA
extraction or for morphological comparison, and no sequences were available in
GenBank.

Key to taxa of section Hypoxylon in this study

la. Ascospores with perispore not dehiscent in 10% KOH ..... H. kanchanapisekii
Ibi Ascospores with perispore dehiscent 1n.l0? K@li rie 5. eat. Serene 2
Zae (1b) Stromatalstirtace without vinaceOUs snaces(. 4) 1. Ane ern ee oe 3
2b) -Stromatal surface with vinaceous shades fermi seem FA ean 6
3a: (2a) Ascospores'less than 12 jim long’... eee ee eee +
SMa ASCOSpOres greater thatitl tits lONG ses ake teed eee ee eee ee oe

4a. (3a) Stromatal glomerate to effused-pulvinate, rosellinioid; grayish sepia (106), or
brown vinaceous (84), with KOH-extractable pigments sienna (8), cinnamon (62),
fulvous (43); ascospores brown to dark brown, unicellular, ellipsoid-inequilateral,
with slightly sigmoid germ slit spore-length, 10-12.5x 3.8-5um...............

4b. Stromatal glomerate to effused-pulvinate, rosellinioid; reddish brown, with KOH-
extractable pigments brown vinaceous (84), or umber (9); ascospore brown to
dark brown, unicellular, ellipsoid-inequilateral, with straight germ slit spore-
length.9 1 26x35 RSA es ee ee A Ek, H. sublenormandii

5a. (3b) Stromatal hemispherical to effused-pulvinate, plane or with inconspicuous
to conspicuous perithecial mounds; surface orange (7), or rust (39); orange
red granules immediately beneath surface and between perithecia, with KOH-
extractable pigments orange (7) or scaret (5); ascospores brown to dark brown,

5b.

6a.

6b.

Tas

7b.
8a.

8b.

aa1

unicellular, ellipsoid-inequilateral, with slightly sigmoid germ slit spore-length,
13-17.9 x 6.3-8.6 um; perispore dehiscent in 10% KOH, smooth...............
| eR Rea Ei ace eur id aly ca es hd ap A AA Pi H. haematostroma

Stromatal hemispherical to effused-pulvinate, with conspicuous perithecial
mounds; surface fulvous (43), or rust (39); rust granules immediately beneath
surface and between perithecia, with KOH-extractable pigments orange (7) or
scaret (5); ascospores brown to dark brown, unicellular, ellipsoid-inequilateral,
with straight germ slit spore-length, (10-) 12.5-14 x 5-6.3 ttm; perispore dehiscent
in 10% KOH, inconspicuous coil-like ornamentation ........... H. suranareei

(2b) KOH-extractable pigments olivaceous (48), or gray olivaceous (107), or
RTCOMISNICI VACCOUS (70 atest ine atresia te ne H. anthochroum

KOH-extractable pigments other than greenish or olivaceous, or without apparent
OURS ANTS Cpe cs RT MEDI See MEN PNET SeRCe ANE THe: OHNE SMC Ee UE ERER SUN EE es MO oP re 7

(6b) KOH-extractable pigments purplish or without apparent pigments ........
ee My te ee Se sin eet eee H. monticulosum

(7b) KOH-extractable pigments orange (7); ascospores brown to dark brown,
unicellular, ellipsoid-inequilateral, with slightly sigmoid germ slit spore-length,
895211 Si C12S) BS PAA Re eae ALA he H. fendleri
KOH-extractable pigments rust (39); ascospores brown to dark brown, unicellular,
ellipsoid-inequilateral, with straight germ slit spore-length, (7.5-) 8.8-10 x 3.8-5
ELLE RT ih ie I Eel ei fe H. rubiginosum

Key to taxa of section Annulata in this study

La.
1b.

Dar
2b.

3a.

3b.

Aa.

Ab.
5a.

5b.

Ostiolar disc not exceeding than.) 3.mimidiameteiers . cued oe ade be Paes 2,
Ostiolardiscexceeding than.U:5 mim diametcte.: sree eee ae ae m1
(1a) KOH-extractable pigments hazel (88) or honey (64) ......... H. cf. archeri
KOH-extractable pigments olivaceous (48) or greenish olivaceous (90) ........ 3

Le RSNA AIAL: ah cobra AS re uN 5 ae MRO Rawr a BAI eae, H. stygium

Stromata rose-coloured with blackish; conidiogenous structure Nodulisporium-
Rea gre ors Srecahsaks so passe Fos op eG ais 5 A oh RP TONER oe D H. atroroseum

(1b) Ostiolar disc variable, 0.3-0.7 mm; ascospores 7.5-10 x 3.5-5 um ..........
SRS ESR, es PE iC CEN RSPR APU ROE H, bovei var. microspora

(4b) KOH-extractable pigments greenish olivaceous (90); ascospores 7.5-10 x 3.8-
GUURETIN, 13.2.6 PR SS VIR As ¢ Pree a dir Eke ete Marra daha AM ey H. nitens
KOH-extractable pigments vinaceous purple (101); ascospores 7.5-10 x 3.8-5 um

aiele Bethel Mh Le AMAR TASA + PRATT eatoeame aby RM hones be H. purpureonitens

O22

Conclusions

Fifteen Hypoxylon species identified from eighty nine collections from Thailand were
recorded including three new species, H. kanchanapisekii, H. sublenormandii, and H.
suranareei. The phylogenetic relationships between morphological and molecular data
of the Hypoxylon species were achieved following sequence analysis of ITS1-5.8S-ITS2
rDNA regions. These molecular results showed clear separation within the Hypoxylon
species studied and could be used to confirm the new species. In addition, molecular
data could be used to resolve taxonomic problems based solely on morphology and has
the potential to recognize the delimitation of other species in future study. Within the
genus molecular data is valuable for resolving species complexes and for the recognition
of relationships between species. The ITS sequences obtained in the current study do not
support a clear separation of members of Hypoxylon and section Annulata and this is in
agreement with the findings of Sanchez-Ballesteros et al. (2000). However, Hsieh et al.
(2005) provided strong evidence for their separation based on different DNA sequences
which is therefore in contrast with our findings and those of Sanchez-Ballesteros et al.
(2000)

Acknowledgements

This study was financially supported by the Thailand Research Fund through the Royal Golden
Jubilee Ph.D. Program. Instrumental supports were provided by Suranaree University of
Technology, the Royal Forest Department (Thailand), and the Biotechnology and Development
Office (Department of Agriculture, Thailand). The authors are grateful to Dr. Yu-Ming Ju (National
University of Taiwan) for providing some of the Hypoxylon strains and giving valuable comments,
Asst. Prof. Dr. Saowalak Pongpaijit (Prince of Songkla University, Thailand) and Dr. Cherdchai
Phosri (Pibulsongkram Rajabhat University, Thailand) for collecting Hypoxylon specimens, Dr.
Jittra Piapukiew (Chulalongkorn University, Thailand) for phylogenetic program support, and
Miss Korawan Ratanachai (Suranaree University of Technology, Thailand) for helping with the
scanning electron microscopy. We greatly appreciate Prof. Roy Watling (Royal Botanic Edinburgh,
U.K.) and Prof. Jack D. Rogers (Washington State University, U.S.A.) for peer reviewers.

Literature Cited

Bruns TD, White TJ, Taylor JW. 1991. Fungal molecular systematics. Annual Review of Ecology
and Systematics 221: 524-564.

Edwards RL, Jonglaekha N, Kshirsagar A, Maitland DJ, Mekkamol S, Nugent LK, Phosri C, Rodtong
S, Ruchikachorn N, Sangvichien E, Sharples GP, Sihanonth P, Suwannasai N, Thienhirun
S, Whalley AJS, Whalley MA. 2003. The Xylariaceae as phytopathogens. Recent Research
Developments in Plant Sciences 1: 1-19.

Felsenstein J. 1995. PHYLIP: Phylogeny inference package. Version 3.6. Department of Genetics,
University of Washington.

Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycetes application
to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113-118.

Gonzalez FSM, Rogers JD. 1993. Biscogniauxia and Camillea in Mexico. Mycotaxon 47: 229-258.

Hsieh H-M, Ju Y-M, Rogers JD. 2005. Molecular phylogeny of Hypoxylon and closely related
genera. Mycologia 97: 844-865.

Ju Y-M, Rogers JD. 1994. Kretzschmariella culmorum (Cooke) Y.-M. Ju & J.D. Rogers and notes on
some other monocot-inhabiting xylariaceous fungi. Mycotaxon 51: 241-255.

323

Ju Y-M, Rogers JD. 1996. A revision of the genus Hypoxylon. Mycologia Memoir 20: 1-365. APS
Press, St Paul.

Ju Y-M, Rogers JD, Hsieh HM. 2004. New Hypoxylon species and notes on some names associated
with or related to Hypoxylon. Mycologia 96: 154-161.

Ju Y-M, Rogers JD, Hsieh HM. 2005. New Hypoxylon and Nemania species from Costa Rica and
Taiwan. Mycologia 97: 562-567.

Ju Y-M, Rogers JD, San Martin F, Grammo A. 1998. The genus Biscogniauxia. Mycotaxon 66:
1-98.

Kimura M. 1980. A simple method for estimating evolutionary rates of base substitutions through
comparative studies of nucleotide sequences. Journal of Molecular Evolution 16: 111-120.
Lzessge T, Rogers JD, Whalley AJS. 1989. Camillea, Jongiella and light-spored species of Hypoxylon.

Mycological Research 93: 121-155.

Leessge T, Spooner BM. 1994. Rosellinia and Astrocystis (Xylariaceae): new species and generic
concepts. Kew Bulletin 49: 1-70.

Lee SB, Taylor JW. 1990. Isolation of DNA from fungal mycelia and single spores. In: MA. Innis,
DH. Gelfand, JS. Sninsky, TJ. White, eds. PCR Protocols. Academic Press, San Diego New York
Boston (1990). p. 282-287.

LoBuglio KF, Taylor JW. 1995. Phylogeny and PCR identification of the human pathogenic fungus
Penicillium marneffei. Journal of Clinical Microbiology 33: 85-89.

Martin P. 1968. Studies in the Xylariaceae, IV. Hypoxylon sections Papillata and Annulata. J S Afr
Bot 34: 303-330.

Mazzaglia A, Anselmi N, Gasbarri A, Vanini A. 2001. Sequence analysis of the 5.88 rDNA and
ITS regions in evaluating genetic relationships among some species of Hypoxylon and related
genera. Mycological Research 105: 670-675.

Miller JH. 1961. A monograph of the world species of Hypoxylon. University of Georgia Press:
Athens, U.S.A.

O'Donnell K. 1992. Ribosomal DNA internal transcribed spacers are highly divergent in the
phytopathogenic ascomycetes Fusarium sambucinum (Gibberella pulicaris). Current Genetics
22: 213-220. |

Petrini LE. 1992. Rosellinia species of the temperate zones. Sydowia 44: 169-281.

Pouzar Z. 1985. Reassessment of Hypoxylon serpens -complex I. Ceska Mykologia 39: 129-134.

Rayner, R.W. (1970). A mycological colour chart. Commonwealth Mycological Institute, Kew and
British Mycological Society. 34 p. + charts I & IL.

Rodrigues KF, Petrini, O. 1997. Biodiversity of endophytic fungi in Tropical regions. In: KD. Hyde,
ed. Biodiversity of Tropical Microfungi. Hong Kong University Press, Hong Kong. p. 57-69.
Rogers JD. 1979. The Xylariaceae: systematic, biological and evolutionary aspects. Mycologia

71: 1-42.

Rogers JD. 2000. Thoughts and musings on tropical Xylariaceae. Mycological Research 104:
1412-1420.

Rogers JD, Ju Y-M. 1996. Entoleuca mammata comb. nov. for Hypoxylon mammatum and the genus
Entoleuca. Mycotaxon 59: 441-448.

Saenz GS, Taylor JW. 1999. Phylogeny of the Erysiphales (powdery mildews) inferred from internal
transcribed spacer ribosomal DNA sequences. Canadian Journal of Botany 77: 150-169.

Sanchez-Ballesteros J, Gonzalez V, Salazar O, Acero J, Portal MA, Julian M, Rubio V, Bills GF,
Polishook JD, Platas G, Mochales S, Pelaez FE. 2000. Phylogenetic study of Hypoxylon and related
genera based on ribosomal ITS sequences. Mycologia 92: 964-977.

Schulz B, Boyle C, Draeger S, Rommert AK, Krohn K. 2002. Endophytic fungi: a source of novel

324

biologically active secondary metabolites. Mycological Research 106: 996-1004.

Skouboe P, Frisvad JC, Taylor JW, Lauritsen D, Boysen M, Rossen L. 1999. Phylogenetic analysis of
nucleotide sequences from the ITS region of terverticilattate Penicillium species. Mycological
Research 103: 873-881.

Swofford DL. 2002. PAUP*: phylogenetic analysis using parsimony (*and other methods). Version
4. Sinauer Associates, Suderland, MA.

Thienhirun S. 1997. A Preliminary Account of the Xylariaceae of Thailand: Ph.D Thesis, Liverpool
John Moores University, UK.

Tompson JD, Higgins DG, Gibson TJ. 1994. CLUSTALW: improving the sensitivity of progressive
multiple sequence alignment through sequence weighting, position-specific gap penalties and
weight matrix choice. Nuclei Acids Research 22: 4673-4680.

Van der Gucht K. 1994. The Xylariaceae of Papua New Guinea. Ph.D Thesis, Univercity of Gent,
Belgium.

Whalley AJS, 1996. The Xylariaceous way of life. Mycological Research 100: 897-922.

Whalley AJS., Edwards, RL. 1995. Secondary metabolites and systematic arrangement within the
Xylariaceae. Canadian Journal of Botany 73 Suppl. 1: S802-S810.

Whalley AJS, Lzessoe T, Kile GA. 1990. A new species of Biscogniauxia with appendaged ascospores
from Tasmania. Mycological Research 94: 27-239.

White TJ, Bruns TD, Lee SB, Taylor JW. 1990. Amplification and direct sequencing of fungal
ribosomal RNA genes for phylogenetics. In: MA. Innis, DH. Gelfand, JS. Sninsky, TJ. White,
eds. PCR Protocols. Academic Press, San Diego New York Boston (1990). pp. 315-322.

Volume 94, pp. 325-329 October-December 2005

Tricholoma equestre, the correct name for T. flavovirens
(Agaricales)

H. DENG”? & Y. -J. YAo™*

*yaoyj@sun.im.ac.cn

‘Systematic Mycology and Lichenology Laboratory, Institute of Microbiology
Chinese Academy of Sciences, Beijing, 100080, China

*Graduate School of the Chinese Academy of Sciences

Abstract—Tricholoma equestre is considered to be the correct name for the species often
known as T: flavovirens. The history of the conservation of the generic name Tricholoma
and its type, T. flavovirens, is reviewed and presented here. The author citation of T.
flavovirens is also discussed and the upcoming correction in the ICBN is addressed.

Key words—nomenclature, synonym, Tricholomataceae

The type of Tricholoma (Fr.) Staude, nom. cons., is T. flavovirens (for the author citation
of this name, see the discussion below), as reported in successive editions of the
International Code of Botanical Nomenclature (ICBN; see Voss et al. 1983; Greuter et
al. 1988, 1994, 2000). However, much confusion has surrounded the correct name of
the species to which this name has been applied because T: equestre and T. flavovirens are
almost universally regarded as synonyms. Some researchers consider T: equestre as the
preferred name with T. flavovirens its synonym (e.g. Bon 1987, Tkaléec & MeSié 2002,
Massart 2003, Horak 2005), but many others still accept T. flavovirens as the correct
name and reduce T. equestre to synonymy (e.g. Moser 1983, Singer 1986, Phillips 1988,
Hansen & Knudsen 1992, Jordan 1995, Bruns et al. 1998, Noordeloos & Christensen
1999).

In their survey of Tricholoma species reported from China, Deng et al. (2004) noted
that both T. equestre (e.g. Tai 1979, Tseng 1996, CAS 1996) and T! flavovirens (e.g. Ying
& Zang 1994, Mao 2000, Wen et al. 2001, Wang et al. 2004) were cited in the Chinese
literature, with the latter used more frequently, especially in recent years.

A second, more global, literature search was conducted to determine the correct name
for this species. Agaricus equestris (=T. equestre) and A. flavovirens (=T. flavovirens) were
consistently treated as synonyms by Fries (Fries 1821, 1828, 1874). The two names were
also considered synonymous both by many of Fries’ contemporaries (see Saccardo 1911)
and more recent agaricologists (e.g. Singer 1962, 1975, 1986; Bon 1976, 1984; Hansen &
Knudsen 1992, Noordeloos & Christensen 1999, Horak 2005).

“Author for correspondence

326

Although A. equestris was first treated as a synonym of A. flavovirens by Fries (1821),
it was restored as an accepted name and the latter reduced to a synonym (Fries 1828, and
1832 in the index to Systema Mycologicum). According to the ICBN (Art. 15, including
Note 1, in Greuter et al. 2000), both A. equestris and A. flavovirens were sanctioned by
Fries (1821, 1828), but A. equestris, as the earlier name, has priority over A. flavovirens.
This conclusion is also indicated in Ex. 4 of Art. 15, ICBN, although the date of Persoon’s
name is incorrect (see below). Therefore, if the two are regarded as synonymous, it is
clear that T’ equestre is the correct name for the species and T. flavovirens is a later
synonym. The author citation and references of these two names are listed below:

Tricholoma equestre (L. : Fr.) P. Kumm., Fiihr. Pilzk.: 130. 1871.
=Agaricus equestris L., Sp. pl. Ed. 1, 1173. 1753. : Fr., Elen. fung. 1: 6. 1828.
=Agaricus flavovirens Pers. in Hoffmann, Abbild. Schwamme 3: t. 24. 1793. : Fr., Syst.
mycol. 1: 41. 1821.

=Tricholoma flavovirens (Pers. : Fr.) S. Lundell in Lundell & Nannfeldt, Fung. Exs.
Suec., Fasc. 23-24: no. 1102. 1942.

Of the several proposals considered by the IAPT Special Committee for Fungi (Rogers
1953a), conservation of the generic name Tricholoma (Fr.) P. Kumm. 1871 against
Tricholoma Benth. 1846 (the name of a plant genus in the Scrophulariaceae) was finally
approved (Rogers 1953b) and formally included in the list of conserved generic names
in the 1956 ICBN (Lanjouw et al. 1956) as:

“Tricholoma (Fries) Kummer, Fiihr. Pilzk. 25. 1871.
T.: Agaricus flavovirens A. & S. ex Fr. Syst. Mycol. 1: 41. 1821 (cf. A. equestris Fr. Elench.
Fung. 1:6. 1828):

Donk (1962, 1968) subsequently determined that the author who first validly published
the conserved Tricholoma was not Kummer, but Staude. Therefore, the authorship for the
generic name in the 1972 ICBN (Stafleu et al. 1972) was changed from ‘(Fries) Kummer,
Fuhr. Pilzk. 25, 129. 1871? to ‘(E. M. Fries) Staude, Pilze Mitt.-Deutschl. xviii, 25. 1857
The type of the conserved generic name Tricholoma, namely ‘Agaricus flavovirens A.
& S. ex Fr., Syst. Mycol. 1: 41. 1821 (cf. A. equestris Fr., Elench. Fung. 1: 6. 1828); was
also included in the proposal for conservation (Rogers 1953b) and accepted as thus
in the 1956 edition of ICBN. Later editions of the ICBN, however, replaced the type
synonymy—the part in brackets: “(cf. A. equestris Fr. Elench. Fung. 1: 6. 1828)’—with
‘[A. equestris Fries]’

In the 1983 ICBN (Voss et al. 1983), the type was listed as ‘T. flavovirens (Albertini
et Schweinitz : E. M. Fries) Lundell (Agaricus flavovirens Albertini et Schweinitz : E. M.
Fries), and in the most recent edition (Greuter et al. 2000) as ‘Agaricus flavovirens Alb.
& Schwein. : Fr. (T. flavovirens (Alb. & Schwein. : Fr.) S. Lundel [sic!]). The synonym
‘A. equestris’ no longer appeared in the list of conserved names. Singer, who cited T.
equestre as the type of Tricholoma (Singer 1962, 1975), did list T. flavovirens as type in
accordance with the 1983 ICBN in the 4" edition of Agaricales in Modern Taxonomy
(Singer 1986). It is noteworthy that Bon, who first cited T. flavovirens with T. equestre as
its synonym (Bon 1984), later reversed himself, citing T. flavovirens as synonymous to
T. equestre (Bon 1987).

327

Although T. flavovirens has been designated as the type of Tricholoma in the ICBN
list of conserved generic names, it is necessary to important to note that T’ equestre is
the correct name for the species to which the name T. flavovirens applies. In fact, it is
not uncommon that the generic or specific name that indicates the type of the name of a
family or genus is not the correct name for that genus or species. For example, the type
of the family name Caryophyllaceae Juss. is Caryophyllus Mill. 1754 (non Caryophyllus
L. 1753), but the accepted name for the genus to which Caryophyllus Mill. applies is
Dianthus L. 1753 (Ex. 4 of Art. 18.3, ICBN).

Further, the authorship of A. flavovirens, ‘A. & S. ex Fr; was listed in the conservation
of Tricholoma in the 1956 ICBN (Lanjouw et al. 1956). The authorship later changed to
‘Alb. & Schwein. : Fr’ (Greuter et al. 1994, 2000), although ‘Pers. (1801)’ has been cited
in Art. 15, Ex. 4 since 1994 (Greuter et al. 1994, 2000). However, in Fries (1821: 41), A.
flavovirens was referred to “Abb. d. Schw. - Pers. Syn. p. 319? The abbreviation Abb. d.
Schw. stands for Abbildungen der Schwadmme, now abbreviated as Abbild. Schwamme
(Stafleu & Cowan 1979: 239), in which A. flavovirens was first published by Persoon (in
Hoffmann 1793). It is unclear why this was mistaken as ‘Alb. & Schw. at least since Rogers
(1953b), but the error may have arisen because the two were very well known authors who
included a description of A. flavovirens in their major mycological publication (Albertini &
Schweinitz 1805: 167). Although “Pers. Syn. p. 319.’ (Persoon 1801) was also mentioned
by Fries (1821), Persoon (1801: 319) explicitly mentioned the earlier publication of the
taxon by Persoon (in Hoffmann 1793).

Accordingly, the author citation for A. flavovirens in both Ex. 4 of Art. 15 and the list
of conserved names of the ICBN should be corrected to ‘Pers. (1793)’ in future editions. The
authors have been informed that the authorship of the species name indicating the type of
Tricholoma will be corrected in the upcoming ICBN (McNeill et al. 2006 in prep., Demoulin
pers. comm. 2006) to: T: flavovirens (Pers. : Fr.) S. Lundell (Agaricus flavovirens Pers. :
Fr.).

Acknowledgements

The authors wish to thank Drs D. N. Pegler and L. L. Norvell for serving as pre-submission reviewers.
Drs R. Korf, V. Demoulin, W. Gams, S. Redhead and J. McNeill are also thanked for their valuable
discussions and comments on the manuscript. Special appreciation is due to Dr S. R. Pennycook
for his careful nomenclature checking and also for indication of the correct authorship for Agaricus
flavovirens. This project is supported by the ‘Programme for International Science and Technology
Cooperation Project of P. R. China (2001CB711103) from Ministry of Science and Technology,
the ‘General Programme Funding’ (30470008) and the ‘National Science Fund for Distinguished
Young Scholars’ (30025002) from National Natural Science Foundation of China and the ‘Research
Project of Innovation Programme’ (KSCX2-SW-101C) and the scheme of ‘Introduction of Overseas
Outstanding Talents’ operated by Chinese Academy of Sciences.

Literature cited

Albertini JB de, Schweinitz LD de. 1805. Conspectus Fungorum in Lusatiae Superioris Agro
Niskiensi Crescentium. E Methodo Persoonian. Lipsiae: Sumtibus Kummerianis.

- Bon M. 1976. Tricholomes de France et d'Europe Occidentale (4@me partie). Documents

Mycologiques 6 (22-23): 165-304.

328

Bon M. 1984. Les Tricholomes de France et d'Europe Occidentale. Paris: Editions Lechevalier
5, A.R.L;

Bon M. 1987. The Mushrooms and Toadstools of Britain and Northwestern Europe. London:
Hodder & Stoughton.

Bruns TD, Szaro TM, Gardes M, Cullings, KW, Pan JJ, Taylor DL, Horton TR, Kretzer A, Garbelotto M, Li
Y. 1998. A sequence database for the identification of ectomycorrhizal basidiomycetes by phylogenetic
analysis. Molecular Ecology 7: 257-272.

Comprehensive Scientific Expedition Team to the Qinghai-Xizang Plateau, Chinese Academy of Sciences
[CAS]. 1996. Fungi in Hengduan Mountain Region. Beijing: Science Press. (in Chinese).

Deng H, Yao Y-J, Pegler DN. 2004. An annotated checklist of Tricholoma from China. Journal of
Fungal Research 2: 1-18.

Donk MA. 1962. The generic names proposed for Agaricaceae. Beih. Nova Hedwigia 5: 1-320.

Donk MA. 1968. Report of the committee for fungi and lichens 1964-1969. Taxon 17: 578-582.

Fries EM. 1821. Systema Mycologicum 1. Gryphiswaldiae: Sumtibus Ernesti Mauritii.

Fries EM. 1828. Elenchus Fungorum 1. Gryphiswaldiae: Sumtibus Ernesti Mauritii.

Fries EM. 1832. Systema Mycologicum, Index Alphabeticus. Gryphiswaldiae: Sumtibus Ernesti Mauritii.

Fries EM. 1874. Hymenomycetes Europaei. Upsaliae: Ed. Berling.

Greuter W, Burdet HM, Chaloner WG, Demoulin V, Brolle R, Hawksworth DL, Nicolson DH, Silva PC,
Stafleu FA, Voss EG, McNeill J. 1988. International Code of Botanical Nomenclature. K6nigstein:
Koltz Scientific Books.

Greuter W, Barrie FR, Burdet HM, Chaloner WG, Demoulin V, Hawksworth DL, Jorgensen PM, Nicolson
DH, Silva PC, Trehane P, McNeill J. 1994. International Code of Botanical Nomenclature. K6nigstein:
Koltz Scientific Books.

Greuter W, McNell J, Barrie FR, Burdet HM, Demoulin V, Filgueiras TS, Nicolson DH, Silva PC, Skog
JE, Trehane P, Turland NJ, Hawksworh DL. 2000. International Code of Botanical Nomenclature.
Koenigstein, Germany: Koeltz Scientific Books.

Hansen L, Knudsen H. 1992. Nordic Macromycetes Vol. 2 Polyporales, Boletales, Agaricales, Russulales.
Copenhagen: Nordsvamp.

Hoffmann GF (ed.). 1793. Abbildungen der Schwamme 3: t. 24.

Horak E. 2005. Rohrlinge und Blatterpilze in Europa. Munich [Miinchen]: Spektrum Akademischer
Verlag [Elsevier].

Jordan M. 1995. The Encyclopedia of Fungi of Britain and Europe. Newton Abbot, UK: David &
Charles.

Lanjouw J, Baehni CH, Robyns W, Rollins RC, Ross R, Rousseau J, Schulze GM, Smith AC, de Vilmorin
R, Stafleu FA. 1956. International Code of Botanical Nomenclature. Utrecht, Netherlands: the
International Bureau for Plant Taxonomy and Noniencare of the International Association for
Plant Taxonomy.

Mao XL. 2000. The Macrofungi in China. Zhengzhou: Henan Science and Technology Press. (in
Chinese).

Massart FE. 2003. Le tricholome doré (Tricholoma auratum [Fr.] Gillet) au banc des accusés.
Documents mycologiques 32(126): 17-20.

McNeill J, Barrie FR, Burdet HM, Demoulin V, Hawksworth DL, Marhold K, Nicolson DH,
Prado J, Silva PC, Skog JE, Wiersema JH, Turland NJ. 2006. International Code of Botanical
Nomenclature. Kénigstein, Germany: Koeltz Scientific Books. (in prep.).

Moser M. 1983. Keys to Agarics and Boleti. London: Roger Phillips.

329

Nordeloos ME, Christensen M. 1999. 3. Tricholoma (Fr.: Fr.) Staude, Mitteldeutschl.: 125. 1857.

107-148. IN Flora Agaricina Neerlandica. Volume 4. C Bas, TW Kuyper, ME Noordeloos, EC
_ Vellinga (eds.). Rotterdam: AA Bakelma.

Persoon CH. 1801. Synopsis Methodica Fungorum. Gottingen, Sweden: Henricum Dieterich.

Phillips R. 1988. Mushrooms and Other Fungi of Great Britain and Europe. London: Pan Macmillan
Ltd.

Rogers DP. 1953a. Special committee for fungi, disposition of nomina generica conservanda for fungi.
Taxon 2: 29-32.

Rogers DP. 1953b. Special committee for fungi, disposition of nomina generica conservanda for fungi.
Taxon 2: 102.

Saccardo PA. 1911. Sylloge Fungorum omnium hucusque cognitorum. 20. Padova.

Singer R. 1962. The Agaricales in Modern Taxonomy. 2nd Ed. Weinheim: J. Cramer.

Singer R. 1975. The Agaricales in Modern Taxonomy. 3rd Ed. Vaduz: J. Cramer.

Singer R. 1986. The Agaricales in Modern Taxononmy. 4th Ed. Koenigstein, Germany: Koeltz Scientific
Books.

Stafleu FA, Bonner CEB, McVaugh R, Meikle RD, Rollins RC, Ross R, Schopf JM, Schulze GM, de
Vilmorin R. 1972. International Code of Botanical Nomenclature. Utrecht, Netherlands: A. Oosthoek’s
Uitgeversmaatschappij N.V.

Stafleu FA, Cowan RS. 1979. Taxonomic Literature, 2nd Ed. Volume II: H—Le. Regnum Vegetable 98:
1-991.

Tai F-L. 1979. Sylloge Fungorum Sinicorum. Beijing: Science Press. (in Chinese).

Tseng S-C. 1996. Fungi of China. Ithaca, New York: Mycotaxon, Ltd.

Tkaléec Z, Mesi¢ A. 2002. Preliminary checklist of Agaricales from Croatia. I. Families Pleurotaceae
and Tricholomataceae. Mycotaxon 81: 113-176.

Voss EG, Burdet HM, Chaloner WG, Demoulin V, Hiepko P, McNeill J, Meikle RD, Nicolson DH, Rollins
RC, Silva PC, Greuter W. 1983. International Code of Botanical Nomenclature. Utrecht, Antwerpen:
Bohn, Scheltema & Holkema.

Wang X-H, Liu P-G, Yu F-Q. 2004. Color Atlas of Wild Commercial Mushrooms in Yunnan. Kunming:
Yunnan Science and Technology Press. (in Chinese).

Wen, H-A, Mao X-L, Sun S-X. 2001. Agarics and other macromycetes. In Higher Fungi of Tropical China.
(ed. Zhuang W-Y.), pp 287-351. Ithaca, New York: Mycotaxon Ltd.

Ying J-Z, Zang M. 1994. Economic Macrofungi from Southwestern China. Beijing: Science Press. (in
Chinese).

pone.
=o

Panacea aaa |
if on | en re sa vhs si) f
en apePAaRH TS eg Mop es
ie Cana eh gir ee
hs: gga ecwremeremeintemerctamecme seer)
:

paieae es apkineorpll hoi cB 9
{SNe ae
ea Merial

pene thi Ai rapa Mee hal of Jpafawonig Gann
ae a ser ee es snide} fargiomipecaud rewire iturh sential
ae wine shtiadepeomitictas abhi
} sofia, > Wak agate at erent rircromnmmanie pees reels.
if | oh 1 pig se adh MA ogapetnen) nar Hb Ae ee ait ag aie Sit
| wane P ‘ne Sti, “ohapod Aube tn is 3. Sh) yphuggealchce: Sxnithoy Bare! bt ae Se oa "akied!
| he bl gatteadird Ay hm NA, wy Lo Sk ltt AR rue Wale
bv Th bia) ceiver sdiuniies eo el RH so otc Semmahatrenel CN ooo
:| :S6 =’ di py ta ulAi, ti if utkstarr VC, bet nepal! ing VP Beelle UW. Maehewshhlit Ge yb ie
ee Oras Huei sgt Mh oR Ciena LoeinneseT re

i Gwe Ohad eet ove. uit [ ein

| eS a 7 1 these ern aby Salhi adsl amasenieh RMORIT
re “a OY hate Meet ae xi Tontehdualaalt ari, scrtnhrta gin Nite icp eH Es ngs
oy

Ls ° ee si ce vitteoa’l: : ats aid eee eoliahiengh to seid sd ytaaicnilan LORS eM So

7 . tae Veg! ext Bort A Beyncan iv Dew ak insects aaa 7
i es Hilan ae betel. (ic M7 SEI, tage Ctebvah i pedl hl enantio

- | 7 a wiRe el bf sts ty usteripoievide Riders oho) lnecir ti Ret W mive, 4 ava Sui *
bs ‘>, oie Liv bruike Alacrtrgtp Hass Vel, z Polsyaceni iS ale owl Weare teal SAL abe ,
eet oh 4 ‘Hat nde iy vite shih Latrescreec) DITW to 261A yoko) 005 0-1 oil DAT kd BK gia ;
| i% AF gee. (204: A Rint mets Ole (aed ftidee Bis I -ygokgerbys0 ‘

oan meat is ay ‘anpeonorion were crore bog ed igi ob

, © 4 or ay Satay, oer S aT apap, ohio et 1i2=TAe

ea ; i or 2 ' capa ov vinioepit casera mh

ke \ | a vib leer 7 } aa ay ‘ nil)
ie a io a stow Rea ances ue nn Cav its | atypn
| Pee os Hed (8. 19S. pteenstionsl Cons of eaativul eeveamtanyed! ‘Uist, Nethiata § is p:
ic ala: aac vat fe 8 man Tagpramey roe fy en, ate eee fe
OT mains : hy ete a»

ou ial ves. wy Nasowli Linge be Chal oe sad ine i ech
} its : " baa : a tNEs

a on | tte \ AOR A> iio ribet - yd wef Opi iad ahaa i. fi
eon it. oe die FNS ee In | yhre ie .
t re \ Aa aoe See Ny heen men n “ Loewe : i, vera Py. Nawieon hoy
i _' ; . Pe oe

MYCOTAZON

Volume 94, pp. 331-340 October-December 2005

A new species of Lecanicillium
isolated from the white pine weevil, Pissodes strobi

HARRY H. KOPE & ISABEL LEAL

Harry.Kope@gov.bc.ca
ileal@pfc.forestry.ca
Natural Resources Canada, Canadian Forest Service
Pacific Forestry Center, 506 West Burnside Road
Victoria, British Columbia, V8Z 1M5, Canada

Abstract—A species of Lecanicillium was isolated from the white pine weevil Pissodes
strobi on Vancouver Island, British Columbia, Canada. Isolates were collected from
adult weevil cadavers. The fungus shares some morphological traits with L. attenuatum
although it differs in having a slower growth rate, larger conidial heads holding up to
50 conidia, a longer average phialide length and variable conidial size and shape. An
analysis of the mitochondrial DNA and the f-tubulin gene showed the fungus to be
distinct from other Lecanicillium species. The new species, Lecanicillium pissodis, is
described and illustrated.

Key words—entomopathogen, Hyphomycete, Picea, Curculionidae, biological control,
Verticillium section Prostrata

Introduction

Numerous entomopathogenic Hyphomycetes have been isolated and described from
various insect hosts worldwide (Butt et al. 2001). Entomogenous Hyphomycetes in the
genera Cephalosporium Corda and Verticillium Nees were originally classified by isolates
that formed either single conidiophores or verticillate conidiophores, respectively (Petch
1925, 1931, 1932, 1939; Batazy 1973), and both authors had differentiated multiple taxa
within the two genera based on morphological details. In 1971, Gams erected the new
section Prostrata of the genus Verticillium and consolidated a range of Cephalosporium
isolates that varied greatly in conidial shape and size under one name; Verticillium lecanii
(Zimm.) Viégas. In 2001, Zare & Gams revisited Verticillium sect. Prostrata and, by
using microscopic and molecular methods, they subsequently placed fifteen species into
a new genus, Lecanicillium W. Gams & Zare. Their thorough work has resolved many of
the difficulties of a broad array of variable isolates of this genus of entomogenous and
fungicolous anamorphs of the Clavicipitaceae.

In 2003 live adult white pine weevils (Pissodes strobi Peck) were collected from
Vancouver Island, British Columbia (BC) and while in rearing cages, dead weevils were
noted and assayed for the presence of entomopathogenic fungi. The collected fungi were
identified as Lecanicillium muscarium (Petch) Zare & W. Gams, with the exception of

three isolates. Microscopic examination and PCR-RFLP analysis determined that the
three unidentified isolates did not fit the descriptions given for known Lecanicillium
species.

In this paper we report on a new species of Lecanicillium that was isolated from
cadavers of P. strobi. This fungus is represented by three collections. Both the
morphological descriptions, restriction fragment length polymorphisms (RFLP) of
mitochondrial DNA and the f-tubulin gene, as well as sequencing of the B-tubulin
gene indicate they are sufficiently distinctive to warrant a description as a new species
of the genus Lecanicillium.

Materials and Methods

Isolate collection:

Live weevils were collected from the arboretum at the Pacific Forestry Centre (N48°
28’ W124° 24’) on Vancouver Island, BC. Weevils were reared on branches of Sitka
spruce Picea sitchensis (Bong.) Carriere, in cages in a shade-house at the Pacific Forestry
Centre. Cadavers were collected, incubated on moistened filter paper in a sealed Petri
plate, and observed daily for the development of mycelium. Single spore isolates of
Lecanicillium were produced by suspending a drop of sterile water from the end of a
hypodermic needle, and upon touching a phialide the hydrophilic conidia migrated into
the droplet. The droplet was spread over the surface of a Lecanicillium-selective medium
(LSM) (Kope et al. 2006). Colonies from single germinated conidia were subcultured
onto Sabouraud dextrose agar (SDA), grown for 14 days, and then stored at 5°C until
needed.

Microscopy:

The identification of Lecancillium isolates from colony morphology was assessed on
potato-dextrose agar (PDA, Oxoid) after 10 days incubation at 20°C in darkness (Zare
and Gams 2001). Conidiophore branching and conidial arrangement was observed in
open PDA Petri plates under a compound microscope at 50x magnification. Phialide
length and conidial shape and size were observed in water mounts on glass slides under
a compound microscope at 400-1000x magnification. Fifty conidia from four water
mounts (200 conidia in total) for each of the three isolates were measured to determine
conidial size. Photo-micrographs were taken with phase contrast optics. Colony growth
of the three Lecanicillium isolates was measured on PDA after 10 days incubation at
24°C in darkness.

DNA extraction:

Mycelium for DNA extraction was harvested from potato-dextrose broth by filtration
and then freeze-dried. The material was ground to a powder in liquid nitrogen, and the
DNA was purified from 20-30 mg of the powdered mycelium using Qiagen DNeasy
Plant Mini Kit following the supplied protocol. MtDNA was extracted from 2.0 grams
of powdered mycelium using Epicentre’s MasterPure™ Yeast DNA Purification Kit,
following the supplied protocol to extract total DNA, followed by CsCl/EtBr density
gradient equilibrium centrifugation (0.8 g ml’ CsCl and 0.4mg ml! EtBr) in a
Beckman Vti65 rotor at 250,000g for 16 hrs. The band was removed and extracted 3
times with isopropanol and dialyzed against 4L of TE (10mM Tris, 1mM EDTA, pH

Bas

8.0) twice for 4 hrs. The resulting DNA was separated into mtDNA and genomic DNA
by CsCl/bisbenzimide density gradient centrifugation (1.0 g ml’ CsCl and 0.1 mg
ml! bisbenzimide) in a Beckman Vti65 rotor at 250,000g for 16 hrs. The mtDNA was
removed and extracted 3 times with isopropanol and dialyzed against 4L of TE (1OmM
Tris, lmM EDTA, PH 8.0) with 3 changes over 16 hrs.

PCR and RLFP:

PCR amplifications and RFLP analyses were carried out as described by Zare and Gams
(2001), however, since we had difficulty discerning band patterns using total genomic
DNA, we separated the mtDNA from the chromosomal DNA. The RFLP of the ITS
region and the 3’ partial S-tubulin gene were amplified using the primer sets, ITS—4/
ITS-5 (White et al. 1990) and Btla/Bt1b (Glass and Donaldson 1995), respectively.

Phylogenetic analysis and sequence alignment:

PCR products of the ITS region and the 5’ partial 6-tubulin gene were sequenced
after purification. To obtain additional B-tubulin sequence information, the 5’ partial
6-tubulin gene was amplified and sequenced using the primers Bt2E/Bt12 as described
by Kim et al. (2003). Sequencing was performed on an ABI 3700 automated sequencer
(Perkin-Elmer, Foster City, CA) at the DNA synthesis and sequencing facility, Macrogen
(Seoul, Korea). A phylogenetic tree of the ITS region was built using sequences of other
taxa obtained from NCBI. The ITS sequences of 16 taxa were aligned using ClustalX
(Thompson et al. 1997) and manually adjusted in the PHYDIT program version 3.2
(http://plaza.snu.ac.kr/~jchun/phydit/). A phylogenetic tree of relatedness between the
new species and related species was constructed by a neighbor-joining (NJ) method
(Saitou and Nei 1987). The distances in the ITS region were determined by Kimura's
two-parameter model. Branch stability was assessed by 1000 bootstrap replications
implemented with PAUP*4.0b10 (Swofford 2001).

Results

Microscopy:

On cadavers of adult P. strobi, mycelium can appear as soon as 4 days after infection and
it is first seen along the length of the proboscis, around the eyes, at the joins between the
thorax, abdomen and head, and at the intersegmented membranes of the legs (Figure
1). The first visible mycelium is white, long and silky, which over time, forms into
filamentous mycelium ultimately enveloping the whole cadaver. Shiny globular droplets
at the tips of phialides are visible to the unaided eye.

Lecanicillium pissodis can be distinguished from other described species in this
genus by a number of morphological characters (Table 1). On agar, colony growth is
radial, slightly raised, bright white in colour with a cream to pale yellow reverse and
no pigment diffusion into the agar. Prostrate hyphae with phialides are visible at the
leading edge of the colony, with phialide numbers increasing towards the center of the
colony. Phialides are mostly single with some in a verticillate arrangement of 2-3 at
intercalary nodes or at hyphal ends. Conidial heads at the tip of phialides are distinctly
visible (Figure 2). When conidial heads are disturbed, conidia are dispersed (Figure
3) releasing up to and sometimes more than 50 conidia. The hydrophilic conidia are
quickly spread via water. Conidia are hyaline, single celled, and variable in size, 4-9.2 x
1.6-2.4 um, and shape, cylindrical to ovoid or oval (FIGURE 4).

334

TABLE 1. Morphological characteristics of some entomogenous Lecanicillium species*

Species ee Conidial heads cee Conidial shape
(um) (um)
L, aranearum 20-30 5.0-8.0 slightly pointed at one
(Petch)Zare & W. Gams x i x or both ends, straight or
0.7-1.5 1.2-1.5 curved
L. attenuatum 9-15.5 1-4 conidia 4.5-6.5 cylindrical, attenuate
Zare & W. Gams x in dry clusters > base uniform shape
1-2 1.5-2.0 occasionally 2-celled
L. lecanii (Zimm.) 11-20(30) globose heads 2.5-3.5(-4.2) short-ellipsoidal, uniform
Zare & W. Gams x x shape
1.3-1.8 1.0-1.5
L. longisporum 20-40 globose heads 5.0-10.5 ellipsoidal to oblong-oval
(Petch)Zare & W. Gams x x
L207. 1.5-2.5
L. muscarium (15-)20-35 globose heads (2-)2.5-5.5(-6) ellipsoidal or
x x subcylindrical, irregular
1-1.7 1.0-1.5(-1.8) shape
L. nodulosum 10-20 globose heads 2.5-4.5 oval
(Petch)Zare & W. Gams x x
15 W2=1N5
L. pissodis sp. nov. (16-)18- globose droplets 4.0-9.2 cylindrical to ovoid to
28(-38) x with up to 50 x oval, very variable shape
1-2 conidia, or more 1.6-2.4

*Characteristics for all species, except L. pissodis, taken from Zare and Gams (2001)

Taxonomic Description

Lecanicillium pissodis Kope & I. Leal, sp. nov. FIGURES 1-4

Coloniae altae, albae, reverso cremeo vel brunnescente, ad 6-7 mm diam. post 10 dies
in agaro PDA dicto. Phialides e hyphis prostratus oriundae, singulae vel 3 verticillatae,
gradatim in apicem angustatae, 16-(18-28)-38um x 1-2um. Conidia in capitulis globosis -
cohaerentia, ovoidea vel cylindracea, 4-9.2um x 1.6-2.4um, magnitudine et forma
inaequalia. Crystalla octaedrica copiosa.

Species ex Pissodes strobi ad Picea sitchensis in British Columbia Canada

Etymology: the specific epithet refers to the genus of the insect host.

Colony growth at 24°C on potato-dextrose agar (Oxoid, PDA) reaches 6-7mm in
diameter after 10 days. Colony white, raised, abundant aerial mycelium, reverse cream
to pale yellow. Phialides on prostrate hyphae, most as single, some double at right angles
and in some instances a verticillate arrangement of up to 3 phialides per node or at
the terminal end of hyphae, measuring 16-(18-28)-—38um x 1-2um and tapered over
their length. Conidia, up to and more than 50 formed in globose droplets at the tip
of phialides, hyaline, single-celled, cylindrical to oval, to cylindrical with an attenuate
end, very variable in size and shape, 4—9.2 x 1.6-2.4um. Teleomorph unknown. Crystals
present in agar medium, octahedral. Growth temperature optimum 20-25°C, with some
growth occurring at 5°C and no growth at 30°C.

335

Figures 1-4. Lecanicillium pissodis. 1. Infected adult of P. strobi. 2. Prostrate hyphae, phialides with

globose droplets holding conidia. 3. Dispersed droplets. 4. Varied shapes and sizes of conidia.
Scale: 1 = 5 mm; 2 = 80 um; 3 = 20 um; 4 = 10 um.

Strains examined:

DAVFP 29230, ex Pissodes strobi adult, Canada, 2003, H.H.Kope; DAVFP 29231, ex
Pissodes strobi adult, Canada, 2003, H.H.Kope; DAVFP 29232, ex Pissodes strobi adult,
Canada, 2003, H.H.Kope, ex-type.

Holotype:

DAVFP 29232, isolated from the cadaver of an adult P strobi in BC, Canada, deposited
in the Forest Pathology Herbarium, Pacific Forestry Centre, Victoria, BC, Canada. A
living ex-type culture CBS 118231 (DAVFP 29232) is deposited in the Centraalbureau
voor Schimmelcultures, Utrecht, The Netherlands. This isolate is also preserved at the
Fungal Culture Collection of Plant Pests & Diseases Research Institute (Ministry of
Agriculture), Tehran, Iran, under IRAN 945 C.

336

PCR and RFLP:

RFLP patterns of the ITS region, f-tubulin and mitochondrial DNA were compared to
other Lecanicillium species. No differences in the ITS-RFLP pattern were seen between
the three L. pissodis isolates and other Lecanicillium species. However, clear differences
in the RFLP patterns of both the }-tubulin gene and mitochondrial DNA indicated that
L. pissodis was distinct from other Lecanicillium species (Table 2). The B-tubulin gene
RFLP-PCR patterns shown in Table 2 for L. attenuatum (CBS 170.76) and the three
isolates of L. pissodis were based on B-tubulin sequencing analysis.

Phylogenetic analysis and sequence alignment:

The alignment of ITS sequences containing the ITS-1-5.8S-ITS region of 12 ITS
sequences of other Lecanicillium species placed the three isolates of L. pissodis in a
branch with L. attenuatum (Figure 5), which has a high bootstrap value in the NJ tree,
and the BLAST search gave 100% identity. Accession numbers for the ITS region of L.
pissodis 17, 18 and 19 are DQ364668, DQ364669, and DQ364670, respectively.

NJ Tree

Lecanicillium muscarium AJ292388
95} Lecanicillium muscarium AJ292387

80 Lecanicillium muscarium AJ292435

100 Lecanicilliumn longisporwn AJ292384
Lecanicillium longisporum AJ292385
97 Lecanicilliun aphanocladii AJ292430
100 Lecanicillium aphanocladii AJ292431
Lecanicillium dimorphum AJ292429
100 Lecanicillium psalliotae AJ292389
Lecanicillium psalliotae AJ292390
Lecanicillium fusisporum AJ292428

Paecilomyces fumosoroseus AF461744

—— 0.005 substitutions/site :
Figure 5. Neighbour joining tree for Lecanicillium ITS sequences rooted with Paecilomyces
fumosoroseus showing the relationship between L. attenuatum and L. pissodis, and the position of
this clade (shaded area) among other Lecanicillium species. Numbers on the branches are bootstrap
values for major groupings in consensus trees.

SO}

i ee ae a a ee ee

09 ‘OLT “OVI “067

09 ‘OLI “OvI “06¢

09 ‘OLI “Ov “0672

‘067

09 ‘OLT “OVI

09 ‘OLT ‘Orl “067

09 ‘OLT ‘OVI “067

06 “OOT “OFT

06 “OOI “OFT

06 “OOI “OVI

06 “OOT “OFT

(1Q0T) SwRH pur o1eZ WIJ USYe} suroned qT
NC [eupuoyooy pur ues urpnqny-g out Ut sipossid "J 10} suowsey YOd-d Ta OW syuosaidas ware popeys oU.Lx.

‘OOE

‘OO€

OL “06 ‘091 ‘O0E
OL ‘06 ‘O9T “OOE
OL ‘06 ‘O9T “O0E
OL ‘06 “O9T “OO
OL ‘06 ‘O91 “OO

OL ‘06 “O9T “OO

(ZETHT dHAVC)
61 sipossid “]

(1€%67 ddAV)
I sipossid “7
(O€767 dHAVO)
LI sipossid “J

(LOTTZO IND

4 WnAsOdS18UO] “T

(689890 INI)

4LUNIADISNUL “T

(9L'OLI SAD)

WNJODNUIA]LD “T

ok RP ee ae ee ee 2 ee ee

1 aw

SLI‘ESE OL ‘V6I‘L9T LB ‘Vb

BLI‘ESE OL P61 ‘LOT LB ‘VrY

SLI ‘ESE OL‘P6I ‘LOT LB Vb

0755 6.9 73 9 Ors Orl ‘00h 007 ‘08~ 06 °0S1
€ ‘yy S9 Ors OSI ‘09E€ 007 ‘087 06 0ST

€ ‘p's ‘79 O81 “O9E SLI‘ESE OL ‘P61 ‘LOT LB “Vbh
Ill 9°H [fulH Ill 2°H 19) IV
VNaw sues uNgM-y SUT JO Sd Ta

JO Sd1Aa

[f/m

WOIsel CLT JO Sd Ta

Il] 9?H

,So1oads WN ]19IUDIAT JO BXE] OULOS JO suroyed YOd-d TAM “7 AVL

QpoOd UOTSsI90B

pure exe,

338

by bob

[esac aust ele

eat eee ls el

let Stee easiest

Sequence alignment of the 3’ end of the $-tubulin genes of L. attenuatum (CBS
170.76) and L. pissodis using primers Btla/Btl1b shows only a few sequence differences
(Figure 6A). These sequences were deposited at EMBL as DQ364671 for L. attenuatum
(CBS 170.76) and DQ364672, DQ364673 and DQ364674 for L. pissodis 17, 18, and 19,
respectively. However, sequence alignment of the 5’ end of the B-tubulin gene with
primers Bt2E/Bt12 indicated major differences of the exon and intron regions between
these two species (Figure 6B). The accession numbers for this part of the B-tubulin gene
of L. attenuatum (CBS 170.76) is DQ364675, and for L. pissodis isolates 17, 18, and 19
are DQ364676, DQ364677, and DQ364678, respectively.

.attenuatum

OLUSHSIOC ES: alk 7
POUSSOGLS ins
OWS SOC Se ho

.attenuatum

WO LSS OGL Sly!
EpiSSOGIS es
DOSS OCusS ees
.attenuatum

OLS SOC mS 1.7
SOUS SOGLS m—aae
SP LSSOGMS. 189

.attenuatum

AOLES SOS) tf
~pisSsodis: 18
~pLssodis) 19

-attenuatum

SES SOG Smeal)
OL SSOdtsSm 163
JDLSSOCL Smo)

HW
QD
>
©)
QD GY i=! C29 Cs) bk)

eh) Ol Gans)
Q @8O SENS em

GTAGCTTTTTAAGGCCCTACCCTGTACGAAATTAGATAGTGGTTCTGAGTATG
GTGGTTTCCGACATTCGACTCCGAGACAAGAATTGGTGGATAGCGGTCCTGAC
GTGGTTTCCGACATTCGACTCCGAGACAAGAATTGGTGGATAGCGGTCCTGAC
GTGGTTTCCGACATTCGACTCCGAGACAAGAATTGGTGGATAGCGGTCCTGAC

@rer @) (Seo ==)

et eda elialcle L222

QOS Sa Aas 7189 001) 2

1806140967854568 2
Tey Dvd GAYE A Ge CGCCTTTTAGGATGTT GTTTGTTTTACGCACAAACAG
TGTGCTTTTCTCGATAG TATTCCCCTCCGGACC GTTTGTTCTACCCGCGCAACG
TGTGCTTTTCTCGATAG TATTCCCCTCCGGACC GTTTGTTCTACCCGCGCAACG
TGTGCTTTTCTCGATAG TATTCCCCTCCGGACC GTTTGTTCTACCCGCGCAACG

CGCGCCTGTCGCGTCGCTAGCAATGTGGTGGATATTAACCATAATTCTCGTACAG
CGTTGCTAGGCTTCGCTGTGGGTACTGACCGCGATTTTGCTCTAG- ---------
CGTTGCTAGGCTTCGCTGTGGGTACTGACCGCGATTTTGCTCTAG- ---------
CGTTGCTAGGCTTCGCTGTGGGTACTGACCGCGATTTTGCTCTAG--~-------

33333344444444445555555555555666666666667777
A688: 9901245 S5ih® ON2S S516 8.89910 4 44456 7 18 90022
S347 Vios STOS9UVG8t 3484 Toul 72614925 6344658712 8106
TATA DT GCAAT TACCCAA Gillie CmpeAGcCCATACC CEGATLCAT
CUCL CLACTe CCA. Tee CCrlrACceDALTG eG Ve Gene Ge
CLEC CVAGUee Cl Mice Ce CLAN CCA € CCl RCE TGG
CLC CrVAGL CCC LMLGe CCeI LAC CGlAn Le CC thee eee

Figure 6. Distribution of B-tubulin sequence differences between L. attenuatum and L. pissodis.
A. 3’ end of B-tubulin gene amplified by primers Btla and Bt2a. B. 5’ end of B-tubulin gene
amplified by primers BT2E and BT12. The position of the polymorphism sites in the aligned
sequence matrices is written vertically above columns. Bold-typed characters indicate the introns.

o39

Discussion

Lecanicillium pissodis is characteristic of the genus Lecanicillium with phialides borne
on prostrate hyphae either singly or as multiples arranged in verticillate whorls at nodes,
in pairs, or singly. The conidia formed in globose droplets at the end of phialides are
single-celled and vary in shape from cylindrical to ovoid or oval.

Morphologically L. pissodis is distinct, but closest to L. attenuatum. It differs from
L. attenuatum having a slower growth rate, longer phialides, a greater variability in
conidial size and the production of droplets at the end of phialides containing up to 50
conidia. L. pissodis differs from L. lecanii having a slower growth rate, longer phialides,
fewer phialides per whorl, and larger conidia. It also differs from L. muscarium and L.
longisporum by size and conidial shape, respectively and having a slower growth rate
than both species.

Lecanicillium pissodis differs in its RFLP banding patterns for both mitochondrial
DNA and the f-tubulin gene when compared with other described Lecanicillium species.
The isolates of L. pissodis had ITS sequences identical to that of L. attenuatum. The ITS
region generally exhibits a high degree of variation between species, and it appears more
highly conserved within species. Although, this ribosomal region can be very useful for
determining relationships between fungal genera and species (Bruns et al. 1992), it might
not allow for the differentiation of closely related taxa (Hermosa et al. 2000, Harrington
et al. 2000, Jacobs et al. 2001). To address this, Kim et al. (2004) have suggested that
sequences for the B-tubulin gene would be more useful. The sequence differences
within the B-tubulin gene reported here separated L. pissodis from L. attenuatum. ‘This
result, coupled with the distinct morphological characteristics, provide strong support
for describing L. pissodis as a new species.

The genus Lecanicillium contains entomogenous fungi with a cosmopolitan
distribution occurring on a wide range of insect hosts. L. muscarium has been
previously collected in British Columbia, Canada (CBS 113450 and 118576) and Kope
et al (2000) demonstrated, after fulfilling Koch’s postulates, that L. muscarium is an
entomopathogen of P. strobi. The newly described isolate of L. pissodis, currently found
only in British Columbia, is also pathogenic to P. strobi (H. Kope unpublished, fulfilling
Koch’ postulates). The occurrence and efficacy of Lecanicillium in the natural habitat
of P. strobi would have an effect on weevil populations, making this entomopathogenic
fungus a component to be considered in control strategies developed for P. strobi.

Acknowledgments

The authors would like to acknowledge the financing supplied by the Enhanced Pest Management
Methods, S & T program, to ECOBIOM (Extended Collaboration on Biological Control of Forest
Insects or Pathogenic Microorganisms) under the direction of Dr. Robert Lavallée of the Centre de
foresterie des Laurentides, Québec, Canada. We also acknowledge Dr. René Alfaro for additional
financing, the technical assistance of Brett Foord with the molecular work, and Dr. Young Lim for
his assistance with the PAUP computer program, and Dr. Brenda Callan and Holly Williams for
corrections to early versions of the manuscript. We also thank Drs. Richard Humber, Leonard
Hutchison, Young Lim and Rasoul Zare for reviewing the manuscript.

340

Literature cited

Balazy S. 1973. A review of entomopathogenic species of the genus Cephalosporium Corda (Mycota,
Hyphomycetales). Bulletin de la Société des amis des sciences et des lettres de Poznan. Série D.
Sciences biologiques 14: 101-137.

Bruns TD, Vilgalys R, Barns SM, Gonzalez D, Hibbett DS, Lane DJ, Simon L, Stickel $, Szaro TM,
Weisberg WG, Sogin ML. 1992. Evolutionary relationships within the fungi: analysis of nuclear
small subunit rRNA sequences. Molecular Phylogenetics and Evolution 1: 231-241.

Butt TM, Jackson C, Magan N. 2001. Fungi as biocontrol agents: Progress, problems and potential.
New York, CABI Publishing.

Gams W. 1971. Cephalosporium-artige Schimmelpilze (Hyphomycetes). Stuttgart, G. Fisher.

Glass L, Donaldson G. 1995. Development of primer sets designed for use with the PCR to amplify
conserved genes from filamentous Ascomycetes. Applied and Environmental Microbiology 61:
1323=1330:

Harrington TC, McNew D, Steinel J, Hofstra D, Farrel R. 2001. Phylogeny and taxonomy of the
Ophiostoma piceae complex and the Dutch elm disease fungi. Mycologia 93: 111-136.

Hermosa MR, Grondona I, Monte E, Iturriaga EA, Diaz-Minguez JM, Castro C, Monte E,
Garcia-Acha JM. 2000. Molecular characterization and identification of biocontrol isolates of
Trichoderma spp. Applied and Environmental Microbiology 66: 1890-1898.

Jacobs K, Wingfield MJ, Wingfield BD. 2001. Phylogenetic relationship in Leptographium based on
morphological and molecular characters. Canadian Journal of Botany 79: 719-732.

Kim JJ, Kim SH, Lee S, Breuil C. 2003. Distinguishing Ophiostoma ips and Ophiostoma montium,
two bark beetle-associated sapstain fungi. FEMS Microbiology Letters 222: 187-192.

Kim JJ, Lim YW, Wingfield MJ, Breuil C, Kim GH. 2004. Leptographium bistatum sp. nov., a new
species with a Sporothrix synanamorph from Pinus radiata in Korea. Mycological Research
108: 699-706.

Kope HH, Alfaro R, Lavallée, R. 2006 (in press). Virulence of the entomopathogenic fungus
Lecanicillium (Deuteromycota: Hyphomycetes) to Pissodes strobi (Coleoptera: Curculionidae).
Canadian Entomologist.

Kope HH, Peterson M, Alfaro R. 2000. Pathogenicity of Verticillium lecanii to Pissodes strobi.
Canadian Journal Plant Pathology 22: 187.

Petch T. 1925. Studies in entomogenous fungi. VI: Cephalosporium and associated fungi.
Transactions of the British Mycological Society 10: 152-182.

Petch T. 1931. Notes on entomogenous fungi. Transactions of the British Mycological Society 16:
55-75, .
Petch T. 1932. Notes on entomogenous fungi. Transactions of the British Mycological Society 16:

209-245.

Petch T. 1939. Notes on entomogenous fungi. Transactions of the British Mycological Society 23:
127-148.

Saitou N, Nei M. 1987. The neighbor-joining method: A new method for reconstructing
phylogenetic trees. Molecular Biology and Evolution 4: 406-425.

Swofford, DL. 2002. PAUP: Phylogenetic analysis using parsimony and other methods, Version
4.0b10. Sinauer Associates Inc., Sunderland, Massachusetts.

Thompson JD, Gibson T, Plewniak F, Jeanmougin F, Higgins, DG. 1997. The ClustalX Windows
interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Research 24: 4876-4882.

White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in MA Innis et al. (eds.), PCR Protocols: a guide to
methods and applications. San Diego, Academic Press.

Zare R, Gams W. 2001. A revision of Verticillium section Prostrata. IV. The genera Lecanicillium
and Simplicillium gen. nov. Nova Hedwigia 73: 1-50.

MYCOTAXON

Volume 94, pp. 341-347 October-December 2005

Two new species of Hymenochaetaceae
from eastern China

YU-CHENG DAI

yuchengd@yahoo.com
Institute of Applied Ecology, Chinese Academy of Sciences
Shenyang 110016, China

BAo-Kalt Cul

Institute of Applied Ecology, Chinese Academy of Sciences
Shenyang 110016, China

Graduate School, Chinese Academy of Sciences
Beijing 100039, China

Abstract—Coltricia tsugicola| and Fomitiporia torreyae __(Basidiomycota,
Hymenochaetaceae) are described as new from Fujian Province, eastern China.
Coltricia tsugicola is characterized by small, stipitate and pendent basidiocarps, large
and irregular pores and oblong ellipsoid basidiospores; its host tree is Tsuga chinensis.
Fomitiporia torreyae has perennial, resupinate basidiocarps, small basidiospores, no
hymenial setae, and grows on Torreya grandis.

Key words—polypore, wood-rotting fungi, taxonomy

Introduction

During the study of poroid Aphyllophorales from Wuyi Mts. in eastern China, some
novel wood-inhabiting fungi were found. Two such specimens were collected on Tsuga
chinensis: fungi with small, stipitate and pendant basidiocarps, a monomitic hyphal
structure without clamp connections, and oblong-ellipsoid, yellowish, smooth, and
thick-walled basidiospores. These features fit well with Coltricia Gray, but with none
of the existing taxa of the genus. Another specimen was collected on living Torreya
grandis, a gymnosperm tree endemic to eastern China. This collection is a resupinate
basidiocarp, a species with dimitic hyphal structure and simple septate generative hyphae.
Its basidiospores are subglobose, hyaline, thick-walled, dextrinoid and cyanophilous.
These characters indicate Fomitiporia Murrill (the Phellinus robustus complex), but
no suitable species name is available for it. Here we describe these species as new in
Coltricia and Fomitiporia.

342

Materials and methods

The studied specimens are deposited at the Herbarium of the Institute of Applied
Ecology, Chinese Academy of Sciences (IFP). Microscopic features, measurements and
drawings were made from slide preparations stained with Cotton Blue and Melzer’s
reagent. The microscopic procedure fellows Dai (1999). Spores were measured from
sections cut from the tubes. KOH = 5% potassium hydroxide, CB = Cotton Blue, CB+
= cyanophilous, CB- = acyanophilous, IKI- = both inamyloid and indextrinoid. In
presenting the variation in the size of the spores, 5% of measurements were excluded
from each end of the range, and are given in parentheses. In the text the following
abbreviations are used: L = mean spore length (arithmetic mean ofall spores), W = mean
spore width (arithmetic mean of all spores), Q = variation in the L/W ratios between the
specimens studied (quotient of the mean spore length and the mean spore width of each
specimen), i = number of spores measured from given number of specimens.

Descriptions

Coltricia tsugicola Y.C. Dai & B.K. Cui, sp. nov. Fig.1
Carpophorum annuum, stipitatum. Facies pororum auratum vel brunneum; pori rotundi
vel sinuolati, 1-2 per mm. Systema hypharum monomiticum, hyphae generatoriae
septatae, efibulatae, hyphae contexti 4-10 um in diam. Sporae aureae, oblongo-ellipsoideae
vel ellipsoideae, crassitunicatae, IKI-, CB(+), 8.5-11.9 x 5.6-6.9 um.
Type. — China. Fujian Prov., Wuyishan County, Wuyishan Nature Reserve, alt. 1700 m,
on rotten wood of Tsuga chinensis, 21.X.2005 Dai 7303 (holotype in IFP, isotype in H).

Etymology. — Tsugicola (Lat.): living on Tsuga.

Fruitbody. — Basidiocarps annual, centrally stipitate and pendent, solitary or gregarious,
soft corky and without odour or taste when fresh, consistency soft corky to fragile and
light in weight when dry. Pilei more or less circular or infundibuliform when fresh,
becoming shrunken and irregular upon drying, up to 1 cm in diam., 5 mm thick at
centre. Pileal surface yellowish to deep reddish brown when fresh, becoming cinnamon
or yellowish brown to rust brown upon drying, azonate, velutinate or smooth; margin
thin, obtuse, curving down when dry. Pore surface yellowish when fresh, becoming
yellowish brown to rust brown upon drying; pores angular or sometimes sinuous to
irregular, 1-2 per mm; dissepiments thin, entire. Context cinnamon to rust brown,
coriaceous, up to 1 mm thick. Tubes yellowish brown, slightly paler than context, soft
corky to slightly brittle when dry, up to 3 mm long. Stipe dark yellowish brown, corky,
velutinate, up to 5 mm long, 1 mm in diam.

Hyphal structure. — Hyphal system monomitic; all septa without clamp connections;
tissue darkening but otherwise unchanged in KOH.

Context. — Contextual hyphae pale yellowish to golden brown, thin- to fairly thick-
walled with a wide lumen, occasionally branched, with frequent simple septa, fairly
straight, loosely interwoven, IKI-, CB-, 4-10 «sm in diam.; hyphae in the stipe golden
yellowish to golden brownish, fairly thick-walled with a wide lumen, occasionally
branched, with frequent simple septa, more or less straight, loosely interwoven, IKI-,
CB-, 5-9 um in diam.

343

5 er

KT “Rose
10 ym 10 um

Fig. 1. Microscopic structures of Coltricia tsugicola (drawn from the holotype IFP Dai 7303). —
a: Basidiospores. —b: Basidia and basidioles. —c: Hyphae from tube trama. —d: Hyphae from
context. —e: Hyphae from stipe.

Tubes. — Tramal hyphae hyaline to pale yellowish or golden brownish, thin- to slightly
thick-walled with a distinct lumen, frequently branched and simple septate, loosely
interwoven, IKI-, CB- or very weakly CB+, 4-8 um in diam. Basidia broadly clavate,
with four sterigmata and a simple septum at the base, 14.6-23.8 x 5-8.4 um; basidioles
in shape similar to basidia, but smaller.

Spores. — Basidiospores ellipsoid or more often oblong-ellipsoid, yellowish, thick-
walled, smooth, IKI-, CB- or weakly CB+ when juvenile, (8.2—)8.5-11.9(-13.2) x (5.2-
)5.6-6.9(-7) um, L = 9.62 um, W = 6.31 um, Q = 1.51-1.54 (n=60/2).

344

Additional specimen (paratype) examined. — China, Fujian Prov., Wuyishan County,
Wuyishan Nature Reserve, alt. 1700 m, on base of living Tsuga chinensis, 21.X.2005 Dai
7336.

Remarks. — The species is characterized by small, stipitate and pendant basidiocarps,
large and irregular pores, and oblong-ellipsoid basidiospores. Coltricia tsugicola was
found in a Tsuga chinensis forest in the Wuyishan Nature Reserve. Forests of Tsuga are
restricted to altitudes from 1100 to 1800 meters, close to the timberline which is at
ca. 1900 m. Climatically the coniferous forests between these limits vary from warm
temperate to almost boreal.

Coltricia focicola (Berk. & M.A. Curtis) Murrill resembles C. tsugicola by having
oblong-ellipsoid and pale yellowish basidiospores, (7.5—)8-9.5(-10) x (3.8—)4—4.8(-5)
um, L = 8.55 um, W = 4.34 um, Q = 1.97. However it has larger basidiocarps, lobed or
incised at margin, lacerate to dentate dissepiments, and its spores are narrower than in
C. tsugicola. In addition, Coltricia focicola grows on the ground, and it is evidently not a
wood-rotting fungus (Ryvarden and Gilbertson 1993).

Coltricia duportii (Pat.) Ryvarden has laterally stipitate basidiocarps and ellipsoid
basidiospores, and it may be related to C. tsugicola. Its growth habit is not pendent,
and fruitbodies are larger, 2.5 cm in diam. and 1 cm thick; besides, its basidiospores are
ellipsoid, rusty brown, 8-10 x 6-7 um. It occurs on deciduous trees in tropical French
Guyana and Brazil (Ryvarden 2004).

Basidiospores of the new species are similar to those of Coltricia montagnei (Fr.)
Murrill which, however, has larger basidiocarps (up to 12 cm in diam. and 1-2 cm thick),
poroid to concentrically lamellate hymenophore, and slightly dextrinoid basidiospores
(Nufiez and Ryvarden 2000, Ryvarden and Gilbertson 1993).

The minute, stipitate and pendant basidiocarps make Coltricia tsugicola confusingly
similar to Coltriciella dependens (Berk. & M.A. Curtis) Murrill, but spores of C.
dependens are finely verrucose, and it occurs in the tropics (Gilbertson and Ryvarden
1986, Ryvarden and Johansen 1980).

Fomitiporia torreyae Y.C. Dai & B.K. Cui, sp. nov. Fig.2
Carpophorum perenne, resupinatum, contextum atroumbrinum vel brunneum. Facies
pororum ravide umbrina vel umbrina; pori rotundi vel sinuolati, 4-6 per mm. Systema
hypharum dimiticum, hyphae generatoriae septatae, efibulatae. Sporae subglobosae vel
globosae, crassitunicatae, dextrinoidae, CB+, 5-5.9 x 4.4-5.3 um.

Type. — China. Fujian Prov., Wuyishan County, Wuyishan Nature Reserve, alt. 800 m,
on living Torreya grandis, 21.X.2005 Dai 7320 (holotype in IFP, isotype in H).

Etymology. — Torreyae (Lat.): referring to the host tree genus.

Fruitbody. — Basidiocarps perennial, resupinate, inseparable, woody hard when fresh,
without odour or taste, consistency woody hard and light in weight when dry, up to
20 cm or more in longest dimension, 10 cm wide, ca. 8 mm thick at centre; margin
more or less receding, up to 2 mm wide, pale brown. Pore surface greyish brown when
fresh, becoming pale brown to rust brown upon drying, shining, slightly cracked with
age; pores circular to sinuous at oblique surface, 4-6 per mm; dissepiments thin, entire.
Subiculum umber brown, woody hard, very thin, up to 0.5 mm thick. Tubes yellowish
brown to rust brown, hard corky, up to 7 mm long, distinctly stratified.

345

Hyphal structure. — Hyphal system dimitic; all septa without clamp connections; skeletal
hyphae IKI-, CB-; tissue darkening but otherwise unchanged in KOH.

Subiculum. — Tissue dominated by skeletal hyphae; generative hyphae hyaline to pale
yellowish, thin- to fairly thick-walled, occasionally branched and frequently simple
septate, 2-3.2 um in diam.; skeletal hyphae golden brown to rust brown, thick-walled
with a narrow to wide lumen, unbranched, interwoven, more or less agglutinated, 2.3-
4.5 um in diam.

Tubes. — Tramal hyphae dominated by skeletal hyphae; generative hyphae hyaline, thin-
to slightly thick-walled, occasionally branched and frequently simple septate, 1.8-3
um in diam.; skeletal hyphae golden brown to rust brown, thick-walled with a narrow
to wide lumen, unbranched, interwoven, slightly agglutinated, 2-4.2 um in diam.
Subhymenium indistinct. Hymenial setae absent, setae extremely rare in subiculum,
subulate to ventricose, dark brown, thick-walled, 10-16 x 6-7 um; cystidioles frequent,
subulate, sharp-pointed or obtuse at apex, hyaline, thin-walled, 14-19.7 x 2.8-4 um;
basidia barrel-shaped to subglobose, with four sterigmata and a simple septum at the
base, 8-13 x 6.8-9 um; basidioles in shape similar to basidia, but slightly smaller; big
rhomboid crystals abundant in hymenia and trama.

Spores. — Basidiospores subglobose to globose, hyaline, thick-walled, smooth,
dextrinoid in Melzer’s reagent, strongly CB+, (4.5—)5-5.9(-6) x (4-)4.4-5.3(-5.9) um,
L = 5.46 um, W = 4.90 um, Q = 1.11 (n=60/1).

Remarks. — The perennial growth habit, resupinate basidiocarp, lack of setae, presence
of subulate cystidioles, small basidiospores, and growth on Torreya grandis characterize
this species. We could not find hymenial setae in the type, and only a few setae were
found in the subiculum and subhymenium. Even there they are extremely rare: 4
setae were observed from 5 microscope preparations. Fomitiporia torreyae is the third
resupinate species in the genus in China, the other two being F. punctata (P. Karst.)
Murrill and FE bannaensis Y.C. Dai (Dai 1999, Dai et al. 2001).

Four species in Fomitiporia—F. aethiopica Decock et al., F mediterranea M. Fisch..,
FE. punctata and F. tabaquilio (Urcelay et al.) Decock & Robledo—have resupinate
basidiocarps, and lack hymenial setae (Decock et al. 2005). These species have distinctly
larger basidiospores than F. torreyae, the length being more than 6 um.

Fomitiporia tenuis Decock et al. was recently described from Africa (Decock et al.
2005). Its basidiospores are very similar to those of Fomitiporia torreyae. However, the
former has a thinner fruitbody (up to 2 mm thick), smaller pores (10-11 per mm), and
hymenial setae.

Fomitiporia bannaensis is found in China too but it is distinguished from F. torreyae by
smaller pores (8-10 per mm) and abundant hymenial setae. Furthermore, E bannaensis
is a subtropical species, growing on angiosperm trees (Dai et al. 2001).

Besides the above-mentioned taxa, the remaining species of Fomitiporia, E sonorae
(Gilb.) Y.C. Dai, FE pseudopunctata (A. David et al.) Fiasson, FE sublaevigata (Cleland
& Rodway) Y.C. Dai, have principally resupinate fruitbodies, but all have hymenial
setae and grow on angiosperm trees. Fomitiporia sonorae has resupinate to reflexed
basidiocarps, and its setae are long (35-55 x 5-8 um, Gilbertson 1979, Valenzuela &

346

Fig. 2. Microscopic structures of Fomitiporia torreyae (drawn from the holotype IFP Dai 7320).
—a: Basidiospores. —b: Cystidioles. —c: Basidia and basidioles. —d: Rhomboid crystals. —e:
Hyphae from tube trama. —f: Hyphae from subiculum.

Chacon-Jiménez 1991). Fomitiporia pseudopunctata and F. sublaevigata have bigger

spores (6.5-7.5 x 5.5-7 um in EF pseudopunctata, 6.5-7 x 5-6 um in E sublaevigata,
Decock et al. 2005).

347

Acknowledgements

Special thanks are due to Mr. Mingyun Huang for companionship during the field trip. We express
our gratitude to Prof. Teuvo Ahti (H, Finland) for revising the Latin description and improving the
manuscript, and to Drs. Tuomo Niemela (University of Helsinki, Finland), and Peter K. Buchanan
(Landcare Research, New Zealand) who reviewed the manuscript. The research was financed by
the National Natural Science Foundation of China (Project No. 30425042).

Literature cited

Dai YC. 1999: Phellinus sensu lato (Aphyllophorales, Hymenochaetaceae) in East Asia. Acta Bot.
Fennica 166: 1-115.

Dai YC, Zhang XQ, Zhou TX. 2001: New and noteworthy species of Hymenochataceae from China.
Mycosystema 20: 16-21.

Decock C, Bitew A, Castillo G. 2005: Fomitiporia tenuis and Fomitiporia aethiopica (Basidiomycetes,
Hymenochaetales), two undescribed species from the Ethiopian highlands—taxonomy and
phylogeny. Mycologia 97: 121-129.

Gilbertson RL, 1979: The genus Phellinus (Aphyllophorales, Hymenochaetaceae) in western North
America. Mycotaxon 9: 51-89.

Gilbertson RL, Ryvarden L. 1986: North American polypores 1. Abortiporus - Lindtneria.
Fungiflora, Oslo. 433 pp.

Nufiez M, Ryvarden L. 2000: East Asian polypores 1. Ganodermataceae and Hymeno-chaetaceae.
Syn. Fungorum 13: 1-168.

Ryvarden L. 2004: Neotropical polypores 1. Syn. Fungorum 19: 1-229.

Ryvarden L, Gilbertson RL. 1993: European polypores 1. Syn. Fungorum 6: 1-387.

Ryvarden L, Johansen I. 1980: A preliminary polypore flora of East Africa. Fungiflora, Oslo. 636
PP:

Valenzuela R, Chacon-Jiménez S. 1991: Los poliporaceos de Mexico 3. Algunas especies de la
Reserva de la Biosfera el Cielo, Tamaulipas. Revista Mex. Micol. 7: 39-70.

Volume 94, pp. 349-355 October-December 2005

Some entomogenous fungi from Wuyishan
and Zhangjiajie Nature Reserves
2. Three new species of the genus Hirsutella’

ZONGQI LIANG ' YANFENG HAN!
ATYING LIU’ & JIANZHONG HUANG?

zqliang472@yahoo.com.cn*
swallow112886@yahoo.com.cn ayliu6@yahoo.com.cn
' The Institute of Fungus Resources, Guizhou University
Guiyang 550025, China

hjz@fjnu.edu.cn
? The Key Laboratory of Microbiological Engineering
Fujian Normal University, Fuzhou 350007, China

Abstract—Three new entomogenous fungi of the genus Hirsutella, H. zhangjiajiensis, H.
hunanensis and H. crinita, collected from Wuyishan (Wuyi Mountains) and Zhangijiajie
Nature Reserves, are described and illustrated. Some problems of the identification of
these fungi are briefly discussed.

Key Words—hyphomycete, taxonomy, morphology

Introduction

Hirsutella Pat. is one of the most abundant and important entomogenous fungi. In 1990,
we reviewed the development, taxonomic characteristics of the genus, and proposed a
key to 62 taxa. A few doubtful species were discussed briefly (Liang 1990a, b). Seifert &
Boulay (2004) suggested that Hirsutella consists of 65 species. From our study, we refer
90 species around the world to the genus of Hirsutella.

The genus Hirsutella plays an important role in the natural control of pest insects
(Evans 1974, 1982). H. gigantea Petch can infect many larvae and pupae of Lepidoptera
in the Kuankuoshui Preserve in Guizhou, China (Liang 1991a). Besides this fungus, H.
rhossiliensis Minter & B. L. Brady, discovered in the early 1980's, has a stronger lethiferous
effect on many plant parasitic nematodes, such as Ditylenchus dipsaci, Meloidogyne
incognita, Aphelenchoides fragariae and Criconemella xenoplax (Jaffee et al. 1982; Cayrol
& Frankowski 1986; Cayrol et al. 1986).

It is known that many species in the genus Hirsutella are anamorphs of Cordyceps Fr.
For example, an anamorph of the famous Chinese traditional medicine C. sinensis (Berk.)
Sacc. is H. sinensis (Liu et al., 1989). Some valuable bioactive compounds have been
recently discovered from members of Hirsutella. A protein toxic to insects, hirsutellin

*Corresponding author: Zongqi Liang

350

A (HtA), has been purified from the fungal mite pathogen, H. thompsonii FE. E. Fisher
(Mazet & Vey, 1995). HtA is considered to be one of many ribonuclease inactivator
proteins (RIPs) (Maimala et al. 2002). Vongvanich et al.(2002) found hirsutellide A from
a new species of Hirsutella, an interesting antimycobacterial cyclohexadepsipeptide. The
synthesis of its key precursor has been studied (Xu et al. 2005).

From 1989 to 2001, Chinese mycologists reported seven new species of Hirsutella
(Table 1). The present paper describes three additional new species of Hirsutella and
their taxonomic position within the genus.

Table 1. Previously reported species of Hirsutella in China

Fungal Name References
H. leizhouensis H.M. Fang & S.M. Tan Fang & Tan 1992
H. changbeishanensis Z.Q. Liang Liang 1991b
H. polycolluta Z.Q. Liang Liang 1991b
H. yunnanensis Z.Q. Liang & A.Y. Liu Liu et al., 1993
H. yunnanensis var. tenuisynnemata Z.Q. Liang & A.Y. Liu Liang et al.,1997
H. sinensis X.J. Liu et al. Liu et al., 1989
H. longissima C.R. Li et al. Li et al., 1999
H. huangshanensis C.R. Li et al. Li et al., 2005

Materials and Methods

All collected specimens were routinely oven-dried at 40C to prevent growth of
contaminant fungi. For examination by light microscopy, slide preparations were made
of a snippet of outer layer tissue from the delaminated synnemata by mounting in
lactophenol and cotton blue.

Description of new species

Hirsutella zhangjiajiensis Z.Q. Liang & A.Y. Liu sp. nov. Figs. 1-1, 4
Stromatibus solitariis vel binariis, cylindraceis, simplicibus, 100 x 2 mm. Stipite et capitulo
brunneo vel ochraceo. Phialides e ascosporis exorentibus, subulatiae graciles, 30-52 x 2-4.5

um, vel basi inflata ellipsoida, 4.5 x 3um. Conidia lanceolata or leviter curvata, 4.5-7.5
(-10) x 1.5-2.5 um, mucigeri, lemoniformes, 10 x 4 um. Holotypus: GZDXIFR98-7131.

Stroma single or 2, cylindrical, 100 x 2 mm, not ramified, leathery. Stipe and fertile
part brown to snuff-colored. Conidiogenous structure deriving from the microcycle
conidiation of ascospores from Cordyceps zhangjiajiensis. Phialides slender awl-shaped,
30-52 x 2-4.5 um or inflated ellipsoidal at basal portion, 4.5 x 3 um. Conidia lanceolate
or the shape of an orange segment, 4.5-7.5(10) x 1.5-2.5 tum, embedded in a mucous
sheath, limoniform, 10 x 4 um.

Specimen studied: GZDXIFR98-7131 was collected from Zhangjiajie Nature Reserve,

Hunan Province by LIANG Zongqi, LIU Aiying et al. in VII 1998.

351

Fig. 1 Synnemata and conidiogenous structures of three species of Hirsutella. 1-1, 4: Conidiogenous
structures and synnemata of H. zhangjiajiensis. 1-2, 5: Conidiogenous structures and synnemata of
H. crinta. 1-3, 6: Conidiogenous structures and synnemata of H. hunanensis

Bars1, 2 =10um, Bar3 =5um
Habitat: Pupa of Lepidoptera.
Teleomorph: Cordyceps zhangjiajiensis Z.Q. Liang & A.Y. Liu (Liang et al. 2002).
Distribution—Zhangjiajie Nature Reserve: Hunan Province, China.

Hirsutella hunanensis Z.Q. Liang sp. nov. Figs. 1-3, 6

_ Synnemata erecta, filiformes, simplices, 5-55 mm longa, Imm crassa, flexiles vel ligneae,
nigro-brunneae. Phialides 7.5-9 x 4.5-5 um, e basi inflate cylindrica vel pyriformibus in
cillum 0.5-0.8 um crassum angustatae, prolificis. Conidia ellipsoidea vel leviter curvata, 6
x 1.5-2 um, mucigeri, ellipsoideis, 6 x 4.5 um. Holotypus: GZDXIFR98-7132

Synnemata filiform, erect, unbranched, 5-55 mm long, 1mm wide, flexible to ligneous,
dark brown, arising from between head and thorax parts of host insect. Phialides solitary

352

or crowded along synnemata, mostly with cylindrical or pyriform inflated basal portion,
7.5-9 x 4.5-5 um and with one or 2 slender, thin necks, 7.5-11 x 0.5-0.8 um. Conidia
long ellipsoidal to the shape of an orange segment, 6 x 1.5-2 um; embedded in a mucous
sheath, ellipsoidal, 6 x 4.5 um. Teleomorph not observed.

Specimen studied: GZDXIFR98-7132. was collected from Zhangjiajie Nature Reserve,
Hunan Province by LIANG Zonggqi, LIU Aiying et al. in VII 1998.

Habitat: A larva of Lepidoptera.
Distribution: Zhangjiajie Nature Reserve—Hunan Province, China.

Hirsutella crinita Z.Q. Liang sp. nov. Figs. 1-2, 5

Synnemata erecta, filiformes vel cylindrica, simplices, 170 mm longa, 1-1.5 mm crassa,
flexiles vel ligneae, nigro-brunneae, caespitosa. Phialides 4.5-6(-10) x 3.5-4.5 um, e basi
inflata globosa vel cylindrical in collum 0.3-0.5 um crassum angustatae, prolificis. Conidia
rara, clavata angusta, 6-9 x 1-1.5 um, exmuca. Holotypus: GZDXIFR98-523 1.

Synnemata slender cylindrical or filiform, unbranched, flexible to ligneous, dark brown,
caespitose, arising from the head and thorax parts of host insect, very long (up to 170
mm), slightly swollen in the basal region, 1.0-1.5mm wide, in middle part to upside,
0.5-1.0 mm wide. Phialides somewhat scattered, forming a loose hymenium, arising
as lateral cells from the outer hyphae of the synnemata, hemispheric to globose or
cylindrical, inflated at basal portion, 4.5-6(-10) x 3.5-4.5 um, abruptly narrowing into a
short thin neck, 1.5-4 um long and 0.3-0.5 um wide, always proliferating 2-4, sometimes
forming inflated, sterile cylindrical hyphae, 15 x 4.5-5 um. Conidia infrequent, narrowly
anisomerous obclavate, 6-9 x 1-1.5 um, absence of distinct mucus layer. Teleomorph not
observed.

Specimen studied: GZDXIFR98-5231 was collected from Wuyishan, Hujian Province by
LIANG Zongqi, LIU Aiying et al. in V 1998.

Habitat: A larva of Lepidoptera. 80-100 x 50-80 mm.
Distribution: Wuyishan, Fujian Province, China.

Discussion

Evans & Samson (1982a,b, 1984) reported several species with phialides of two types
(Table 2): A-phialides, which are lateral and compacted in a layer below the head,
and B-phialides, which are terminal, compact, and awl-shaped. The new species,
H. zhangjiajiensis, forms both A- and B-phialides during the ascosporic microcycle
conidiation (Fig. 1-1) and produces B-phialides that are solitary and compacted. Species
in the genus Hirsutella that have awl-shaped phialides more than 40 um long include
H. aphidis, H. stilbelliformis var. stilbelliformis, H. stilbelliformis var. dolichoderi, H.
sporodochialis, H. darwinii, H. guignardii, H. sinensis, and H. zhangjiajiensis. Among
them, species that have both A- and B-phialides and some phialides greater than 40um
long are H. sporodochialis, H. stilbelliformis var. stilbelliformis, H. stilbelliformis var.
dolichoderi and H. zhangjiajiensis (Table 2). Possession of rough-walled hyphae and
echinate phialides separates the three former species from H. zhangjiajiensis.

In the genus Hirsutella, some species that have proliferating phialides are H. besseyi,
H. guyana, H. versicola, H. verticillioides, and H. yunnanensis var. tenuisynnemata. All

Table 2. A comparison of three new Hirsutella with related species

353

Phialides
Species Length Conidia (um) Reference
Shape in um Type
(max.)
H. aphidis Cymbiform
Perch Awl >40 B 9x1.5-2.5 Petch 1942
H. besseyi Awl or >40 B Ellipsoid or Minter & Brady
FE. Fisher cylindrical limoniform 1980
4.1-8.3x2.5-5.8
*H. crinita Base inflated: >10 A Narrowly clavate, This work
subglobose 6-9 x 1-1.5
H. darwinti Awl >40 B Fusiform Evans & Samson
H.C. Evans & Samson 4.5-11.5x1.5-2 1982a
H. guignardii (Maheu) Awl >40 B Ellipsoid or fusiform Samson et al.
Samson et al. 7-13x4-6 1984
H. guyana Base inflated: >40 A Ellipsoid or an Minter & Brady
Minter & B.L. Brady cylindric orange segment 1980
8-12x3-7
*H. hunanensis Base inflated: >10 A Ellipsoid or an This work
cylindric to orange segment
pyriform 6 x 1.5-2
H. minnesotensis Base inflated: >10 A Globose Chen et al. 2000
S.Y. Chen et al. subglobose 4-6 (in length)
H. necatrix Base inflated: >5 A& Ovoid or ellipsoid Minter et al. 1983
Minter et al. subglobose >10 B 3-4x2.5-3
& awl Globose, -3.5
H. sinensis Awl >40 B Reniform or Liu et al., 1989
Liu et al. ellipsoid
5.4.-14x3.2-5.4
H. sporodochialis Base inflated: >80 A to Fusiform Evans & Samson
H.C. Evans & Samson flask-shaped B 10-27x3.5-4 1984
or awl
H. stilbelliformis Base inflated: >10 A& Clavate 7-9x1.5-2.5 | Evans & Samson,
H.C. Evans & Samson ellipsoid >100 B Ovoid 8-12x4-5 1982b
echinate &
awl
H. stilbelliformis var. ' Base inflated: >40 A& Cylindrical to ovoid Evans & Samson,
dolichoderi ellipsoid >100 B 6.5-9.5x3.5-4.5 1982b
H.C. Evans & Samson echinate &
awl
H. versicola Base inflated: >40 A Fusiform Minter & Brady
Petch ellipsoid 4-7x1 1980
H. verticillioides Base inflated: >40 A Ellipsoid or an Minter & Brady
Charles cylindrical orange segment 1980
6-8x3-5
H. yunnanensis var. Base inflated: >10 A Cylindrical or Liang et al.,1997
tenuisynnemata ellipsoid or obclavate
Z.Q. Liang & A.Y. Liu subglobose 4.5-7,2X1.5-1.8
*H. zhangjiajiensis Awl >40 A& Lanceolate or an This work
& base B orange segment,
inflated: 4.5-10x 1.5-2.5

ellipsoid

354

of these species are similar to the new species H. hunanensis in fusiform, ellipsoidal and
orange conidia. H. hunanensis can be distinguished from the above-mentioned species
by phialides less than 10um length and smaller conidia, around 6 x 1.5-2 um.

Minter et al. (1983) described a new species, H. necatrix, that also has phialides
with a subglobose or globose swollen base portion. Possession of ovate or ellipsoidal
separates this fungus from H. crinita, which has narrowly clavate conidia (Table 2). The
new species H. crinita is also closely related to H. minnesotensis and H. yunnanensis
var. tenuisynnemata with similar phialides containing a subglobose basal portion.
Globose conidia typically found in H. minnesotensis distinguish it from H. crinita. H.
yunnanensis var. tenuisynnemata has fusiform or ellipsoidal conidia and can produce
yellow caespitose synnemata.

Acknowledgments

This project was supported by the National Natural Science Foundation of China. We are grateful
to Drs. Shengjun Chang and Jielin Liu for their comments on the manuscript. And we really
appreciate editorial revisions.

References

Cayrol JC, Frankowski JP. 1986. Influence of the number of parasitizing conidia of Hirsutella
rhossiliensis on the mortality of Ditylenchus dipsaci. Revue Nématol. 9(4): 411-412.

Cayrol JC, Castet R, Samson RA. 1986. Comparative activity of different Hirsutella species towards
three plant parasitic nematodes. Revue Nématol. 9(4): 412-414.

Chen SY, Liu XZ, Chen FJ. 2000. Hirsutella minnesotensis sp. nov., a new pathogen of the soybean
cyst nematode. Mycologia 92(5): 819-824.

Evans HC, Samson RA. 1982a. Entomogenous fungi from the Galapagos Islands. Can. J. Bot. 60:
2IL0-2LI30.

Evans HC, Samson RA. 1982b. Cordyceps species and their anamorphs pathogenic on ants
(Formicidae) in tropical forest ecosystems II. The Camponotus (Formicinae) complex. Trans.
Br. Mycol. Soc. 82 (1): 127-150.

Evans HC, Samson RA. 1984. Cordyceps species and their anamorphs pathogenic on ants
(Formicidae) in tropical forest ecosystems I. The Cephalotes (Myrmicinae) complex. Trans. Br.
Mycol. Soc. 79(3): 431-453.

Evans HC. 1974. Natural control of arthropods with special reference to ants by fungi in the tropical
high forest of Ghana. J. Appl. Ecology (11): 37-49.

Evans HC.1982. Entomogenous fungi in tropical forest ecosystem: An appraisal. Ecological
Entomology (7): 47-60.

Fang HM, Tan SM. 1992. A new species of Hirsutella, H. leizhouensis Fang & Tan. Acta Mycologica
Sinica 11(1): 28-31.

Jaffee BA, Zehr EL. 1982. Parasitism of the nematode Criconemella xenoplax by the fungus Hirsutella
rhossiliensis. Phytopathology 72: 1378-1381.

Li CR, Huang B, Fan MZ, Li ZZ. 1999. Cordyceps longissima and its Hirsutella anamorph.
Proceedings of 4th Sino-Korean Joint Symposium on Mycology. J. Anhui Agri. Univ. 26(3):
374-377.

Li CR, Xia CR, Lin YR, Fan MZ & Li ZZ. 2005. Hirsutella huangshanensis sp.nov., the anamorph of
Cordyceps formosana and its infection on Tenebrio molitor Mycosystema 24(3): 349-355.

alia,

Liang ZQ. 1990a. Classification of the genus Hirsutella Pat. I. Advance and the characteristics of
taxonomy. Journal of Guizhou Agricultural College 9 (1): 58-68.

Liang ZQ. 1990b. Classification of the genus Hirsutella Pat. II. Key to the taxa of the genus Hirsutella
Pat. Southwest China Journal of Agricultural Sciences 3 (3): 32-39.

Liang ZQ. 1991a. Several entomopathogenic new species and records of Stilbelaceae in China.
Journal of Guizhou Agricultural College 10 (1): 56-62.

Liang ZQ. 1991b. Two new entomopathogenic fungi of the genus Hirsutella. Southwest China
Journal of Agricultural Sciences 4 (1): 51-56.

Liang ZQ, Liu AY & Huang JZ. 2002. Some entomogenous fungi from Wuyishan and Zhangjiajie
Natural Reserves I. Cordyceps spp. Mycosystema 21(2): 162-166.

Liang ZQ, Liu AY, Huang JZ & Jiao YC. 1997. The genus and its allies from Kuankuoshui Preserve
in Guizhou II. Mycosystema 16 (1): 61-67.

Liu AY, Liang ZQ, Cao L & Yang HM. 1993. A few new and rare entomogenous fungi in Kunming
area. Southwest China Journal of Agricultural Sciences 6 (1): 87-90.

Liu XJ, Guo YL, Yu YX & Zeng W. 1989. Isolation and identification of the anamorphic state of
Cordyceps sinensis (Berk.) Sacc. Acta Mycologica Sinica 8(1): 35-40.

Maimala S, Tartar A, Boucias D & Chandrapatyab A. 2002. Detection of the toxin Hirsutellin A
from Hirsutella thompsonii. Journal of Invertebrate Pathology 80: 112-126.

Mazet I & Vey A. 1995. Hirsutellin A, a toxic protein produced in vitro by Hirsutella thompsonii.
Microbiology 141: 1343-1348.

Minter DW, Brady BL. & Hall RA. 1983. Five hyphomycetes isolated from eriophyid mites. Trans.
Br. Mycol. Soc. 81(3): 455-471.

Petch T. 1942. Notes on entomogenous fungi. Trans. Br. Mycol. Soc. 25: 259-260.

Samson RA, Rombach MC & Seifert K. 1984. Hirsutella guignardii and Stilbella kervillei, two
troglobiotic entomogenous hyphomycetes. Persoonia 12(2): 123-134.

Seifert KA & Boulay H. 2004. Hirsutella uncinata, a new hyphomycete from Australia. Mycologia
96(4): 929-934.

Vongvanich N, Kittakoop P, Iaska M, Trakulnaleamsai S, Vimuttipong S, Tanticharoen M &
Thebtaranonth Y. 2002. Hirsutellide A, a new antimycobacterial cyclohexadepsi peptide from
the entomopathogenic fungus Hirsutella kobayasii. J. Nat. Prod. 65(9): 1346-1348.

Xu YJ, Duan XM, Li ML, Jiang LQ, Zhao GL, Meng Y & Chen LG. 2005. Synthesis of the key
precursor of Hirsutellide A. Molecules 10: 259-264.

lay

i ba e vie ear / be ;
7h A 3 ;
sy he ae ea - at AMPs 7 as
Bsa atte dies tame Dawe Rian Wied Saar ae rae Sate tg
ee hol Laeecendul hy > enn aan e napa
14; ARES Cath We eidiakaddnddmuntatticienelontites
ee | , cara et i wel

er
iin gcb eit
cri a aa +o, tani
ny set Saas tat Os arn

ee osenetenst ear ee i

| iv sill w3i Love gerry ttm

. pels ; bare We fab at sutra (ery d wwevdistade? il “a
ae grimnoo mM yt abOLSIyOMONOS vo baa wan wil A £@et JAM gue AJ ae OS giteid : tke

ar 00-78 (Adeermaistgnrtenite@ In fortuna sori tatoo taro mn

aeons, MNDRARY: Ung ondoad LA Lit wines 2 Tifa ae Mla
bey j RP AR ‘3 aie tna (Oe naka aD EM at i. -s2t adap) ape sbi eRED NY |
Sain sles wit obo Me folivarecl SOE A deneytbita 2 (i sain yA thet 2 alucoied |
OE STL D2 | rgoloibay standart hs Ineruecl viveae yeverld nilkotivew} rere
dimers nalss wei yd endive ak bs! une et ROT oA MiliatoedT RUT A + A | is
7 Sols BEET-ERE LEE reveled
veg Hina ssh a Sigpo Rta cen a tieyrlow He) ARERR tet pe
Le cai digtt ey Ot uy pital Of Ditphenchges dipetige Pow ‘alt cide DE AAS kioyM, Mw
cepeat (a Camet h.dacneeg Rd JGR hese: wart: age eel abe rier oie Dubanets 9
tik" bias Gti? BP Mintingl ag! se AOE Reet? BOM sbapcenall Ay doderpae 7
Jp NZ: fhe Ff ae gt atn teat aew cterhey at umemny henimobdletdeyers a.
aty.! Ne Lite Fi ee shat iio & reeaiae midisnetl 2005 A. valvol BAA ceting |
eens 4 oe RAC {Ro Cah ewie bear ai as its ca Tag Aid by JO ot aneh
WO ne aistind.2 groqiiumaly .2 fgnmnaslptilanhardt Malena! 5. goede Aaaabs ane ‘l
“nti: ghettos te pe) deb et0? eriytsddoserdinariwsde @/ A kbMienener ios Wingman des
es 5 COSY ROE PNT ier at bahar e Cidlaplaoti Secagoodd topes tienen ely |
45.0 Shi Wy 5 “1 nye 200k Dold 6 ¥ yasM 19 eed OF gral , A bLMiX nent AT iy
Peas 1S Satie RA. Peles Conieay THOS Ale lhcepalea nity YH hotgna
/ Per nieg it) iy) Ow re eae stan T The CG pounionia bfy rich, nay) ¢ MOAR 2 tik Be
Co) Mpc Rkeo7eCRk 291 09 pnt 9% ‘|
ah | ri {. diah “e ayeul of ay hited with « ew ai te npc netia tt srk a
| bigh Carey af Ghiag, T, Appl, Beapaee Tia | ane a
ane ate 7 Srivves Pare ae jis ris deri fora we Aiden Ave arin tiga s
: warty (> 7 ef, i!
ee DOK) watt ha , 1 rN nee sponges vi bord ey yi shi es o Patig « 9 Yun, we Nis scales,

; yin atic i q

wed rg
' |. @aew Ry Tatu PL. ant, Porgaivain ad the Aa) cone vases wey Fs

htettiveets. Phemgethaiogy 72-4 YR FNRI, ‘tay

0. Posen By tan MSZ om Coda: haadmad uid it ‘\ahdihes attiesorph *

Arenbddnygs oF ath Sang aisee poten Bycapopigen en _—— j Ai Age NtRbles HN oF

a ; i Png

Li Len, Pts wi ty ‘e iow ww WZ. ee mene ton,

#F rao ahaa aan asane ats mee

. f r ri Vs —_
a Ay va f

Meas i e ay Bre

sta
ore eer LS - a
3,

Lan

MY COTAXON

Volume 94, pp. 357-363 October-December 2005

Paecilomyces parvosporus, a new species with its relatives from
Yunnan Province, China

YANFENG HAN! ZONGAQI LIANG?
HUuALI CHU? & JICHUAN KANG?

‘swallow112886@yahoo.com.cn *zqliang472@yahoo.com.cn
Institute of Fungus Resources, Guizhou University
Guiyang, China 550025

*hualil1121@163.com
Hainan University, Haikou, 570228 China

> Jichuank@yahoo.co.uk
The Research Center of Biochemistry Engineering
Guizhou University Guiyang, China 550025

Abstract—Four Paecilomyces isolates were isolated from soils and insects infected in
Yunnan Province, China. Amongst them, GZDX-IFR-A10.1 has been distinguished as
a new species by its unique morphological characters including a light yellow colony
on Czapek, small subglobose or globose conidia and long and thin phialidic necks as
well as a phylogenetic analysis based on the nucleotide sequences of the ITS region.
Meanwhile the other three isolates GZDX-IFR-A35.1, GZDX-IFR-466.6 and GZDX-
IFR-468.2 were identified as P lilacinus, P. tenuipes and P. cateniannulatus.

Key Words—taxonomy, morphology, fungi, rDNA sequence

Introduction

China is rich in fungal species in Paecilomyces. Recently we have found several new
species in Paecilomyces (Han et al. 2005a, b, Liang et al. 2005). In 2004, while carrying
out a project of the National Natural Science Foundation of China (NSFC) to investigate
the Paecilomyces species in Kunming, Nujiang, Lancangjiang Xishuangbanna
(Tropical rain forest), Tengchong (Geothermal National Geopark) and Lijiang areas
in Yunnan province, we collected many Paecilomyces samples from the soils and
infected insects. Amongst them, quite a few species in Paecilomyces known in China,
including P. cateniannulatus, P. tenuipes, P. farinosus, P. cateniobliquus (Liang 1981) and
P. amoeneroseus (Liu & Liang 2003) were collected and isolated again. Moreover, a few
Paecilomyces members with mesophilic and thermotolerant nature from soils have also
been obtained (Liang et al. 2005).

*Corresponding author: Zongqi Liang

358

Table 1 DNA sequences used in the phylogenetic studies from Genbank

Name GenBank No. Name GenBank No.
P. amoeneroseus AY624168 P. inflatus AB099943
P. carneus AY624170 P, javanicus AY 624186
P.cateniannulatus AY624172 P lilacinus AY624188
P. cateniobliquus AY 624173 P. marquandii AY624193
P. cicadae AB085887 P. niphetodes AY624192
P. coleopterorum AY624177 P. penicillatus AY624194
P. farinosus AY624181 P. sinensis AJ243771
P. fumosoroseus AY624182 P. tenuipes AY491997
P. ghanensis AY624185 P. variotii AY247956
P. gunnii AY489650 P. viridis AY 624197

The genus Paecilomyces Bainier shares many identical or similar morphological
characters with its related genera including Acremonium Link, Gabarnaudia Samson
& W. Gams; Penicillium Link, Mariannaea G. Arnaud, Septofusidium W. Gams and
Verticillium Nees. It is difficult to distinguish them using only morphological characters,
particularly species intermediate between Penicillium and Paecilomyces. Recently
molecular biological techniques, including phylogenetic rDNA sequence analyses, have
become efficient ways to identify the intermediate and doubtful species. In this paper,
we used both morphology and phylogenetic analysis of rDNA sequences to identify
a few Paecilomyces species isolated from soil samples and infected insects of Yunnan
Province. The results showed that strain GZDX-IFR-A10.1 is a new species named here
as P. parvosporus. The strain GZDX-IFR-A35.1 was identified as P. lilacinus. While the
strains GZDX-IFR-466.6 and GZDX-IFR-468.10 were identified as P. tenuipes and P
cateniannulatus respectively.

Materials and Methods

Tested strains 1
Four tested strains, GZDX-IFR-A10.1, GZDX-IFR-A35.1, GZDX-IFR-466.1 and GZDX-
IFR-468.10 were used in this paper.

Collection and strain isolation

GZDX-IFR-A10.1 and GZDX-IFR-A35.1 were isolated from soil samples of Dali City,
Yunnan Province. Two grams of soil were added to a flask containing 20ml sterilized
water and glass beads. The soil suspension was shaken for about 10 min and then diluted
to concentrations of 10°-10°'. 1 ml of soil suspension (10°) was mixed with Martin's
medium in a sterilized 9cm diameter Petri dish and incubated at 25C for 5 days.
Colonies with Paecilomyces conidiogenous structures were transplanted to Martin's slant
for purification. GZDX-IFR-466.1 and GZDX-IFR-468.10 were isolated from infected
insects from Xishan Park, Yunnan Province. A small amount of spore powder from
insect surface was transplanted to Martin's medium by sterilized inoculation needle,
and then incubated at about 25C for 3-5 days. The isolates were purified when their
conidiogenous structures became the same as those on insects.

eee eee LL ON ee ee

_ =~ rat hhc

359

Fig. 1 Conidiogenous structures of Paecilomyces parvosporus. Bar = 10 um.

Strain identification

The strains under study were transplanted on Czapek agar, potato dextrose agar (PDA),
and Sabouraud agar according to Brown and Smith (1957) and Samson (1974). After
incubation at 25°C for 7 days, the strains were identified based on colony features,
conidiogenous structure and biological property. Type strains of GZDX-IFR-A10.1 and
its holotypes GZDX-A10.1, the dried plate cultures on Czapek agar, were deposited in
the Institute of Fungus Resources, Guizhou University, Guizhou province, China.

Reagent
Taq enzyme and dNTP were bought from Shanghai Sangon, Agarose Gel DNA
Purification kit ver 2.0 from TAKARA Company®

DNA extraction

The four strains from Yunnan Province used for the molecular identification were
incubated on Czapek agar and potato dextrose agar. Subsequently, the fresh sporulating
cultures were used for DNA extraction according to Tigano-Milani et al. (1995), and
then DNA were kept at -20°C.

PCR amplification and determination of ITS rDNA sequences
Polymerase chain reaction (PCR) amplification was performed according to the
manufacturer's instructions, 50uL reaction system: 10x reaction buffer 5 uL, dNTP 1uL,

360

primer ITS4 1yL, ITS5 1pL, Pfu buffer 0.5 yl, 2uL of template DNA and ddH,O 39.5
uL. The amplification program: a first step of 94°C for 5 min; then 35 cycles consisted
of 94°C for 40 s, 49°C for 40 s, and 72°C for 1 min; and a final step of 72°C for 10
min. To amplify ITS1-5.8S- ITS2 rDNA, the following primers were used: ITS4 (5’-
TCCTCCGCTTATTGATATGC- 3’) and ITS5 (5°-GGTGAGAG ATT TCTGTGC -3’).
PCR products were purified using Agarose Gel DNA Purification kit ver 2.0 according
to its procedure (TAKARA Company), and purified DNA samples were sent to Beijing
Sunbiotech Co. Ltd. for sequencing. The rDNA sequences of ITS1-5.8s- ITS2 regions
of the four strains from Yunnan Province were submitted to GenBank (DQ187951-
DQ187954).

Sequence alignment and phylogenetic analysis

Sequences were aligned by Clustal X, and adjusted to maximize homology. Then the
phylogenetic tree was constructed using Neighbour-Joining (NJ) and Maximum
Parsimony (MP) methods in PAUP 4.0b10. Confidence values for individual branches
were determined by bootstrap analysis (1000 replications).

Results

Taxonomy

Paecilomyces parvosporus Y.F. Han & Z.Q. Liang sp. nov. Fig.1

Coloniae in agaro Czapekii ad 20 mm diam, 14 diebus 25°C, primitus albae, tum
leteus, olivaceus in margo; reversio citrinae. Hyphae hyalina, levia, 0.6-3.6 um crassa.
Conidiophora ramosa, 11.2-38.1 um crassa, phialidibus 2 vel 5 terminatis. Phialides 4.8-9.6
x 1.2-1.8 um, e basi inflata, cylindrical vel clavata in collum tenerum; Conidia continua,
hyalina, levia, subglobulosa; vel globulosa, 1.2-2.4 um. Chlamydospora ellipsoidea, 4.0-
10.1 x 2.7-6.7 um.

Typus: GZDX-IFR-A10.1 et cultara GZDX A10.1, isolatus e soli, Dali city, provincia
Yunnan, China, VI, 2004, Y.E Han & Z.Q. Liang. In Guizhou Univ, conservatur.

Colony on Czapek agar, attaining a diameter of 20mm within 14 days at 25°C, floccose,
at first white, then light yellow, green in margin, appearing evident radial furrow,
round; reverse yellow. Vegetative hyphae hyaline, smooth-walled, septate, 0.6-3.6 um
in diameter. Conidiophores hyaline, smooth-walled, septate, branched, about 11.2-38.1
tum, bearing whorls containing 2-5 phialides. Phialides 4.8-9.6 x 1.2-1.8 tm, consisting
of a cylindrical or claval basal portion, tapering into a distinct neck. Conidia in dry
divergent chains, one-celled, smooth, subglobose to globose, 1.2-2.4 um in diameter;
Chlamydospores ellipsoidal, 4.0-10.1 x 2.7-6.7 um.

Material examined—GZDX-IFR-A10.1 was isolated by Y.F. Han & Z.Q. Liang
from vegetable soils collected in Dali, Yunnan Province, China, June, 2004.

Distribution— Yunnan Province, China.

DNA sequencing

To analyze the ITS rDNA sequence of the tested strains and Paecilomyces species from
NCBI (Table 1), PAUP was applied to construct the phylogenetic tree by the methods of

100

| 100 | |
78 | } | | 99

| 96
— 97

100

81 |

361

Po margquandii AYO24193
P vividis AY624197
P. earnenus AYG24170
GZDX-IFR-ASS.1
PB hlacimis AYG24 188
PB cioadae ARUSSSS7
P humosaroseus AY G24 152
GZUR-TPR-466.6
P tennines AYA91 997

P. ghanensis AYG2A185

FP coleepterorum AYO2ZA1T?7

' FP farinosus AYG241 81

FP eateniannulatus AYG241 72

* GZLDX-TPR-468, 10

P anmeneraseus AY 624168

P. gateniabliguus AY 624173

P javanious AY 624186

FB sinensix AJ243771

P& varioni AYZATIS6

. GZDRX-IFR-AIOI

P inflatus ATOOOO43

P, penivillatus AY624194

PB aunt AYASOGSO

Priphetodes AYO2A192

Fig.2 Phylogenetic tree based on aligned internal transcribed spacer sequences (ITS1-5.8S-ITS2
rDNA) of selected Paecilomyces species, showing the sister group relationship between a few
species and the new species. (CI = 0.7284, HI = 0.2716, RI = 0.7577, RC = 0.5520)

362

NJ and MP. The results from NJ and MP methods are almost identical, so only the tree
constructed by MP was shown in the paper. The phylogenetic tree inferred from the
ITS sequence data (Fig.2) shows that the two strains GZDX-IFR-466.6 and GZDX-IFR-
468.10 are clustered well with P tenuipes AY491997 and P. cateniannulatus AY624172
from NCBI in two subclades (88% and 99% bootstrap supports), respectively. GZDX-
IFR- A35.1 strain is very similar to P lilacinus in the morphological characters, its ITS
sequence is clustered very well with P lilacinus AY624188 in the same subclade (100%
bootstrap support), so GZDX-IFR- A35.1 strain is identified as P lilacinus. The strain
GZDX-IFR-A10.1 forms a separate branch close to P. sinensis AJ243771, P. variotii
AY 247956 and P. inflatus AB099943 is therefore identified as a new species.

Discussion

In the genus Paecilomyces, based on the morphological characters, the accepted
species with cylindrical phialides base and globose conidia are as follows: P. carneus.
P. marquandi, P. stipitatus and P. vinaceus. The conidia of P. carneus are echinate. The
colony of PR. marquandii is red, but the colony of the new species is yellow to green.
The phialides of P stipitatus have septate and thin long stalks, and its colony is white.
P. vinaceus is characterized by its vinaceous colony reverse. The new species can be
distinguished from the above-mentioned species by its greenish colony, much smaller
conidia and its very thin, long phialide necks.

The phylogenetic tree showed that the newly named P. parvosporus (GZDX- IFR-
A10.1), PB inflatus, P. variotii, and P. sinensis were grouped in the same subclade. But P.
inflatus has monophialides and fusiform conidia (Samson 1974). P. sinensis can produce
obvious synnemata on the media and its conidia are fusiform to ellipsoidal, 4.5-7.5 x
1.2-3.8 um (Q.T. Chen 1984). The 3.2-5 x 2-4 um conidia and fulvous colony of P. variotii
(Brown & Smith 1957, Samson 1974) distinguish it from the new species.

In addition, P. parvosporus was highly homologous with Penicillium daleae when
blasted in NCBI Genbank. According to Raper & Thom (1949), Penicillium daleae is
mainly characterized by coarsely roughened conidia that are ellipsoidal to subglobose,
3.0-3.5 x 2.5-3.0 um. P parvosporus, however, has smooth conidia that are globlose to
subglobose, 1.2-2.4 um. It can therefore be obviously distinguished from Penicillium
daleae.

Acknowledgements

This project was supported by the National Natural Science Foundation of China (NSFC No.
30270011) and the Key Laboratory of Microbial Resources, Yunnan University, Yunnan Province,
the Ministry of Education P. R. China. We are grateful to Dr. Shengjun Chang and Dr. Jiangxin
Wang for their comments on the manuscript. We also appreciate Dr. Jinkui Yang for his help
during the experiment, and thank Dr Shaun Pennycook and the Editor-in-Chief for their warm
corrections.

References

Brown AHS, Smith G. 1957. The genus Paecilomyces Bainier and its perfect stage Byssochlamys
Westling. Transactions of the British Mycological Society 40: 17-89.

363

Chen, QT, Xiao RS, Shi ZY. 1984. Paecilomyces sinensis sp. nov. and its connection with Cordyceps
sinensi. Acta Mycologica Sinica 3: 24-28.

Han YF, Liang ZQ, Chu HL. 2005a. Studies on the genus Paecilomyces in China II. Paecilomyces spp.
from Guizhou Mycotaxon 91: 361-364.

Han YF, Chu HL, Liang ZQ. 2005b. Two new species of the genus Paecilomyces in China. Mycotaxon
92; 311-316.

Liang ZQ. 1981. Entomogenous fungi from the pests of tea-plants. Acta Phytopathologica Sinica
11(4): 9-16.

Liang ZQ, Chu HL, Han YF. 2005. A thermotolerant Paecilomyces sp. nov., which produces laccase
and biform of sporogenous structure. Fungal Diversity (In press).

Liu AY, Liang ZQ. 2003. Paecilomyces amoeneroseus, one new record in China. Mycosystema 22(
Suppl.): 80-81.

Raper KB, Thom C. 1949. The manual of the Penicillia. The Williams & Wilkins Co., Baltimore,
296-298.

Samson RA. 1974. Paecilomyces and some allied hyphomycetes. Studies in Mycology No.6: 1-119.

Tigano-Milani MS, Samson RA, Martins I, Sobral BWS. 1995. DNA markers for differentiating
isolates of Paecilomyces lilacinus. Microbiology (Reading, U.K.), 141: 239-245.

MYCOTAXON

Volume 94, pp. 365-370 October-December 2005

Notes on Otidea from Xinjiang, China

WEN- YING ZHUANG!

zhuangwy@sun.im.ac.cn
Key Laboratory of Systematic Mycology & Lichenology, Institute of Microbiology
Chinese Academy of Sciences, Beijing 100080, China

Abstract — Newly collected specimens of Otidea from Xinjiang, China were examined.
Five taxa of the genus are identified. Among them, Otidea crassa is described as a new
species and O. onotica var. brevispora is treated a new variety.

Key words — taxonomy, new taxa

Introduction

Species of the genus Otidea (Pers.) Bonord. is widely distributed in north temperate
areas. They are characterized by apothecia of medium to large size, mostly terrestrial,
ear-shaped, split down to base or discoid, with some shade of whitish, yellow, brown or
ochre; asci operculate, not blued by iodine; ascospores elliptical to elliptical-fusiform,
biguttulate; paraphyses slender, strongly curved at apex, capitate or with notches at
apical portion. According to the CABI database,” 71 published species names are listed
under Otidea and apparently 17 of them should be excluded from the genus. But many
of the rest are either synonyms or doubtful members of the genus. About 15 species
are commonly accepted in the world (Kirk et al. 2001). Regional studies have been
carried out in China, India, Japan, Lithuania, United Kingdom, the Nordic countries,
North America, etc. (Kanouse 1949, Nannfeldt 1966, Otani 1969, Thind & Waraitch
1974, Harmaja 1976, Dennis 1978, Breitenbach & Kranzlin 1984, Cao et al. 1990, Korf
& Zhuang 1991, Dissing 2000, Kutorga 2000). Species diversity of the genus in each
region seems not very high. In China, fifteen taxa of Otidea were previously reported
by Cao et al. (1990) from Gansu, Heilongjiang, Jilin, Shaanxi, Shanxi, Sichuan, Yunnan,
Xinjiang, and Xizang. Otidea alutacea var. alutacea [2 collections] and O. propinquata
(P. Karst.) Harmaja [a single collection] in Picea forests were the only records known
from Xinjiang, an area in the northwest occupying more than 1/7 of the China mainland
territory. In our recent field trip to Xinjiang, 20 specimens of the genus were collected
from Burgin, Jimsar, and Yining. Five taxa are recognized among them. Otidea leporina
is the most common. Otidea crassa is described as a new species and Otidea onotica vat.
brevispora is proposed as a new variety.

Supported by the National Natural Science Foundation of China (nos. 30230020, 30499340).
*http://www.indexfungorum.org/Names/Names.asp

366

Taxonomy

Otidea alutacea (Pers.) Massee, British Fungus Flora 4: 446, 1895.

Specimens examined: CHINA. Xinjiang, Urmudi, on the ground, 12 VII 1985, L. Fan 10,
HMAS 88262; Xinjiang, Burqin, Hemuxiang, alt. 1100 m, 5 VIII 2003, on the ground, W.
Y. Zhuang & Y. Nong 4719, 4722, 4685, HMAS 83559, 83560, 83562; ibid., 6 VIII 2003,
on the ground, W. Y. Zhuang & Y. Nong 4744, 4739, HMAS 83561, 83563.

Notes: The fungus is characterized by the truncate to cupulate apothecia with one side

split to the base and up to 5-7.5 cm wide; hymenium surface beige, light cinnamon,
cinnamon brown to brown when fresh; receptacle surface usually lighter than hymenium
surface, beige, light cinnamon brown, brownish yellow to brown; ascospores ellipsoid
with blunt ends, 13.5-15.8 x 6-8.5um; paraphysis apices curved to hooked. The five
known collections were all found in Burgin in northeastern Xinjiang. It was reported
previously from Heilongjiang, Jilin, Xinjiang (Urmugqi), Shanxi, and Xizang of the
country (Cao et al. 1990).

Otidea cochleata (L.) Fuckel, Jahrb. Nassauischen Vereins Naturk. 23-24: 329, 1870.

Specimens examined: CHINA. Xinjiang, Jimsar, alt. 1700 m, 1 VIII 2003, on duff under
Picea sp., W. Y. Zhuang & Y. Nong 4622, 4645, 4651, HMAS 83564, 83575, 83576.

Notes: This species is characterized by the medium-sized, cupulate to truncate apothecia
with light brown, brown to dark brown hymenium surface and light brown, yellowish
brown to brown receptacle surface when fresh; hymenium 240-270 um thick, asci
12.5-15 um wide; and ellipsoid to broad-ellipsoid ascospores 15-18 x 8.6-11.7 um. The
club-shaped cells of the outer excipulum arise from small angular cells which arise by a
gradual transition from the textura intricata of the medullary excipulum.

Otidea cochleata was first reported from Milin, Xizang in southwestern China based
on one collection (Cao et al. 1990). Otidea umbrina (Pers.) Bres. is a later synonym
according to the CABI database.

As noted by Breitenbach & Kranzlin (1984), Otidea cochleata is similar to O. alutacea in
apothecial shape and is distinguished from the latter in somewhat smaller and darker
fruitbodies, as well as the larger ascospores.

O. cochleata might also be confused with O. propinquata (P. Karst.) Harmaja occurring
in a similar niche. The latter possesses larger ascospores usually over 18 um in length
(Velenovsky 1934, Kanouse 1949, Harmaja 1976). The single specimen from Xinjiang
previously recorded as O. propinquata (Cao et al. 1990) has not been located. Another
collection identified at the same time as O. propinquata from Shanxi turns out to be
O. cochleata.

Otidea crassa W.Y. Zhuang, sp. nov. Figs. 1-3

Ab Otidea leporina surperficie hymenii flavo-brunneis vel brunneis, surperficie receptaculi
dilute flavo-brunneis, ascis 178-192 x 9.5-12.5 um, ascosporis late ellipsoideus, brevibus,
10.5-12.5 x 7.4-9 um differt.

Etymology: The specific epithet refers to the broadly ellipsoid ascospores produced by
the fungus.

—s-

367

Apothecia ear-shaped, short-stipitate, 1.2-2 cm wide and up to ca 3 cm high, hymenium
surface yellowish brown to brown when fresh and light brown to warm brown when dry,
receptacle surface paler than hymenium when fresh, pale yellowish brown to pale brown
when fresh and becoming orange-brown to warm brown when dry, stipe base whitish;
ectal excipulum of textura angularis, 40-90 um thick, cells more or less isodiametric,
8-30 um diam.; medullary excipulum of textura intricata, 240-330 um thick, hyphae
hyaline, 3-12.5 um wide; subhymenium 30-50 um thick; hymenium 165-215 um
thick; asci 8-spored, subcylindrical, J- in Melzer’s reagent, ca 178-192 x 9.5-12.5 um
wide; ascospores broadly ellipsoid with rounded or blunt ends, biguttulate, smooth,
uniseriate, 10.5-12.5 x 7.4-9 um; paraphyses filiform and curved at apex, 2—2.5 um
wide at apex and ca 1.5—2 um below.

Holotype: CHINA. Xinjiang, Jimsar, alt. 1700 m, 1 VIII 2003, on mossy rotten wood, W.

Y. Zhuang & Y. Nong 4647, HMAS 83571. Paratype: CHINA. Xinjiang, Jimsar, alt. 1700

m, 1 VIII 2003, on mossy rotten wood, W. Y. Zhuang & Y. Nong 4631, HMAS 83570.

Notes: The new species is similar to Otidea leporina (Kanouse 1949) except for the
thinner flank, yellowish brown hymenium surface, and broadly ellipsoid ascospores.
When the two collections of O. crassa were compared with eight of O. leporina from
Xinjiang, distinctions have been found in spore size and shape [10.5-12.5 x 7.4—9 um vs.
11.5-13.5 x 6.4-8 um in the Chinese collections], width of medullary excipular hyphae
(3-12.5 um vs. 2.5-5 um wide), size of ectal excipular cells (8-30 um in diameter vs.
6-15 um wide), and its occurrence on rotten wood instead of soil and duff.

In addition to the morphological characteristics, our 28S nrDNA partial sequence data
(unpublished) support also its separation from O. leporina and show close relationship
to Otidea cantharella (Fr.) Quél., a species with bright yellow pigment in fruitbodies and
composed of only one kind of tissue in excipulum, viz. outer layer of textura prismatica
changing gradually to inner layer of textura intricata, which was treated in a separate
genus as Flavoscypha cantharella (Fr.) Harmaja (Harmaja 1974).

The apothecial shape and spore size of the new species are also similar to those of
O. felina (Pers.) Bres. but the fruitbodies are smaller (1.2-2 cm wide and up to ca 3 cm
high vs. 2-3 cm wide and 3-4.5 cm high), apothecial color is yellowish brown to brown
when fresh instead of light grayish yellow to light flesh colored, ascospores are wider,
shorter [10.5-12.5 x 7.4-9 um vs. 11-13 x 6-8 um according to Saccardo 1913)] and
broadly ellipsoid with blunt ends instead of ellipsoid with slightly pointed ends (Boudier
1905-1910).

Otidea leporina (Batsch) Fuckel, Jahrb. Nassauischen Vereins Naturk. 23-24: 329,
1870 var. leporina
Specimens examined: CHINA. Xinjiang, Jimsar, alt. 1700 m, 1 VIII 2003, on the ground,

W. Y. Zhuang & Y. Nong 4632, 4633, 4634, 4657, 4635, 4636, 4637, HMAS 83565, 83566,
83567, 83568, 83577, 83578, 83579.

Notes: The species seems very common in Xinjiang, as well as in other areas of China,
such as Heilongjiang, Hunan, Jilin, Shanxi, Sichuan, Xizang, and Yunnan as reported
by Cao et al. (1990) and Zang (1996). It is characterized by the ear-shaped apothecia
2-4 cm wide, with hymenium surface cinnamon, cinnamon brown, warm brown,.

368

brown to grayish brown when fresh and receptacle surface concolorous, dark brown
or grayish yellow; ectal excipulum of textura angularis, cells 6-15 um wide, outermost
cells sometimes short club-shaped; medullary excipulum of textura intricata, hyphae
stable in width, ca 2.5-5 um wide; hymenium 165-178 um thick; asci 8-10 um wide;
and ascospores ellipsoid, 11.5-13.5 x 6.4-8 um; paraphyses curved, 1.5-2.5(-3) um
wide at apical portion.

HMAS 83569 (Xinjiang, Yining, Guozigou, alt. 1800 m, 11 VIII 2003, W. Y. Zhuang,
Y. Nong & S. Y. Guo 4845) has smaller, ear-shaped, brown to grayish brown fruitbodies
up to 1.5 x 0.8 cm; elongate-ellipsoid, longer ascospores 12.5-16 x 6-8 um; and
paraphyses straight, bent or curved at apex and 2.5-3.2 um at the widest, and is here
tentatively treated as Otidea cf. leporina.

Kanouse (1949) accepted Saccardo'’s (1889) separation of Otidea leporina var. minor
(Rehm) Sacc. from the original variety. The Chinese collections appear to have identical
morphology to O. leporina var. leporina.

Otidea onotica var. brevispora W.Y. Zhuang, var. nov. Figs. 4-6

Ab Otidea onotica var. onotica ascosporis brevibus, ellipsoideus vel late ellipsoideus,
8.5-10.5(-11) x 5.2-7 um differt.

Etymology: The specific epithet refers to the short ascospores produced by the fungus in
comparison with those in Otidea onotica var. onotica.

Apothecia spoon- to ear-shaped, short-stipitate, 1-5 cm wide and 2.5-8 cm high,
hymenium surface yellow to dull yellow when fresh, receptacle surface yellow or paler
than hymenium when fresh, stipe base whitish; ectal excipulum of textura angularis,
50-80 um thick, cells 13-20 x 5-12 um and 9-26 um in diameter if isodiametric, with
the outer most cells somewhat club-shaped; medullary excipulum of textura intricata,
100-660 um thick, hyphae hyaline, 2-8 um wide; subhymenium 40—50(—70) um thick;
hymenium 140-180 um thick; asci 8-spored, subcylindrical, J- in Melzer’s reagent,
(7—)8-9.5(-10.5) um wide; ascospores ellipsoid to broadly ellipsoid with rounded or
blunt ends, biguttulate, smooth, uniseriate, 8.5-10.5(-11) x 5.2-7 um; pataphyses
filiform and curved at apex, 2-2.8 um wide at apex and ca 1.5 um below.

Holotype: CHINA. Yunnan. Baoshan, alt. 1900 m, 24 VII 2003, Z. L. Yang 3854, HKAS

43003, isotype HMAS 83551. Paratypes: CHINA. Heilongjiang, Yichun, 6 IX 1989, on

the ground under mixed woods, J. Z. Cao 821, HMAS 83572; Xinjiang, VIII 1994, on

duff, J. Y. Wang 132, HMAS 69951 (filed as Otidea cantharella); Xinjiang, Jimsar, alt.

1700 m, 1 VII 2003, on the ground, W. Y. Zhuang & Y. Nong 4655, HMAS 83573; ibid.,

2VIII 2003, on cone of Picea sp., W. Y. Zhuang & Y. Nong 4670, HMAS 83574.

Notes: The fungus is characterized by its ear-shaped, yellow apothecia and shorter
ascospores 8.5-10.5(-11) x 5.2-7 um than those of Otidea onotica var. onotica
[(10—)12-13 x 5-6 (Dennis 1978), 12-14 x 6-7(-8) um (Kanouse 1949)]. Our 28S
rDNA partial sequence data (unpublished) also support its separation from O. onotica
var. onotica.

369

50 micron 36 micron

50 micron

Figs. 1-6. Otidea spp. 1-3. Otidea crassa (HMAS 83571): 1. Longitudinal section of apothecium.
2. Excipular structure. 3. Portion of hymenium showing asci and ascospores. 4-6. Otidea onotica
var. brevispora (HMAS 83551): 4. Excipular structure. 5, 6. Portion of hymenium showing asci and
ascospores.

Acknowledgements

The author would like to thank Prof. R. P. Korf and Prof. D. H. Pfister for serving as pre-submission
reviewers, Dr. Z. L. Yang for providing his own collection from Yunnan, Mr. Y. Nong for collecting
jointly the specimens used in this work, Mr. C. Y. Liu for providing information about Otidea DNA
sequences, and Ms. X. Song for making the sections.

Literature cited

Boudier E. 1905-1910. Icones Mycologicae. Tome II. Paris.

_ Breitenbach J, Kranzlin FE 1984. Fungi of Switzerland. Vol. 1 Ascomycetes. Luzern. [English
transl.]

370

Cao JZ, Fan L, Liu B. 1990. Some species of Otidea from China. Mycologia 82: 734-741.

Dennis RWG. 1978. British Ascomycetes. ed. 2. Cramer. Vaduz.

Dissing, H. 2000. Pezizales. In Hansen L, Knudsen H. (eds.). Nordic Macromycetes. Vol. 1.
Nordsvamp, Copenhagen.

Harmaja H. 1974. Flavoscypha, a new genus of the Pezizales for Otidea cantharella and
O. phlebophora. Karstenia 14: 105-108.

Harmaja H. 1976. New species and combinations in the genera Gyromitra, Helvella and Otidea.
Karstenia 15: 29-32.

Kanouse BB. 1949. Studies in the genus Otidea. Mycologia 41: 660-677.

Kirk PM, Cannon PE, David JC, Stalpers JA (eds.). 2001. Ainsworth & ate Dictionary of the
Fungi. Edition 9. CAB International, Surrey UK.

Korf RP, Zhuang WY. 1991. A preliminary discomycete flora of Macaronesia: Part 15, Terfeziaceae,
and Otideaceae, Otideoideae. Mycotaxon 40: 413-433.

Kutorga E. 2000. Mycota Lithuaniae. Pezizales. Bot. Inst., Vilniaus Univ. Vilnius. (in Lithuanian)

Nannfeldt JA. 1966. On Otidea caligata, O. indivisa and O. platyspora (Discomycetes Operculatae).
Ann. Bot. Fenn. 3: 309-318.

Otani Y. 1969. Some species of the genus Otidea collected in Japan. Trans. Mycol. Soc. Japan
9:101-108.

Saccardo PA. 1889. Sylloge Fungorum. Vol. 8. Saccardo. Padova.

Saccardo PA. 1913. Sylloge Fungorum. Vol. 22. Saccardo. Padova.

Teng SC. 1963. Fungi of China. Science Press. Beijing. (in Chinese)

Thind KS, Waraitch KS. 1974. The Pezizales of India —- XIII. Proc. Nat. Acad. Sci. India 44(B):
13-21.

Velenovsky J. 1934. Monographia Discomycetum Bohemiae. Pragae.

Zang M (ed.). 1996. Fungi of the Hengduan Mountains. Science Press. Beijing. (in Chinese)

MYCOTAXON

Volume 94, pp. 371-391 October-December 2005

Book reviews and notices

Compiled by

Davip L. HAWKSWORTH?

MycoNova, The Yellow House, Calle Aguila 12,
Colonia La Maliciosa, Mataelpino
ES-28492 Madrid, Spain.

General

Mycelium Running: How Mushrooms can help Save the World. By Paul

Stamets. 2005. Ten Speed Press, Box 7123, Berkeley, CA 94707, USA. Pp. x + 339, figs
BO0, ISBN 1953008 579 25 Prices US'S'35.

This book by Paul Stamets, an entrepreneur and fellow fungus chauvinist, is not
a systematic text, but is mentioned here as it is something that helps promote the
importance of mycology in ecological processes and human settings. He draws
parallels of mycelial networks with the internet, and stresses the potential of fungi
in mycofiltration, mycoforestry, mycoremediation, and as mycopesticides. All this
is written with a racy style and well-illustrated by colour photographs and drawings.
The next two thirds of the book is devoted to the cultivation of mushrooms, and their
nutritional and medicinal properties -- including many references to original sources. In
summary, a great book to direct someone to who is unsure why on earth anyone should
take an interest in mushrooms. A limited edition of 200 individually numbered, signed,
boxed and hardbound versions is also available at US $ 195.

Biodiversity of Fungi: Their Role in Human Life. Edited by Sunil K. Deshmukh
& Mahendra K. Rai. 2005. Science Publishers, Enfield, P. O. Box 699, NH 03784,
USA. Pp. 461. ISBN 1 57808 368 0. Price: £ 48.40.

This volume comprises a hotchpotch of 18 chapters, some of which do emphasise
biodiversity, others do concern their impact on the human environment, and some.
manage both at the same time. How some chapters, e.g. ‘Fungal protoplast technology,
fall under the umbrella title is not immediately obvious. The book is certainly a ‘curate’s
egg, good in parts. Elizabeth Arnold's ‘Diversity and ecology of fungal endophytes in
tropical forests’ was a highlight.

‘Books for consideration for coverage in this column should be mailed to the Book Review Editor
(address above) in the first instance. Fax (+34) 91 857 3640; e-mail: myconova@terra.es.

O72

Gunde-Cimarmans et al. “Halotolerant and halophilic fungi, Deshmukh & Kushwaha
‘Keratinophilic fungi on birds and their ability to decompose keratin, Wasser & Didukh’s
‘Mushroom polysaccharides in human health care, and Maldonades & Ibarra’s ‘Organic
dyes from fungi and lichens’ truly embraced the diversity theme. There are also useful
chapters on the potential of ligninolytic basidiomycetes to degrade organopollutants,
and on metal bioremediation (but why the latter needed three chapters I do not know).

There seems to be an increasing number of books that lump a set of loosely related
chapters together under a catchall title, with the assumption that this provides a valuable
contribution to the literature. Sadly, more often than not it does not work. Multi-author
books need to provide more than the sum of the individual parts. This book is reasonably
priced, but I will not be recommending it for purchase by the library.

LYNNE BoODDY
Cardiff School of Life Sciences, Main Building,
Park Place, Cardiff CF10 3TL, UK

Fungi in Forest Ecosystems: Systematics, Diversity, and Ecology. Edited
by Cathy L. Cripps. 2004. The New York Botanical Garden Press, 200" Street and
Kazimiroff Boulevard, Bronx, New York, NY 10458-5126, USA (e-mail: nybgpress@nybg.
org). Pp. xvi + 363. [Memoirs of the New York Botanical Garden Vol. 89.] ISBN 0 89327
459 3. Price: US $ 68.

This volume has been prepared as a tribute to Orson K. Miller Jr, 75 years young in
2005. Following a detailed, well-illustrated’, and at times somewhat light-hearted life
history, there are lists of theses prepared under his direction, new scientific names he
has introduced, and a bibliography of his publications. The original papers contributed
mainly by close friends and colleagues are placed in three groups: Systematics, Diversity,
and Ecology. Those on systematics include ones on Amanita subgen. Lepidella,
Crepidotus, Entoloma, and Mycena, between them with descriptions of 17 new species,
mostly macromycetes. The diversity chapters cover different groups of fungi in areas
from Papua New Guinea, through the European alps and Israel, to Oregon and the
southern Appalachians. The contributions in the ecology group mainly concern
ectomycorrhizas or wood-decay fungi. There are some fascinating items amongst the
papers, from the relation of Phellinus pini to red-cockaded woodpecker cavity trees
to macrolichen distribution patterns in the Montana and Yellowstone and Glacier
National Parks, and an intriguing winter-fruiting helotialean anamorph (Cadophora
hiberna sp. nov.). This is a work that all mycological libraries with a macromycete focus
should endeavour to acquire, not least for its compilations of information on Orson’s
outstanding contributions.

Fungi: Experimental Methods in Biology. By Ramesh Maheshwari. 23 June
2005. CRC Press, Taylor & Francis Group, 6000 Broken Sound Parkway NW, Suite 300,
Boca Raton, FL 33487-2742, USA. Pp. xii + 240. [Mycology Series Vol. 24.] ISBN 1
57444 468 9. Price: US $ 149.95, £ 85.

"I especially liked the photograph of Orson at the microscope under the caption “Girl Scout
Leader”.

BYE

While the subtitle might lead to the expectation that this was a hands-on book on
methodologies, it is actually a textbook that arose from the teaching of graduate students
in biochemistry in Bangalore. Those students would have clearly been especially favoured
to have had such an exposure to mycology, but sadly much seems to be tailored to such
students’ perceived needs rather than providing a balanced introduction to the subject.
The book is divided into six parts and an appendix. These address: The unique features
of fungi (2 chapters), Integration of fungi with other organisms (2), Model fungi in
research (4), Gene manipulation in fungi (1), Adaptations (3), and Populations (2). It
would not be pertinent to consider these sections in depth in Mycotaxon, but I have to
say that I was frankly aghast at the appendix on Naming, defining and broadly classifying
fungi. Most of the appendix consists of crude illustrations evidently scanned from poor
quality Xerox copies of earlier works, incorrectly uses subphylum terminations (i.e. *-
mycotina) for the main groups labelled as at the rank of phylum (names in which have
the termination ‘-mycota). Then, to compound matters, the author recognizes ‘phylum
Deuteromycotina (Fungi Anamorphici)! Just how out of touch can an author be with
current thinking? The 2001 edition of Ainsworth & Bisbys Dictionary of the Fungi is
cited at the end of the appendix, but clearly has not been taken note of.

Further, in the main body of the work, to find no detailed consideration of molecular
phylogenetic approaches is almost unbelievable for a work with a 2005 date - there
is only one tree from a paper of the author's from 2002 on Indian Neurospora strains
accompanied by a mere 15 lines of discussion. Even with all the exciting current
experimental work, mycorrhizas get a mere seven pages, and the part on interactions
with other organisms does not have anything on insect-fungus relationships or medical
aspects. There is even no treatment of endophytic fungi which I would have expected
biochemistry students to want. In addition, there are numerous mistakes and out of date
information in other sections, and I fail to see why the same photographs have been
included twice in some cases, once in black and white and once in colour (e.g. Fig. 3.5,
also not named in the legend, but probably Caloplaca thallincola growing on Verrucaria
maura).

This is a stain in an otherwise really splendid series, and neither the text nor the figure
quality can have been critically reviewed prior to publication. This is sad as the series
would have benefited from counting a rounded text amongst its volumes, especially as
there is still a shortage of authoritative introductions to the subject. Fortunately, the
price of the book should prevent most students’ having access to a copy.

Revue du Cercle de Mycologie de Bruxelles. Numéro 1. September 2001. Cercle
de Mycologie de Bruxelles, c/o Yolande Mertens, Tomberg 116 bte 12, B-1200 Bruxelles,
Belgium. Pp. 52. ISSN not indicated. Annual membership: 12.50 €.

This new journal is mentioned here as it is full of systematic papers, rather than just
excursion reports and notes on interesting finds. And it deals no just with macromycetes.
The first number has five original papers which concern, Amanita vittadinii, Caloscypha
fulgens, Podospora conica, Puccinia albescens, and Sarcoscypha jurana. The second, issued
in 2002, includes systematic contributions on Ascobolus degluptus, Cordyceps (with a
key to 14 species and distribution maps), Discinella lividopurpurea, Gymnosporangium
sabinae, and a key to long-stalked Inocybe species based on spore characters. Where

374

there are field meeting reports, these include notes on the features of interesting species.
Colour photographs illustrate most articles. The journal is edited to a high professional
standard, should be in all major mycological libraries, and merits coverage in abstracts
databases.

Encyclopedia of Fungi of Britain and Europe. By Michael Jordan. 2004.
Revised edn. Frances Lincoln, 4 Toriano Avenue, London NW5 2RZ, UK. Pp. 384,
numerous col. photographs. ISBN 0 7112 2378 5 (hardback), 0 7112 2379 3 (paperback).
Price: £ 27.50 (hardback), £ 15 (paperback).

When this work first appeared in 1995 it was warmly welcomed by the amateur
mycological community because of its excellent colour photographs and concise
descriptions. As in all identification guides covering a wide range or fungi, there were
invariably some errors in the applied names, and this led to some most unfortunate
and disproportionate published criticisms and dissociations (e.g. Emmett 1996; Henrici
1996). It is always hard for someone without the resources of a major institution behind
them to produce such a major work, and such texts have to be seen in that context. For
this revised edition, the author has endeavoured to address the criticisms and updated
about 60 photographs and replaced or relocated some eight that were wrongly named.

The fungi are arranged by major group, and while “Aphyllophorales” and
“Gasteromycetes” appear as categories for practical reasons, I was very pleased to see
these names in inverted commas and the correct disposition of genera provided (e.g.
Lycoperdon in Agaricales).

While the focus of the book is the photographs and descriptions, there are also
helpful introductory chapters with notes on nomenclature, collecting, photography,
chemical tests and conservation, as well as a colour chart and glossary. There is also a
key and bibliography, although the latter sadly has not been updated and no post-1993
works included: further, Ainsworth & Bisby’s Dictionary of the Fungi is given as “1986”,
ignoring the 1995 and 2001 editions.

Interestingly for a book aimed at amateur mycologists and mycophagists, English
common names are generally omitted, as “for the vast bulk of fungi the Latin name is
the only acceptable option” — I concur.

With so many fine photographs and at such a reasonable price in paperback, this
revised edition will do much to promote serious mycological studies amongst the
amateur community, those who are the key to the much deeper understanding of
macromycete distribution and ecology that is so badly needed.

This is a fine achievement on which the author and publisher are to be congratulated,
and those that might wish to pinprick from advantageous standpoints need to stand
back and see the work in context. I did not consider it appropriate so to do, and look
forward to a succession of future editions.

Emmett, E. E. (1996) A disclaimer. Mycologist 10: 95.
Henrici, A. (1996) The Encyclopedia of Fungi. Mycologist 10: 183.

6 Sie)

Die Pilzflora des Ulmer Raumes. By Manfred Enderle. 2004. Manfred Enderle,
Am Wasser 22, D-89340 Leipheim-Riedheim, Germany (e-mail: manfred.ender. Pp.
521, illustrated. ISBN 3 88294 336 X. Price: 24.50 €.

This beautifully presented and personal work aims to document the range of fungi so
far found in the Ulm area of Baden-Wiirttemberg in Bavaria, Germany. After a short
but clear and well-illustrated introduction to what fungi are and characters used in
macromycete identification, a detailed history of fungus exploration in the area follows.
The first records go back to 1728, but the account goes through to document the activities
of the local mycological society, the Arbeitsgemeinschaft Mykologie Ulm (AMU)
founded in 1976, including data in publications and the personalities involved. There
are also lists of localities with MTB grid square references, and sections on geology, soils,
climate, and vegetation types — the latter with lists of species frequent in or characteristic
of them within.

The core of the book is the species lists, which cover slime moulds, and straminipilous
fungi as well as asco- and basidiomycetes. Sadly, a category Fungi imperfecti is retained,
which for some inexplicable reason includes zygomycetes, and lichen-forming fungi
are not covered at all. The total number of species treated is given as 2681 species,
plus 72 that are unclear or partly described taxa. Most have been collected over the
last 40 years, and detailed information is provided on localities, hosts, and for rarer
species specific collections with date, collector, place where voucher material is held,
or literature reference. Author citations are provided, but unfortunately do not follow
those recommended by and used in the Index fungorum database - and there are
inconsistencies in how the same author is abbreviated.

Fine colour photographs and line drawings are scattered throughout the body of the
text, and in some cases full morphological and microscopical descriptions are provided,
especially for species that either are in the Red List or described from the region. Critical
collecting over an extended period has led to the discovery of a considerable number of
novel taxa in the area, and a list of the 43 new scientific names introduced by the author
over the years is provided (pp. 64-65). Further, several new taxa are introduced in the
book: two new species of Coprinus s. lat., a new variety of Hebeloma vaccinium, and a
new combination for a form of Tricholoma vaccinum.

There are two separate sections of colour plates with integral descriptions at the end
of the systematic treatment: one for the 50 most edible species with the outside margins
of the pages with a green strip, and one for harmful ones with a red strip. The reference
list and full index is preceded by a most delightful 20-pages of half-tone photographs of
mycologists on excursions and in meeting rooms or laboratories. Not all are dated, but
those that are cover the period 1980-2003 and include many well-known mycologists,
several of whom are now dead. Additional snippets are ten rules for collectors, frequently
consulted works, and a glossary.

The acknowledgements list is extremely extensive and includes not only different
mycologists who have helped, but further several major companies in the region who
made financial contributions to the cost of publishing this book - resulting in the most
reasonable price for such a well-produced and lavishly illustrated local treatment.

a16

The author should feel well-satisfied with what is very much a testimony and personal
record of his four decades of collecting fungi in the Ulm region. It is a “must have” for
those working in the region!

Fungi of Northwestern China. Edited by Wen-Ying Zhuang. 2005. Mycotaxon,
P.O. Box 264, Ithaca, NY 1485-0264, USA. [Order from: Professor Wen- Ying Zhuang, P.
O. Box 2714, Beijing 100080, Peoples’ Republic of China (e-mail: zhuangwy@sun.im.as.
cn).] Pp. vi + 430, figs 5. ISBN 0 930845 14 5. Price: US $ 40.

The region covered in this compilation embraces Gansu, Ningxia, Qinghair, Shaanxi,
and Xinjiang provinces, more than a quarter of the People’s Republic of China and
including desert areas such as the Gobi desert, grasslands, mountains, and plateaux.
In all, 3887 species.distributed through 759 genera are treated, including straminipiles,
lichen-fungi, and slime moulds. The data are presented as a series of 14 complementary
chapters prepared by different specialists, but the editor clearly has insisted on a standard
style, so that each entry includes a note on the host or substrate, provinces where the
species has been found, and information as to the source (i.e. to a reference collection or
publication). Especially helpful are the maps showing collecting sites in each province.

All chapters start with an overview of the study of a particular group in China, and
there are comprehensive indices at the end by both host and fungal taxon. This is clearly
an important regional synthesis, and will also be an aid to identification through the
host index, but very many more species are to be expected. That the text is in English
and with extensive references to the literature in Chinese is a real bonus for non-
Chinese speakers, making otherwise inaccessible data available. My one frustration is
the continual citing of authors of hosts names in the text that have surely never been
verified by the authors. Further, abbreviations used for the authors of fungal names are
inconsistent, sometimes even within the same chapter.

The work is a complement to Higher Fungi of Tropical China (Zhuang 2001; reviewed
in Mycotaxon 87: 493-494, 2003), and it is to be hoped that in due course it will be
followed by parallel treatments of the remaining regions of China.

Zhuang, W.-Y. (2001) Higher Fungi of Tropical China. New York: Mycotaxon.

Fungi of the Antarctic: Evolution under Extreme Conditions. Edited by G.
Sybren de Hoog. 2005. Centraalbureau voor Scvhimmelcultures, P. O. Box 85167,
3508 AD Utrecht, The Netherlands (e-mail: info@cbs.knaw.nl). [Studies in Mycology
No. 51.] Pp. vii + 79. ISBN 90 70351 55 2. Price: 40€.

‘The two systematic monographs that comprise volume 51 of Studies in Mycology provide
an outstanding introduction to the world of non-lichenized fungal life under extreme
Antarctic conditions. Both groups of fungi are poorly understood, but the results
reported in these articles indicate they constitute a substantial part of the microbial
diversity of these habitats. I much appreciate the inclusion of both reviews in the same
volume since despite the very different strategies of the fungi involved, they share the
ability to withstand the harsh conditions of the Antarctic desert, providing new insight
into the limits of fungal life. At the end of each article, the authors provide hypotheses
for the evolution of the fungal groups treated.

Fungi at the edge of life: cryptoendolithic black fungi from Antarctic desert (L.
Selbmann, G. S. de Hoog, A. Mazzaglia, E. I. Friedmann and S. Onofri): The authors
present an extensive treatment of Antarctic cryptoendolithic communities. These fungi
of diverse phylogeny colonize rock cavities and thus avoid the inhospitable conditions
of the rock surface. The article starts with an introduction in which the ecological niche
of these fungi is described, along with some of their morphological and physiological
characteristics. This is followed by a detailed description of the sampling sites and the
methods employed in the study. The results include light microscopy and scanning
electron microscopy descriptions of twenty-six strains of black, mostly meristematic,
fungi from cryptoendolithic lichen-dominated communities of Antarctica, and the
sequencing of their ITS rDNA region. The phylogenetic positions of these different
strains and their survival strategies are discussed, and the new genus Cryomyces is
introduced for two newly described species. A further new species of Friedmanniomyces
is also named here.

- Evolution, taxonomy and ecology of the genus Thelebolus in Antarctica (G. S. de Hoog,
E. Gottlich, G. Platas, O. Genilloud, G. Leotta and J. van Brummelen): These authors
report a high frequency of Thelebolus species in Antarctic “biomats” from several types
of lake, and offer an explanation for this based on bird vectors. A short introduction to
the genus is followed by a description of the sampling sites and methods used to sample,
isolate, and analyze strains, and herbarium collections. The results include an extensive
molecular analysis aimed at resolving the phylogeny of this adapted group of cup fungi
using different methods, including microsatellite fingerprinting and the sequencing of
several genes. Phylogenetic relationships, taxonomic positions and the evolution of this
genus are discussed in the light of SSU and ITS rDNA and f-tubulin sequence data.
The article ends with a taxonomic section, which includes a key for the morphological
identification of the four species described, two of which are described as new to science
and appear to be endemic to Antarctica.

ASUNCION DE LOS Rios

Instituto de Recursos Naturales

Centro de Ciencias Medioambientales
Serrano 115dpdo, , Madrid-28006, Spain

Basidiomycetes

Les Réactifs Mycologiques. Vol. 2. Les Réactifs Microchimiques. By Jacques
Charbonnel. 2004. Edition Jean-Claude David-Rogeat, Rue Général Dufour 131, CH-
2502 Bienne, Switzerland (e-mail: info@mycologie.ch). Pp. 289. ISBN 2 9700411 0 2.
Price:(50 €.

This is the second part of Aide pratiques a létude microscopique des Champignons and
follows a long French tradition for the use of chemicals in macromycetology, from
Bataille to Josserand and Henry et al. Indeed 36 mycologists experienced in this field are
thanked in the opening pages.

There are seven chapters, the first setting out the aims of the compilation, an
introduction, abbreviations used therein, etc., and incorporating a preface by Francis

378

Quirin, President of the French Mycological Society. The next chapter tabulates the
reagents, formulae, etc., which will be found in the pages which follow.

The largest part of the publication, 214 pages in all, brings together the reactions
resulting from a specified, described and documented reagent when applied to a
particular tissue or structure. For each case, where appropriate and possible, the same
arrangement is used in the presentation so that direct comparisons can be made for
the procedure and the reaction found in the same tissue in different reagents. Chapter
4 is particularly helpful because it deals with the application of selected chemicals to
dried material, and in the following chapter discussion is focused on Russula, a genus in
which chemicals have been used extensively in its systematics. The methods by which
the reagents are made-up and applied are clearly given. Chapter 6 deals with naturally
occurring pigments and their distribution within the sporomes. It is admirable that
the author covers all the main groups of fungi when considering how to deal with the
specimens in hand and their chemical characteristics.

A cross-referenced index follows, which is extremely helpful, especially as it cites
the various species of fungi, or the genera which are mentioned under each reaction.
The format for the whole publication parallels papers in Documentes Mycologiques, a
journal in which Charbonnel regularly publishes. This is an excellent publication which
will be of very great help to those undertaking this kind of work, and students should be
encouraged to utilise the contents as the tests have a significant role to play in areas not
attainable by so-called cutting edge science!

But for would-be readers, I suggest that on purchasing a copy it should be immediately
rebound with a firmer spine, otherwise the pages will soon dismember.

Roy WATLING
Caledonian Mycological Enterprises, Crelah,
26 Blinkbonny Avenue, Edinburgh EH4 3HU, UK

Frontiers in Basidiomycote Mycology. Edited by Reinhard Agerer, Meike
Piepenbring & Paul Blanz. 2004. IHW Verlag, P.O. Box 119, D-85378 Eching,
Germany (e-mail: dr.schmid@ihw-verlag.de). Pp. 430, figs 124, col. pl. 80. ISBN 3
DOOLOTEDy oer TiCe. Elores

Despite several requests to the publishers, no copy has been received. This implies that
the publisher does not consider that the work merits coverage in Mycotaxon.

Cortinariales. By Vincentas Urbonas. 2005. UAB ‘Valstieciy Laikrastis, Vilnius,
Lithuania. [Available from Institute of Botany, Zaliyjy ezery 49, LT-08406 Vilnius 21,
Lithuania. Pp. 288, figs 118, col. plates 32. [Mycota Lithuaniae Vol. 8 (5).] ISBN 9986
$47,390 .Price:23.G,

This work is part of a series of books dealing with the mycobiota of Lithuania. It is
written in Lithuanian, but contains a seven page long English summary with keys to the
included genera. .

In this book, the Cortinariales are subdivided into two families, Cortinariaceae and
Crepidotaceae, and in total 291 species belonging to 13 genera assigned to these families
are described. Keys are provided for all included species, but they are difficult to use

for people who do not know Lithuanian. The genera and numbers of species covered
are: Cortinarius (124 spp.), Crepidotus (14), Galerina (27), Gymnopilus (12 ), Hebeloma
(30), Hebelomina (1), Inocybe (65), Leucocortinarius (1), Naucoria (X), Pellidiscus (1),
Phaeocollybia (3), Rozites (1), and Simocybe (4). Cortinarius is subdivided into five
subgenera: Cortinarius (12), Dermocybe (12), Myxacium (10), Phlegmacium (37), and
Telamonia (53). Hebeloma is divided into subgenera Denudata (18) and Hebeloma
(12). Galerina is subdivided into subgenera Phaeogalera (24) and Galerina (3). And
subgenera Inocybe (19) and Inocybium (46) are used for Inocybe species.

Basionyms, important synonyms, and iconography are provided for all included taxa.
The nomenclature follows Index Fungorum, but is not always up to date. For example,
Rozites is treated as a distinct genus, and the species epithet of Cortinarius harcynicus
is given as ‘hercynicus. Drawings of spores or other important microscopical structures
are provided for selected taxa only, but they are more raw outlines than informative
line drawings. An index of scientific names enables the reader to easily find all included
taxa. The reference list includes a few interesting recent Lithuanian publications, but
otherwise mainly includes publications up to the nineties; and more recent treatments
(or iconography) of the included genera have not been considered in this work. The
appendix of 32 colour plates provides either drawings or photographs of 163 of the
species treated in the book. The colour drawings of the basidiomes are usually quite well
done; but the quality of the photographs varies from quite good, to others which are out
of focus or do not show the important features of the fungus. However, most pictures are
supplemented by a line drawing.

In summary, this book is the first, well-investigated inventory of the cortinarioid
fungi occurring in Lithuania. Those who understand the language will also find
it a useful aid to the identification of fungi in Lithuania and surrounding countries,
especially because pictures and line drawings are given in the same volume. Thus, it
can be expected that with increasing sampling, the number of fungal species in this
order known from Lithuania will rise. Consequently, in spite of a few shortcomings,
this book will certainly help Lithuanian mycologists to study the brown-spored fungi of
their beautiful country much more easily.

URSULA PEINTNER
Institute for Microbiology, Leopold Franzens University Innsbruck,
Technikerstrasse 25, A-6020 Innsbruck, Austria

Checklist of Polish Larger Basidiomycetes. By Wtadystaw Wojewoda. 2005
[“2003”]. [Biodiversity of Poland Vol. 7.] W. Szafer Institute of Botany, Lubicz 46, PL-
31-512 Krak6ow, Poland (e-mail: ed-office@ib-pan.krakow.pl). Pp. 812, fig. 1. ISBN 83
89648 09 1. Price: 58 €.

This is a welcome addition the literature of macromycetes of Europe. In the ninth
edition of Ainsworth & Bisby’s Dictionary of the Fungi (Kirk et al. 2001) works on the
macromycetes of this continent were mentioned for Bulgaria, former Czechoslovakia,
Denmark, France, Great Britain, Greece, Italy, Scandinavia, Spain, Sweden and
Switzerland. However, Poland, the eighth largest country of Europe in area, was
omitted.

380

The checklist of Polish larger basidiomycetes includes about 400 genera and 2650
species, although some of the listed names are invalid or otherwise contrary to the Code.
The true number of nomenclaturally correct larger basidiomycete taxa known from
Poland is actually about 2550.

Over 2100 species of agaricoid and boletoid fungi (Moser 1983) and about 2000
species of aphyllophoroid, gasteromycetoid, tremelloid, auricularoid, dacryomyceteoid
and tulasnelloid fungi (Jiilich 1984) are known in Europe. According to Wojewoda,
these numbers are certainly too low and many more fungi occur in Europe. In the
former German Federal Republic, 3150 species of basidiomycetes (Krieglsteiner 1991)
were known through 1991, about a thousand more than the number known in Poland
in 2003. Because Poland and the western part of Germany are comparable in terms of
area, climate and nature preservation, a similar number of species might be expected
to grow in Poland. In the years to come, Polish mycologists face the important task of
finding these fungi.

Wojewoda includes data on threatened species compiled from the Red List of
Threatened Macrofungi in Poland. To enable the data to be compared with information
on threatened fungi in other European countries, categories of threat from the following
countries are cited: Austria, Belgium, Bulgaria, Czech Republic, Estonia, Finland,
Germany, Great Britain, The Netherlands, Lithuania, Latvia, Norway, Switzerland and
Sweden.

The Polish names of the fungi given are derived from many authors of papers
published between 1830 and 2003. The habitats in which the fungi grow, the plant
community, substratum, mode of nutrition and fruiting time are detailed. Examples of
species distribution in Poland, including the regions, form the most extensive part of the
account of each species. For some very rare species, all or nearly all sites are given, while
for fairly common species only selected sites are cited. For very common and common
one (except a few like Phallus impudicus and Langermannia gigantea) no sites are given.
Readers and all users of this new checklist can only congratulate the author on seeing
the book published after 14 years of work.

Kirk, P.M., Connon, P.F., David, J.C., & Stalpers, J. (2001) Ainsworth & Bisbys Dictionary of the
Fungi. 9 edn. Wallingford: CABI Publishing.

Moser, M. (1983) Die Rohrlinge und Blatterpilze (Polyporales, Boletales, Agaricales, Russulales). In:
H. Gams (ed.) Kleine Kryptogamenflora II b/2: Basidiomycetes. 2. Teil 5., bearbeitete Aufl. VEB.
Jena: G. Fischer.

Jiilich, W. (1984) Die Nichtblatterpilze, Gallerpilze und Bauchpilze. Aphyllophorales,
Heterobasidiomycetes, Gasteromycetes. In: H. Gams (ed.) Kleine Kryptogamenflora II b/1
Basidiomyceten I. Stuttgart: G. Fischer.

Krieglsteiner, G. J. (1991) Verbreitungsatlas der Grosspilze Deutschland (West.). Vol. 1. Standerpilze.
Teil A. Nichtblatterpilze. Teil B. Blatterpilze. Stuttgart: Verlag E. Eugen, Stuttgart, pp. 421-
1016.

BRONISLAW ZYSKA
Wolnosci Street 47/1, 41-500 Chorzow, Poland

381

Guia de los hongos de Alcala de Henares (Macromicetes). By Michel
Heykoop Fung-a-You & Rosa Antolin Bellver. 2005. Servicio de Publicaciones,
Ayuntamiento de Alcala de Henares, Concejalia de Medio Ambiente, Instituto de
Planificacién y Gesti6n Ambiental, Quinta de Cervantes, Calle Navarro y Ledesma 1,
Alcala de Henares, Madrid, Spain. Pp. 120, col. plates. ISBN not indicated (Dep. Legal:
M-52838-2004). Price: Free while stocks lasts.

This amazing guide, completely financed by the local authority of Alcala de Henares,
the city where Cervantes lived part of his life in Spain, is an example of how local
administrative bodies can promote interest in fungi, as a part of their broader concerns
for nature and its conservation, and considering organisms as part of the area’s natural
heritage. It provides a concise history of mycological studies in the area, a catalogue
that describes 65 species beautifully illustrated by coloured paintings rom the 200
known from Alcala de Henares. It comprises seven chapters, some of which are brief
introductions as to what a fungus is, habitats where they grow, fungal interactions
with other organisms, the importance and applications of fungi, fungal classification,
and characters of macromycete fruit bodies, as well as a key for the 65 species treated
in the guide. Chapter 7 provides scientific and common names (where they exist),
macroscopic descriptions, detailed drawings of the species (the second author, Michel's
wife), and observations on their culinary or toxic properties, medicinal fungi, and fungi
of industrial interest. A basic glossary of scientific terms is provided, as well as an index
to the species. A three-week exhibition of the original paintings in a hall close to the
town centre was also staged in April-May 2005. This is useful book for amateurs, and
all interested in fungi from this area, combining identification with sound information
on the broader relevance of fungi. The initiative in making such a work available free
of charge is a model that I would like to see followed by many other local authorities
worldwide. |
TERESA ITURRIAGA
Departamento biologia de Organismos, Universidad Simon Bolivar
Apartado 89000, Sartenejas, Baruta, Edo. Miranda, Venezuela

Palearctic Lyophyllaceae (Tricholomatales) in Northern and Eastern Europe
and Asia. By Kuulo Kalamees. 2004. Estonian Academy Publishers, Tartu, Estonia.
[Scripta Mycologica No. 18.] Pp. 135, figs 32, maps 3. ISBN 9985 50 356 2. Price: Not
indicated.

This book presents a survey of the taxonomy, ecology and distribution for most of the
genera in family Lyophyllaceae sensu Bon 1999 from the Palearctic regions of Europe
and Asia: Lyophyllum s.str., Hypsizygus, Gerhardtia, Calocybe s. str., Tricholomella,
Rugosomyces, and Asterophora are treated in detail but the genus Tephrocybe is not
considered. The book is divided in two parts: an introductory part (pp. 5-15) and a
taxonomic part (pp. 16-105). The introductory part summarizes the actual state of
knowledge on family Lyophyllaceae, presents the significant taxonomic features used for
species determination, and the classification and the abbreviations used by the author.

382

The taxonomic part constitutes some kind of practical guide to the identification of
the Palearctic Lyophyllaceae, which is certainly not one of the easy agaric families as
pointed out by the author. The author provides a key to genera and species, species
descriptions illustrated by some line drawings of microscopical features (spores, basidia

and mycelium), clarifies differences in species concepts between mycologists, and adds ~

also valuable information about the distribution and ecology of the species. Ecology is
indeed very important but too often a neglected aspect in many revisions. Particularly
in the case of Lyophyllaceae, ecology may very well be one of the most important factors
underlying evolution since molecular studies have shown that all the classifications
proposed for the tribe Lyophylleae are artificial and that species sharing a mode of
nutrition cluster together.

The book is well edited and provides detailed macroscopic and microscopic
descriptions and well referenced discussions and comments. It is therefore all the more
deplorable that the quality of the illustrations is disappointing. The rather simplistic line
drawings often lack sufficient precision or detail (e.g. scales are not always respected,
as for the spores of L. loricatum), while in others being superfluous or not essential
for understanding or identification or not representative of the text (e.g. Rugosomyces
obscurissimus spores). The reader has the impression that the author considers
microscopic illustrations of secondary or no importance (even when a lot of collections
have been checked, as for example in the case of L. decastes, where one would expect
mature basidia instead of basidioles). As already very few morphological characters
are available to separate species in virtually all of the Lyophyllaceae, the illustration of
taxonomically significant microscopic features such as size, shape and ornamentation of
spores should be as detailed, precise and representative as possible. In my opinion, the
book would also have benefited from coloured pictures illustrating the species (in the
form of an annex for example) in addition to a list of often too inaccessible references to
most of the users of this type of monograph.

Talso regret that the discouraging nomenclatural chaos in Tephrocybe was apparently
responsible for its exclusion from this revision of Lyophyllaceae. Indeed, molecular
studies suggest that both Tephrocybe and Lyophyllum are polyphyletic. Exclusion of
either one results automatically in partial revisions of the species in several of the natural
groups within Lyophyllaceae. In that sense, the impact of this study is reduced, not only
as a taxonomic guide to Lyophyllaceae, but also as a useful tool for future revisions of the
more natural entities.

With the new insights of molecular systematics, a reappraisal of the morphology
of Lyophylleae in the context of a more natural classification of this fungal group will
hopefully soon emerge. It will facilitate the difficult task of the purely morphological
approach in Lyophylleae. Taxonomic studies as this one are really needed to help clarify
the nomenclature, morphology and ecology of this very difficult group of fungi, and this
book can therefore be considered as an important contribution to attaining this goal.

VALERIE HOFSTETTER
Verdonnet 32, 1010 Lausanne, Switzerland

383

Monograph of the genus Hemileia (Uredinales). By Anja Ritschel. 2005.
J. Cramer in der Gebriider Borntraeger Verlagsbuchhandlung, D-14129 Berlin,
Germany. [Bibliotheca Mycologica No. 200.] Pp. 132, pl. 8, figs 39. ISBN 2 443 59102 7.
Price: 44 €.

The work on this tropical fungal genus, known essentially for its parasitism on coffee,
but affecting at least ten families of angiosperms, has been conducted on herbarium
material, mostly from European herbaria, but also from ones in the USA and South
Africa. In many cases the descriptions rely on (very) old material, which is probably
caused by the absence of collectors, providing fresh samples, in the tropics. For some
species, no material was available to the writer. Descriptions were then gathered from
previous publications.

There is a pertinent discussion of the validity of the genus name and the afhliation
of Hemileia with the Chaconiaceae. The author keeps all species without a known
teleomorph in the anamorph genus Uredo. This concerns 17 of the 43 species described.
A new genus, Desmosurus is proposed. One new name, a new species, and some new
combinations are introduced. Doubtful and excluded taxa are mentioned.

Full attention is given to the formation of the sori, and two types, suprastomatal or
erumpent, are distinguished. The individual species descriptions are as complete as can
be, and include all the references needed. Urediniospore characters are congruent with
the host range and differentiate the species, and the author gives a key based on length
and echinulation of the urediniospores. For the species of Hemileia s. str., a description
of the teliospores is provided. The drawings of spores are very good and clear, and the
SEM photographs excellent.

The cited literature comprises 125 references. The last cytological study mentioned
is dated 1968, and two references concern molecular techniques, which were probably
not possible with the herbarium material available. Further work remains to be done in
that field.

This book is a valuable contribution to our knowledge of the genus, and will be
of great use for mycologists everywhere, and not only in the tropics. One species is
described from Japan, and another reported from orchids in heated greenhouses in
Europe.

ARTHUR VANDERWEYEN
Avenue Cardinal Micara 9, B-1160 Bruxelles, Belgium

Russulaceae: Lactarius. By R[onald] W. Rayner, assisted by R[oy] Watling &
E[lizabeth] Turnbull. 2005. Royal Botanic Garden, 20A Inverleith Row, Edinburgh
EH3 5LR, UK (e-mail: pps@rbge.org.uk). [British Fungus Flora Vol. 9.] Pp, 203, figs 200.
ISBN 1 872291 34 1. Price: £12.50

This ninth number in the agarics and boleti series documenting the British fungi treats
Lactarius in the Russulaceae. It is presumed that Roy Watling and Elizabeth Turnbull
brought the compilation together for publication after the passing of “Ronnie” Rayner,
although this is not mentioned in the publication. An item that appeared early on in the
series and is included with this number is that of the trifold colour identification chart.

384

This chart will be repeatedly consulted for determination of spore colour in mass as well
as other colours described for the basidiomes.

The overall treatment of Lactarius follows the same general scheme presented in
previous issues of this series with introductory text, references, family description, a
generic key to just Russula and Lactarius with a note that sequestrate representatives
are to be keyed elsewhere. Lactarius is then treated in detail with a description and
discussion of features (including useful macrochemical reagents) in the genus
followed by a key to seven sections, diagnostic synopses of the sections, the systematic
arrangement (essentially that of Singer's fourth edition with some minor rearrangement,
and incorporating Hesler and Smith’s treatment of sect. Tristes). This is followed by a
complete dichotomous key to the 64 species. A handful of varieties are also treated.
Although key to sections is provided, a key to species in each section (and subordinate
subtaxa) is lacking.

The individual descriptions of species occupies the bulk of the publication and
these are quite complete with attention to the details of fresh macroscopic appearance,
macrochemical reactions, and important microscopical features, describing spores,
hymenial cystidia and the pileus surface. The ecological habitat, phenology and
distribution in Britain follow the description along with a commentary on distinctive or
odd features and comparisons to like taxa. On a rare occasion, mention is made of the
taxon as it might occur outside of Britain. In addition, some general synonymy is given
along with citation of illustrations (icones) representing well the British species.

The descriptions are followed by a listing of species according to ecological preference
such as: in oak woods, with ash, with Betula nana, on calcareous soils to name just a
few. Some species are mentioned more than once in this list. There are further lists
of synonyms and misidentifications, rejected names (and why rejected), an index to
epithets mentioned in the commentaries, and lastly the index to described species. The
last 65 pages of 203 are given over to line illustrations of habit sketches and microscopic
features of spores, cystidia, and hyphal configurations making up the pileus surface.
These latter are relevant in a diagnostic sense as examples of taxa in particular sections.

It is noteworthy to mention that the descriptions are almost entirely based on
observation of fresh material, either collected by the author or given to him by several
individuals who are dutifully acknowledged.

For those who need to identify Lactarius species among the macromycetes in Britain,
users will find this treatment comfortably familiar to past treatments in the series as well
as thorough and well documented. The addition of the colour chart will be necessary
for colour determination but is also an added bonus and can be used with the previous
publications.

Roy E. HALLING

Institute of Systematic Botany
The New York Botanical Garden
Bronx, NY 10458-5126, USA

385
Ascomycetes

Discomycetes. Fasc. 1. Familiae Ascobolaceae (species coprotrophicae),
Iodophanaceae_ (species coprotrophicae), Ascodesmidaceae (species
coprotrophicae), Pezizaceae (species coprotrophicae), Pyrenomycetaceae
(species coprotrophicae), Thelebolaceae (species coprotrophicae). By V.
P. Prochorov. 2004. Oficina Editoria KMK, 123100 Moscow a/r 16, Russia (e-mail:
kmk2000@online.ru). Pp. 256, figs 148. [Definitorium Fungorum Rossiae.] ISBN 5
87317 136 X. [In Russian.] Price: not indicated.

This volume aims to provide a detailed account of the coprophilous pezizalean
discomycetes known from Russia. It treats 194 species disposed through 23 genera:
Ascobolus, Ascodesmis, Ascozonus, Caccobius, Cheilymenia, Coprobia, Coprobolus,
Coprotus, Dictyocoprotus, Dictyosporus, Fimaria, Hapsidomyces, Iodophanus, Lasiobolus,
Ochotrichobolus, Peziza, Pseudacozonus, Ramgea, Saccobolus, Thecotheus, Thelebolus,
Trichobolus, and Trichophaeopsis. ‘These are all listed here as only 11 of the genera are
named on the contents page. For each species, the place of publication of the accepted
name and any synonyms is provided (sometimes with a page-range not the actual page).
Descriptions of genera and species are detailed, keys are provided, there are references
to published illustrations, and especially welcome fine original line illustrations of
microscopic features -- covering three quarters of the included species. Notes on habitat
and frequency are very brief, and regions in Russia the species occur are sometimes
indicated, but not consistently; extra-Russian distributions are also summarized. The
work has evidently been in press for some years, as the latest reference cited is one of
the author's from 1996 and so seems a little dated in part, for example in not taking up
Pseudombrophila for the later synonym Fimaria. While this is no rival to Doveri’s Fungi
Fimicoli Italici (2004; see Mycotaxon 90(1): 220-221, 2004), it is a major achievement for
a mycologist who has only been publishing on these fungi since 1991, and does include
some species not treated in the Italian account. I will certainly find the illustrations of
value in trying to name minute coprophilous discomycetes.

Lichen-forming fungi

Lichens: An Illustrated Guide to the British and Irish Species. By Frank S.
Dobson. 2005. 5" edn. Richmond Publishing, P.O. Box 963, Slough SL2 3RS, UK
(e-mail: rpc@richmond.co.uk). Pp. 480, col. pls, maps. ISBN 0 85546 095 4 (hardback),
0 85546 096 2 (paperback). Price: £ 45 (hardback), £ 35 (paperback).

Each fresh edition of this book, the first of which was published in 1979, goes from
strength to strength. The number of species treated has increased from about 450 in
1979, to about 700 in the fourth edition of 2000 (reviewed in Mycotaxon 78: 510, 2001),
to about 850 in the fifth - approaching half of all the 1800 or so lichen-fungi known
from Great Britain and Ireland. Further, an increasing number are illustrated in colour
and crisper and more true-to-life than ever thanks to the use of digital photography.

The tried and tested format of keys that has been used so successfully by almost a new

386

generation of amateur lichenologists has been maintained, as has the basic layout of the
entries with the neat and now familiar distribution maps based on data in the British
Lichen Society’s Mapping Scheme. Unfortunately, the nomenclature follows the last
British checklist too slavishly, for example in the adoption of some of the segregates
proposed for parmelioid lichens for the first time after papers synonymizing several had
appeared, retaining Usnea subfloridana as distinct from U. florida, and not taking up
Xanthoria aureola for X. ectaneoides. In consequence there will be some discrepancies
from the new edition of the multi-authored The Lichen Flora of Great Britain and Ireland
currently in preparation. But these are small points. To produce one identification guide
is a major achievement for an amateur mycologist, but to be able to produce one in
five continuously improving editions over a period of 26 years is an unparalleled event
and a ‘first’ for lichenology. The impact that this title has had on developing expertise
in lichenology in Great Britain and Ireland over this extended period of time has been
immense, especially through its use on several field courses each year by its’ author and
other tutors. Lichenology owes Frank an immense debt.

Opredelitel? Lishainikov Rossii. Vol. 8. Bacidiaceae, Catillariaceae,
Lecanoraceae, Mycobilimbiaceae, Rhizocarpaceae, Trapeliaceae. By M. P.
Andreev, L. I. Bredkina, N. S. Golubkova, A. A. Dobrysh, Y. V. Kotlov, I. I.
Makarova, I. N. Urbanavichene & G. P. Urbanavichus. 2003. Nauka, St Petersburg,
Russia. Pp. 278, figs 93. ISBN 5 02 026044 4. Price: Not indicated.

Opredelitel’ Lishainikov Rossii. Vol. 9. Fuscideacae, Teloschistaceae. By A. Y.
Khododovtsey, S. Y. Kondratyuk, I. I. Makarova, & A. N. Oxner. 2004. Nauka, St
Petersburg, Russia. Pp. 340, figs 133. ISBN 5 02 026207 2. Price: Not indicated.

This series started publication in 1971 as Opredelitel’ Lishainikov SSSR, with ‘SSR’ being
replaced by ‘Rossii’ from volume six which appeared in 1996. I was pleased to see these
two recent volumes as no additions to the series had appeared since volume seven in
1998, and it would have been unfortunate if this ambitious project joined the ranks of
unfinished multi-volume projects. The style follows that of the previous volumes with
keys and detailed descriptions, but with more line and half-tone illustrations.

Volume Eight tackles a series of difficult families in which concepts are still being
worked out and in many cases await testing by molecular phylogenetic approaches.
But, at least the authors have endeavoured to follow the latest proposals, for example in
accepting Calvitimela (into which three new combinations are made). In some cases all
the species in a genus are not treated, for instance under Lecanora only the L. marginata/
L. sulphurea complex is covered. Volume Nine has been particularly awaited for its
treatment of Caloplaca and especially Xanthoria on which Sergey Kondratyuk and the
late A. N. Oxner worked for many years. The treatment of Caloplaca follows traditional
lines, and the account is particularly well-illustrated by line drawings. The authors’
approach to Teloschistes and Xanthoria, however is much more controversial with the
introduction of three new genera, none validly published here: Oxneria for the X. fallax
group (18 spp.), Rusavskia for the X. elegans group (11), and Xanthoanaptychia for the
Teloschistes chrysophthalmus group (5). Further, many more species are being accepted in
these segregate genera than are currently in use. There may be good molecular evidence

387

for such changes, but it would have been preferable to see the new evidence first and for
the scientific names and combinations to have been validly published elsewhere before
being utilized in an essentially floristic study.

As the series grows, it becomes increasingly difficult to check in which volume a
particular taxon is treated, and it would be great if in future that each volume had a
complete list of genera so far treated in the series with an indication in which volume they
were to be found. Treated families were listed in each part up to and including volume
six, which was a gesture in this direction, but even that was dropped in subsequent
volumes.

The Lichens, Lichenicolous and allied Fungi of Poland: An annotated checklist.
By Wieslaw Faltynowicz. 2003. W. Szafer Institute of Botany, Polish Academy of
Sciences, Lubicz 46, 31-512 Krakow, Poland (e-mail: ed-office@ib-pan.krakow.pl). Pp.
435, figs 1. [Biodiversity of Poland Vol. 6.] ISBN 83 89648 06 7. Price: Not indicated.

The tradition in which Polish records are synthesized is not only maintained but taken
to new heights in this new checklist. The previous checklist (Falttynowicz 1993) included
1500 lichenized and 119 lichenicolous fungi, and these totals have now swelled to 1554
and 214 respectively. But the 1993 list consisted only of the scientific names, with no
references as to sources let alone information on habitats and distribution. This one
has synonyms listed under the names, information on ecology and localities (down to
province), and literature references from the mid-nineteenth century on. Each genus
and species is also given a name in Polish, most coined here for the first time. But I
have to wonder if this is really worthwhile - especially in the case of the lichenicolous
fungi so named! ‘This is a landmark publication of synthesis on the Polish lichens and
lichenicolous fungi, on which the author has worked for over 25 years, and is the most
detailed checklist I have seen for some years for any country.

Faltynowicz, W. (1993) A checklist of Polish lichen forming and lichenicolous fungi including

parasitic and saprophytic fungi occurring on lichens. Polish Botanical Studies 6: 1-65.

Flora Liquenoldégica Ibérica: Ostropales: Graphidaceae, Solorinellaceae;

Gyalectales: Gyalectaceae. 2004. Sociedad Espafiola de Liquenologia, Murcia, Spain.
Pp. 48, figs 9, map 1. ISSN 1696-0521. Price: 10 €.

The first volume in this series dealt with the Peltigerales (see Mycotaxon 92: 492-493,
2004). This second volume covers somewhat disparate groups by different authors, but is
presented to the same high standards in both the descriptions and drawings. The plate of
ascospores in Gyalecta is especially fine. As the series builds it will become of increasing
value as a major work of reference.

Catalogue of the lichenized and lichenicolous fungi in Bulgaria. By Helmut
Mayrhofer, Cvetomir M. Denchev, Dimitar Y. Stoykov & Siyka O. Nikolova. 2005.
Bulgarian Mycological Society, c/o Institute of Botany, Bulgarian Academy of Sciences,
23 Acad. G. Bonchev Street, 1113 Sofia, Bulgaria (e-mail: denchev@bio.bas.bg). Pp. 59.
[Mycologica Balcanica 2: 3-61.] ISSN 1312-3300. Price: 19 €.

388

This paper is mentioned here as it was specifically submitted to Mycotaxon for review.
It is the first synthesis of information on the lichens of Bulgaria to have been published
since the flora of Popnikolov & Zhelezova (1964). That work accepted 636 species and
included keys, descriptions, and many illustrations. This new checklist has almost 50%
more species, 893, of which a mere nine are lichenicolous and 14 non-lichenized fungi
traditionally studied by lichenologists. The list is based on 216 publications supplemented
by previously unpublished reports backed by herbarium material. Eighteen species are
reported from Bulgaria for the first time; some of the latter are rather widespread in
Europe (e.g. Lecanora saligna, Phylctis argena, Tuckermannopsis chlorophylla) and their
inclusion at such a late date is a witness to the scant attention lichenology in the country
has received. Species are arranged alphabetically and their sources are given, but without
any information on substratum or locality except in the case of new records for the
country. An impressive list of synonyms is included, with 1625 infrageneric epithets.
Hopefully, the availability of this new work will stimulate interest in lichenology in
Bulgaria.

Popnikolov, A. & Zhelezova, B. (1964) Lishei. [Flora na B”lgariya.] Sofia: Narodna
Prosveta.

101 Common Mosses, Liverworts & Lichens of the Olympic Peninsula. By

Martin Hutten, Karen Hutten & Andrea Woodward. [2001]. [US Government
Printing Office.] Pp. xi + 109, col. ISBN none. Price: US $ 9 [now out of print].

This delightful little spiral bound book, only 14.5 x 11.5 cm so it easily slips into a pocket,
seems to have escaped other listings of lichen literature. Bryophytes and lichens are
conspicuous even to the casual tourist in the high-rainfall parts of the Olympic Peninsula
in Washington State, USA. The annual rainfall is said to be higher in some parts of the
Peninsula than anywhere else in North America (600 cm p.a. plus), and pendent lichens
to over 2 m in length can be encountered. After the introductory matter, each species has
a full page almost half of which is a high-quality colour photograph, and the remainder
presents descriptive notes, information on size, and separation from similar species.
Altitudinal ranges are indicated by a vertical scale bar, and the species are grouped by
habitat (e.g. forest floor, log, conifer). In many case there are small inset photographs of
allied species that might be confused with those featured. The lichen pages have been
prepared to the highest standards, with critical material checked by Bruce McCune. The
production of the book was funded by several organizations including Cannon, The
Green Earth Campaign, National Park Service, US Geological Survey, National Park
Foundation, and the Northwest Interpretive Association; their vision in supporting such
an initiative to generate a low-price product is to be commended. I found the little book
very valuable in the field when encountering some of the endemic Pseudocyphellaria’s
for my first time on the Peninsula in October 2005, but after praising, recommending it,
and being presented with a copy by Maggie Rogers (Portland, Oregon), it emerged that
this little gem was already out of print. If you see one available second-hand do secure it,
even if just to sell one at a society auction.

389
Conidial fungi

Sporidesmium, Endophragmiella and related Genera from China. By Wenping
Wu & Wenying Zhuang. 2005. Fungal Diversity Press, Centre for Research in
Fungal Diversity, Department of Ecology and Biodiversity, University of Hong Kong,
Pokfulham Road, Hong Kong SAR, People’s Republic of China. Pp. x + 351, figs 152.
[Fungal Diversity Research Series no. 15.] ISBN 962 86765 8 X. Price: US $ 80.

The fungi formerly referred to Sporidesmium have been segregated into an increasing
number of genera over the course of the last three decades. The generic separations
have been based on methods of conidiogenesis and conidial secession, schizolytic
(Sporidesmium-type) or rhexolytic (Endophragmiella-type), and then by the septation
in the conidia, which can be eu- or distoseptate, or the form of the conidia. These fungi
had been little studied in China, indeed only one species of Sporidesmium is mentioned
in Teng (1996), S. polymorphum (a record apparently overlooked by the authors), but
Wu made around 300 collections in ‘the last few years: This book is a report of those
collections and does not include studies of material in HMAS (Beijing) or other Chinese
collections. This makes the results all the more impressive, as out of those collections
emerged 143 species in 25 genera, including one genus and 43 species new to science
(i.e. 30 % of those collected), and 16 new combinations. Further, 23 of the genera and 99
species proved to be first records for China.

The introduction includes comparative illustrations of the differences between the
genera, as well as a key, which is sure to be of value to all starting to get to grips with
the current generic concepts in the group. Very full descriptions are provided and there
are clear line drawings, mostly full-page, but no photographs. Photographs would have
been a valuable addition as it is not always clear what artistic licence has been taken in
adapting complex wall structures to drawings. In particular, incomplete septa are in
some cases illustrated between thickened distoseptate cells, with structures indicated
between some and not others. That may well be so, but photographs would have made
the situation incontrovertible. Also, there are strong similarities between the conidia
of some species placed in different genera, for instance the S. novozymium group
and Ellisembia bambusae, which even have similar gelatinous sheaths at their apices,
and I wonder how significant a complete as opposed to an incomplete septum really
is. It would be interesting to see a molecular phylogenetic study carried out on these
collections to address such issues.

Original places of publication are always given, but there is no indication as to
whether the type collections of already described species were examined. At least in
some cases the concepts seem to have been taken from publications of other authors.
With respect to the type specimens and ex-type cultures of the newly described species, I
was somewhat concerned to read that all the specimens studied including the types “are
preserved in Wu's mycological herbarium in Novozymes, China’, with living cultures
in the Novozymes collection. This is hardly in the spirit of the Code, and at least the
holotypes would have been better deposited in HMAS (Beijing).

Notwithstanding these concerns, there is no question that this work represents a
substantial contribution to our knowledge of these fascinating fungi, and that it has

390

been carried out with care and patience that is in the best traditions of studies of
dematiaceous hyphomycetes. With so many taxa covered, this work is set to become
the major international reference work on Sporidesmium and similar genera for many
years to come.

Teng, S. C. (1996) Fungi of China. Ithaca, NY: Mycotaxon.

Morphotaxonomic Revision of Fungicolous Cladosporium Species. By Bettina
Heuchert, Uwe Braun & Konstanze Schubert. 2005. Druckerei der Martin-Luther-
Universitat Halle- Wittenberg, Kréllwitzer StraBe 44, D-06120 Halle/Salle, Germany. Pp.
78, figs 26, plates 2. [Schlechtendalia Vol. 13.] ISSN 1436-2317. Price: 5 €.

With the nature of Cladosporium s. str. now clarified, the numerous species described
but whose affinities have not been reassessed in the light of current concepts need to be
revisited. Here, this task is undertaken for the fungicolous (including the lichenicolous)
species. Most fungicolous species prove to belong to Cladosporium s. str. Eleven obligately
fungicolous species are accepted and described in detail, and illustrated by line drawings;
information on hosts, geographical occurrences, and lists of specimens examined is also
provided. One of these species is newly described (C. gerwasiae on a Gerwasia sp. rust
on Rubus), and a new variety of C. exobasidiae occurring on Exobasidium vaccinii is
also recognized . In addition, descriptions of six saprobic species which can also occur
on decaying fungi are treated in similar detail. Twelve species are regarded as dubious
or doubtful due to insufficient data or ambiguous information as to their substrate, and
seven are excluded from the genus. New generic names are introduced for two of the
excluded species, Digitopodium (for C. hemileiae) and Parapericoniella (for C. asterinae),
and there are suggestions that two more may eventually also require different generic
names.

The authors place square brackets ([. . .]) around author citations for infraspecific
taxa other than the type variety, i.e. C. exobasidii Japp var. exobasidii but C. exobasidii
[Jaap] var. verruculosum Heuckert et al. Under the Code, the citation of the author of the
species name is not appropriate in the last and similar cases. However, if it is considered
desirable to mention the author of the species name, their placement between squared
brackets is a novel approach, though potentially ambiguous, as the device has a long
informal use for the indication of pre-Linnean names.

This is a morphologically based study in which especial attention has been paid to
the nature of the conidial scars and conidiophore branching, and there are coloured
plates of the type species of the new genera and scanning electron micrographs of scars.
Keys by the features of the fungi alone, and also by host, are provided. This is a carefully
executed study in the best traditions of hyphomycete taxonomy and will facilitate and
encourage future critical identifications in this ecological group of the genus.

391
Miscellaneous

Species Plantarum 250 Years: Proceedings of the Species Plantarum
Symposium held in Uppsala August 22-24, 2003. Edited by Inga Hedberg.
2005. Uppsala University Library, Box 510, SE-751 20 Uppsala, Sweden (e-mail:
acta@ub.uu.se). Pp. 219. [Symbolae Botanicae Upsalienses Vol. 33 (3).] ISBN 91 554
Sa oeele Price: 215 SEK:

Although only one of 20 contributions in this work has a fungal (actually lichen)
flavour through its examples, attention is drawn to it here as these include important
background information to the Linnaean literature and Linnaeus’ way of working -- as
well as some thought-provoking contributions on the future of botanical nomenclature.
The contributors include the leading authorities on Linnaeus (e.g. Charlie Jarvis, Bengt
Jonsell, Per Magnus Jorgensen, Walter Lack) and others at the cusp of heated debates on
aspects of the future of biological nomenclature (e.g. Werner Greuter, Kevin de Queiroz).
A final tranch of seven papers deals with inventorying the world’s flora, and occasions
reflection on the huge gap between the state of plant and fungal inventories.

Biological Resource Centres and the Use of Microbes. Edited by Nelson Lima
& David Smith. 2003. Micoteca da Universidade do Minho, Centro de Engenharia
Bioldgica, Campus de Gualtar, 4710-057 Braga, Portugal. Pp. 422. ISBN 972 97916 3 5.
aleeel) ef

This volume represents the proceedings of the 22"? European Culture Collections
Organization (ECCO) Meeting held in Braga, Portugal, on 17-19 September 2003. It is
important that those involved in the curation and maintenance of genetic resource centres
of fungus cultures keep abreast of both technical advances in preservation science and
the increasingly complex worlds of databasing and legal or ethical issues. Such occasions
facilitate such exchanges of views with those working with other organisms, from bacteria
to human cell lines. Starting with a powerful opening contribution on the importance of
ex situ collections by Manuel Mota, the papers presented in four symposia follow. These
concern: The use of microbes, Microbial identification techniques, Bioactive molecules,
and Biological resource centres. There are also reports from a round-table discussion
covering the Global Biodiversity Information Facility (GBIF), activities of the World
Federation for Culture Collections (WFCC), Accredited Biological Resource Centres,
and the realm of acronyms. If you curate a collection of fungal cultures and would like
to obtain a copy, prompt action is recommended as only 300 copies of the proceedings
were printed.

Nomenclatural novelties proposed in Mycotaxon 94

Anthracoidea setosae L. Guo, p. 47

Anthracoidea xizangensis L. Guo, p. 48

Blumenavia toribiotalpaensis Vargas-Rodriguez, p. 8

Clavulinopsis antillarum (Pat.) Garcia-Sandoval & Cifuentes, p. 277
Coltricia tsugicola Y.C. Dai & B.K. Cui, p. 342

Cordyceps spegazzinii M.S. Torres, J.E. White & J.E Bischoff, p. 257
Dactylellina illaqueata, D.S. Yang & M.H. Mo, p. 215

Fomitiporia torreyae Y.C. Dai & B.K. Cui, p. 344

Hirsutella crinita Z.Q. Liang, p. 352

Hirsutella hunanensis Z.Q. Liang, p. 351

Hirsutella zhangjiajiensis Z.Q. Liang & A.Y. Liu, p. 350

Hymenochaete flexosetosa Parmasto, p. 199

Hymenochaete geniculata Parmasto, p. 201

Hymenochaete legeri Parmasto, p. 203

Hymenochaete nothofagicola Parmasto, p. 212

Hypocenomyce isidiosa Elix, p. 219

Hypoxylon kanchanapisekii Suwannasai, Rodtong, Thienhirun & Whalley, p. 307
Hypoxylon sublenormandii Suwannasai, Rodtong, Thienhirun & Whalley, p. 307
Hypoxylon suranareei Suwannasai, Rodtong, Thienhirun & Whalley, p. 308
Lecanicillium pissodis Kope & Leal, p. 334

Lepiota catenariocystidiata Han C. Wang & Zhu L. Yang, p. 52

Lepiota trichroma Montoya & Bandala, p. 112

Lepraria lobata Elix & Kalb, p. 220

Leprocaulon australasicum Elix, p. 221

Lewia chlamidosporiformans B.S. Vieira & R.W. Barreto, p. 246

Otidea crassa W.Y. Zhuang, p. 366

Otidea onotica var. brevispora W.Y. Zhuang, p. 368

Paecilomyces parvosporus Y.F. Han & Z.Q. Liang, p. 360

Pertusaria cyathicola Elix, p. 223

Pertusaria subarida A.W. Archer & Elix, p. 134

Ramaria luteoaeruginea P. Zhang & Zhu L. Yang, p. 236

Ramaria pallidolilacina P. Zhang & Z.W. Ge, p. 238

Russula mukteshwarica K. Das, S.L. Mill., J.R. Sharma & R.P. Bhatt, p. 86
Streptopodium passiflorae (Syd.) Liberato & R.W. Barreto, p. 90
Thyrostoma negundinis (Berk. & M.A. Curtis) A.W. Ramaley, p. 131
Tuber umbilicatum Juan Chen & P.G. Liu, p. 2

Vamsapriya Gawas & Bhat, p. 150

Vamsapriya indica Gawas & Bhat, p. 150

Weddellomyces turcicus Halici & Orange, p. 249

one

394
Author Index—Volume 94

Aksoy, Ahmet, see Halici & al.

Archer, Alan W. & John A. Elix. A new species of Pertusaria from Western Australia. 94: 133-135.
2005 (2006).

Bandala, Victor M., see Montoya & Bandala

Barreto, R. W., see Liberato & Barreto

Barreto, Robert W., see Vieira & Barreto

Bhat, Darbhe Jayarama, see Gawas & Bhat

Bhatt, R.P., see Das & al.

Bischoff, Joseph F,, see Torres & al.

Blanco, M.N., see Checa & Blanco

Boddy, Lynne. Book review: Biodiversity of Fungi: Their Role in Human Life [Deshmukh & Rai
2005]. 94: 371-372. 2005 (2006).

Bonuso, Enrico, see Iotti & al.

Breuil, C., see Masuya & al.

Checa, Julia & M.N. Blanco. Some interesting pyrenomycetous fungi on bark of Quercus spp. from
Spain. 94: 225-230. 2005 (2006).

Chen, Juan, Pei-Gui Liu & Yun Wang. Tuber umbilicatum, a new species from China, with a key to
the spinose-reticulate spored Tuber species. 94: 1-6. 2005 (2006).

Chen, Weimin, see Yang & al.

Chu, Huali, see Han & el.

Cifuentes, Joaquin, see Garcia-Sandoval & al.

Constantinescu, Ovidiu, Vadim A. Melnik & Gerard J.M. Verkley. Two parasitic fungi on a new
host, Syringa (Oleaceae). 94: 175-179. 2005 (2006).

Cui, Bao-Kai, see Dai & Cui

Dai, Yu-Cheng & Bao-Kai Cui. Two new species of Hymenochaetaceae from eastern China. 94:
341-347. 2005 (2006).

Das, K., S.L. Miller, J.R. Sharma, P. Sharma, & R.P. Bhatt. Russula in Himalaya 1: A new species of
subgenus Amoenula. 94: 84-88. 2005 (2006).

De Luna, Efrain, see Garcia-Sandoval & al.

Delivorias, P., see Z. Gonou-Zagou

Deng, H., & Y. -J. Yao. Tricholoma equestre, the correct name for T. flavovirens (Agaricales).
Mycotaxon 94: 325-329. 2005 (2006).

Elix, John A. New species of sterile crustose lichens from Australasia. 94: 219-224. 2005 (2006).

Elix, John A., see Archer & Elix

Estrada-Torres, Arturo, see Garcia-Sandoval & al.

Fan, Meizhen, see Huang & al.

Garcia-Sandoval, Ricardo, Joaquin Cifuentes, Efrain De Luna, Arturo Estrada-Torres &
Margarita Villegas. A phylogeny of Ramariopsis and allied taxa. 94: 265-292. 2005 (2006).

Gawas, Puja & Darbhe Jayarama Bhat. Vamsaprija indica gen. et sp. nov., a bambusicolous,
synnematous fungus from India. 94: 149-154. 2005 (2006).

Ge, Zai-Wei, see Zhang & al.

Gilbertson, Robert L., see Parmasto & Gilbertson

Gonou-Zagou, Z., & P. Delivorias. Studies on Basidiomycetes in Greece 1: The genus Crepidotus.
94: 15-42. 2005 (2006).

————

pp ee —

505

Grand, L.F., & C.S. Vernia. Biogeography and hosts of poroid wood decay fungi in North Carolina:
species of Fomes, Fomitopsis, Fomitella and Ganoderma. 94: 231-234. 2005 (2006).

Guo, Lin. Two new species of Anthracoidea (Ustilaginales) from China. 94: 47-50. 2005(2006).

Halici, M. Gdkhan, Alan Orange & Ahmet Aksoy. Weddellomyces turcicus, a new species on a grey
Acarospora from Turkey. 94: 249-252. 2005 (2006).

Halling, Roy. Book review: Russulaceae: Lactarius [Rayner et al. 2005]. 94: 383-384. 2005 (2006).

Han, Yanfeng, see Liang & al.

Han, Yanfeng, Zongqi Liang, Huali Chu & Jichuan Kang. Paecilomyces parvosporus, a new species
with its relatives from Yunnan Province, China. 94: 357-363. 2005 (2006).

Hawksworth, David L. (ed.). Book reviews and notices. 94: 371-391. 2005 (2006).

Hodge, Kathie T., see Huang & al.

Hofstetter, Valerie. Book review: Palearctic Lyophyllaceae (Tricholomatales) in Northern and
Eastern Europe and Asia [Kalamees 2004]. 94: 381-382.

Huang, Bo, Chunru Li, Richard A. Humber, Kathie T. Hodge, Meizhen Fan & Zengzhi Li.
Molecular evidence for the taxonomic status of Metarhizium taii and its teleomorph,
Cordyceps taii (Hypocreales, Clavicipitaceae). 94: 137-147. 2005 (2006).

Huang, Bo, Richard A. Humber, Shigui Li, Zengzhi Li & Kathie T. Hodge. 2005 (2006). Further
notes on the molecular taxonomy of Metarhizium. 94: 181-187.

Huang, Jianzhong, see Liang & al.

Huang, Ying, see Yang & al.

Humber, Richard A., see Huang & al.

Hiiseyin, Elsad, Faruk Selcuk & Ahmet Sahin. The world’s second record of Neoheteroceras
flageoletii reported from Turkey. 94: 94: 241-244. 2005 (2006).

Iotti, Mirco, Mauro Marchetti, Enrico Bonuso & Alessandra Zambonelli. Morphological and
molecular characterization of the mycorrhizas of Inocybe rufuloides and I. splendens. 94:
75-84. 2005 (2006).

Iturriaga, Teresa. Book review: Guia de los hongos de Alcala de Henares (Macromicetes) [Heykoop
& Bellver 2005]. 94: 381. 2005 (2006).

Jiang, Y. & Y-J. Yao. ITS sequence analysis and ascomatal development of Pseudogymnoascus
roseus. 94: 55-73. 2005 (2006).

Kaneko, S., see Masuya & al.

Kang, Jichuan, see Han & el.

Kim, G.-H., see Masuya & al.

Kim, J.-J., see Masuya & al.

Kope, Harry H. & Isabel Leal. A new species of Lecanicillium isolated from the white pine weevil,
Pissodes strobi. 94: 331-340. 2005 (2006).

Leal, Isabel, see Kope & Leal

Li, Chunru, see Huang & al.

Li, Shigui, see Huang & al.

Li, Zengzhi, see Huang & al.

Liang, Zongqi, see Han & el.

Liang, Zongqi, Yanfeng Han, Aiying Liu & Jianzhong Huang. Some entomogenous fungi from
Wuyishan and Zhangijiajie nature reserves 2. Three new species of the genus Hirsutella. 94:
349-355. 2005 (2006).

396

Liberato, J. R. & R. W. Barreto. Streptopodium passiflorae comb. nov. on Passiflora rubr. 94: 89-92
2005 (2006).

Liu, Aiying, see Liang & al.

Liu, Pei-Gui, see Chen & al.

Maia, Leonor C., see Silva & al.

Marchetti, Mauro, see Iotti & al.

Masuya, H., J.-J. Kim, M. J. Wingfield, Y. Yamaoka, S. Kaneko, C. Breuil & G.-H. Kim. Discovery
and description of a teleomorph for Leptographium koreanum. 159-173. 2005 (2006).
Medel, Rosario. A review of the genus Gyromitra (Ascomycota, Pezizales, Discinaceae) in Mexico.

94: 103-110. 2005 (2006).

Melnik, Vadim A., see, Constantinescu & al.

Miller, S.L., see Das & al.

Mo, Minghe, see Yang & al.

Montoya, Leticia & Victor M. Bandala. A new species and a new record of Lepiota occurring in the
Gulf of Mexico area. 94: 111-125. 2005 (2006).

Orange, Alan, see Halici & al.

Ozdemir Tiirk, Aysen, see Tufan & al.

Parmasto, Erast & Robert L. Gilbertson. The genus Hymenochaete (Basidiomycota,
Hymenomycetes) in the Hawaiian Islands. 94: 189-214. 2005 (2006).

Peintner, Ursula. Book review: Cortinariales [Urbonas 2005]. 94: 378-379. 2005 (2006).

Ramaley, Annette W. The connection of Dothidotthia aspera (Botryosphaeriaceae) to a
hyphomycetous anamorphic fungus, Thyrostoma negundinis. 94: 127-132. 2005 (2006).

Rios, Asuncién de los. Book review: Fungi of the Antarctic: Evolution under Extreme Conditions
[de Hoog, ed. 2005]. 94: 376-377. 2005 (2006).

Rodtong, S., see Suwannasai & al.

Sahin, Ahmet, see Hiiseyin & al.

Selcuk, Faruk, see Htiseyin & al.

Sharma, J.R., see Das & al.

Sharma, P., see Das & al.

Silva, Gladstone A., Leonor C. Maia & Sidney L. Stiirmer. A dichotomous key to Scutellospora
species (Gigasporaceae, Glomeromycota) using morphological characters. 94: 293-301.
2005 (2006).

Stiirmer, Sidney L., see Silva & al.

Siimbiil, Hiiseym, see Tufan & al.

Suwannasai, N., S. Rodtong, S. Thienhirun & A.J.S. Whalley. New species and phylogenetic
relationships of Hypoxylon species found in Thailand inferred from the internal transcribed
spacer regions of ribosomal DNA sequences. 94: 303-324. 2005 (2006).

Tang, B.-H., T.-Z. Wei & Y.-J. Yao. Type revision of three Termitomyces species from India. 94:
93-102. 2005 (2006).

Thienhirun, S., see Suwannasai & al.

Torres, Monica S., James F. White, Jr. & Joseph E. Bischoff. Cordyceps spegazzinii sp. nov., a new
species of the C. militaris group. 94: 253-263. 2005 (2006).

Tufan, Ozge, Hiiseyin Siimbiil & Aysen Ozdemmr Tiirk. The lichen flora of the Termessos National
Park in Southwestern Turkey. 94: 43-46. 2005 (2006).

Vanderweyen, Arthur. Book review: Monograph of the genus Hemileia (Uredinales) [Ritschel
2005]. 94: 383. 2005 (2006).

B97,

Vargas-Rodriguez, Yalma Luisa & J. Antonio Vazquez-Garcia. 2005 (2006). Blumenavia
toribiotalpaensis: a new species of Clathraceae from Jalisco, Mexico. 94: 7-14. 2005 (2006).

Vazquez-Garcia, J. Antonio, see Vargas-Rodriguez & Vazquez-Garcia

Verkley, Gerard J.M., see, Constantinescu & al.

Vernia, C.S., see Grand & Vernia

Vieira, Bruno S. & Robert W. Barreto. Lewia chlamidosporiformans sp. noy. from Euphorbia
heterophylla. Mycotaxon 94: 245-248. 2005 (2006).

Villegas, Margarita, see Garcia-Sandoval & al.

Wang, Han-Chen & Zhu-Liang Yang. A new species of Lepiota (Agaricaceae, Besa omyeetee)
from China. 94: 51-54. 2005 (2006).

Wang, Yun, see Chen & al.

Watling, Roy. Book review: Les Réactifs Mycologiques. Vol. 2. Les Réactifs Microchimiques
[Charbonnel 2004]. 94: 377-378. 2005 (2006).

Wei, Jiangchun, see Wei & Wei

Wei, T.-Z., see Tang & al.

Wei, Xinli, & Jiangchun Wei. Two new species of Hypogymnia (Lecanorales, Ascomycota) with
pruinose lobe tips from China. 94: 155-158. 2005 (2006).

Whalley, A.J.S., see Suwannasai & al.

White, Jr., James FE, see Torres & al.

Wingfield, M. J., see Masuya & al.

Yamaoka, Y., see Masuya & al.

Yang, Dongshen, Weimin Chen, Ying Huang, Minghe Mo & Keqin Zhang. A new predatory
fungus from China. 94: 215-217. 2005 (2006).

Yang, Zhu-Liang, see Wang & Yang

Yang, Zhu-Liang, see Zhang & al.

Yao, Y.-J., see Tang & al.

Yao, Y.-J., see Yao & Jiang

Yao., Y. -J., see Deng & Yao

Zambonelli, Alessandra, see Iotti & al.

Zhang, Keqin, see Yang & al.

Zhang, Ping, Zhu-Liang Yang & Zai-Wei Ge. Two new species of Ramaria from southwestern
China. 94: 235-240. 2005 (2006).

Zhuang, Wen- Ying. Notes on Otidea from Xinjiang, China. 94: 365-370. 2005 (2006).

Zyska, Bronislaw. Book review: Checklist of Polish Larger Basidiomycetes [Wojewoda 2005]. 94:
379-380. 2005 (2006).

398

Reviewers, Volume Ninety-four

The Editors express their appreciation to the following individuals who have, prior
to acceptance for publication, reviewed one or more of the papers appearing in this

volume.

Teuvo Ahti

T.V. Andrianova

Alan W. Archer
Richard Baird

Victor Bandala
Stephen Bentivenga
M. E. Barr Bigelow
José Luiz Bezerra
Uwe Braun

Paul Bridge

Peter Buchanan
Michael A. Castellano
Shengjun Chang
Andrzej Chlebicki
Vincent Demoulin
Cvetomir M. Denchev
Dennis E. Desjardin
Paul Diedrich

Harry C. Evans
Tobias G. Freaslev
Laura Guzman Davalos
Tan R. Hall

Karen Hansen

Maria Havrylenko

Lauraine Hawkins

David L. Hawksworth
Donald E. Hemmes
Kentaro Hosaka
Richard A. Humber
Gintaras Kantvilas
W. Bryce Kendrick
Thomas Kirisits
Richard P. Korf
Shidong Li

Taihui Li

Zong-Qi Liang
Jielin Liu

Xuefeng Liu
Patrick McCarthy
Eric McKenzie
John McNeill
Vincenzo Migliozzi
Joseph Morton
Gregory M. Mueller
Karen K. Nakasone
Tuomo Niemela
Lorelei L. Norvell
David N. Pegler
Ursula Peintner

Antonio Batista Pereira

Shaun R. Pennycook
Ronald H. Petersen
Donald H. Pfister
Scott A. Redhead
Peter Roberts

Jack D. Rogers
Amy Y. Rossman
Mark R.D. Seaward
Keith Seifert
Beatrice Senn-Irlet
Hyeon-Dong Shin
Harrie J.M. Sipman
Brian M. Spooner
James M. Trappe
Adnan Uzunovic
Kalman Vanky
Larissa Vasilyeva
Jukka Vauras

Else C. Vellinga
Jiangxin Wang

Roy Watling

Zhu L. Yang
Yi-Jian Yao

Rasoul Zare

Wen- Ying Zhuang

S29

MYCOTAXON ONLINE RESOURCES: WWW.MYCOTAXON.COM

Index to fungous and lichen taxa—Mycotaxon proudly provides full indices to all
authors and taxa that appear in its pages. We continue to print complete indices to
authors in each Mycotaxon volume. Until 2004 (Mycotaxon 1-88), we also printed
complete lists of taxa, which are still available for purchase. Because digital files are far
more conveniently searched than separate appendices in each print journal, we now
post Mycotaxon taxonomic indices only online. Taxonomic indices are now current up
through Volume 91, but Volumes 92-94 are scheduled for posting later in 2006. To read
or print Index to fungous and lichen taxa for Volume 91, download our posted PDF file
by clicking first on InpicEs (in the list at the top of any webpage under the Mycotaxon
header) and then Taxon INDEX, VOL 91.

Cumulative indices—Readers can now swiftly and easily locate taxonomic and author
names in the cumulative indices to authors and taxa from earlier Mycotaxon volumes.
Cumulative author indices available are VOLUMES 61-93 on the MycoTaxon website
and Volumes 1-20 on the CyBERLIBER website. Cumulative taxonomic indices now
available for downloading include Taxon INDEX, VOLUMES 61-70; TAXON INDEX,
VOLUMES 71-80; and TAXON INDEX, VOLUMES 81-90. Taxonomic entries for Volumes
91-94 will eventually be integrated into Taxon INDEX, VOLUMES 91-FF.

Distributional checklists—Mycotaxon posts downloadable PDF files or URL links
first published in Mycotaxon by authors who amend or update species identifications,
nomenclatural revisions, and range & substrate extensions as new data become available.
To find the checklist page, first click ONLINE REsouRCES (under the MycoTaxon
header) and then REGIONAL CHECK Lists. Users may also find checklist PDFs and
URLs by clicking on links in the summary abstracts. (Abstracts are found following the
PUBLICATIONS -> VOLUME LISTING —> VOLUME NUMBER -> TITLE pathway.)

Volumes 1-27 now online—Mycotaxon happily announces that cost-free access to
papers in back volumes is well underway. Early volumes may be accessed and individual
pages downloaded by following the CYBERLIBER —> BOOKS & JOURNALS -> MYCOTAXON
pathway from the Mycoraxon homepage.

Information for authors and reviewers—The INSTRUCTIONS TO AUTHORS page is the
best way to find the most up-to-date information needed for Mycotaxon manuscript
submission. Downloadable files include the 19-page detailed INSTRUCTIONS TO
AuTuHors PDF and the following document files: REVIEWER GUIDELINES (with peer
review checklist for expert reviewers), official MyCOTAXON SUBMISSION FORM, and our
pre-formatted MycoTaxon WorD SHELL.

Search—The search! engine option in the top right corner of every Mycotaxon webpage
is yet another way to search for authors, taxa, and other online resources. Currently it
only indexes taxa cited in titles, abstracts, or keywords of published papers. The search
button also finds all nomenclatural novelties.

400

Errata

Volume 3

The new generic name Burenia is misspelled on pp. 1, 9-12, 46-47, and 570. It is an orthographic
error, correctable under the International Code of Botanical Nomenclature. The name honors G.
von Biiren, misspelled Buren on pg. 11, but spelled correctly on pg. 48. All the Latin names cited
should thus be corrected to Buerenia. We are advised that the correct spelling will appear in the
10th edition of Dictionary of the Fungi (CMI).

pe coal dl

pg. 36, f. 5 caption

pg. 129, In. 4

pg. 130, In. 11

pg. 137, abstr. In. 8
pg. 144, In. 8

pg. 154, In. 17

pg. 224, In. 18

pg. 224, In. 19

pg. 226, par. 3, In. 2
pg. 250, In. 5

pg. 362, In.15

pg. 363, In. 2

pg. 526, In, 12

pg. 526, after In. 21
pg. 526, In. 21

PorOe 7 sie:

p. 379, line 4

Volume 91

for: Thecispora
for: Coltricella
for: P. redivivus
for: tenius

for: fomitiporoides
for: fomitiporoides
for: fomitiporoides
for: segetum

for: carbo

for: Wallr.

for: versatilis

for: tanganykeanum
for: griseiviridis
for: griseiviridis

read: Trechispora
read: Coltriciella
read: Panagrellus redivivus
read: tenuis

read: fomitoporoides
read: fomitoporoides
read: fomitoporoides
read: segetum 0

read: carbo 0

read: Wallr. 3

read: versatile

read: tanganyikeanum
read: griseoviridis

read: griseoviridis

delete Pertusaria hueangensis Jariangprasert, p. 283
add: PHAEOTREMATACEAE Popoff ex Piatek, p. 181
for: parvicarpum ... 352 read: parvicarpum ... 351

for: namaqualandensis read: namaqualandus

Volume 93

for: aurelio@castillo@uah.es — read: aurelio.castillo.uah.es

401

Instructions for Mycotaxon Authors
(Updated December 2005)

MycoTaxon is an international mycological journal devoted to research on the
taxonomy and nomenclature of fungi. Publication is open to everyone. Authors are
responsible for obtaining peer reviews from experts in the field prior to presubmission
of their manuscripts to the Nomenclature and French Language Editors. The Editor-in-
Chief reviews all expert peer reviews, presubmission recommendations, and author
submissions and prepares all files and hard copy for printing by Sheridan Press, which
also handles reprints. Subscriptions, author invoices, and payments are handled by the
Business Manager. MycoTaxon is indexed by the Index Editor and the Webmaster is
responsible for maintaining the journal website on www.mycotaxon.com.

Review Editors

Dr. Lorelei L. Norvell, MycoTaxon Editor-in-Chief
<editor@mycotaxon.com>
6720 NW Skyline Boulevard
Portland OR 97229-1309 USA

Dr. Shaun R. Pennycook Prof. Dr. Grégoire L. Hennebert
Mycotaxon Nomenclature Editor Mycoraxon French Language Editor
<PennycookS@LandcareResearch.co.nz> 32 Rue de 'Elevage

B-1340 Ottignes-LLN, BELGIUM

Authors: Include “Mycotaxon + author name + date’ or ‘MycoTAxon accession number’ in all
subject headers. Add editor@mycotaxon.com, Ilnorvell@pnw-ms.com, info@mycotaxon.com, and
PennycookS@LandcareResearch.co.nz to your Email-friendly address lists.

Submissions are usually acknowledged within two weeks of receipt, although acknowledgments
may slow during field season or at press times. Manuscripts go first to the Nomenclature Editor,
who assigns permanent accession numbers. Completed manuscripts and supporting materials
go to the Editor-in-Chief, who reviews final submissions in the order received, returning files for
revision as needed before preparing the final papers for the press. Author listings, page numbers,
and proof pprs sent for final author approval must be acknowledged within three working days.

Only errors introduced by ppF conversion are corrected free of charge. Conversion errors include
omitted text, altered symbols, and other anomalies introduced by the Editor-in-Chief, but not
minor shifts in text flow caused by graphics insertion. MycoTaxon reserves the right to reject
papers of questionable taxonomic merit or those that do not meet other listed criteria.

Overview
1. What is suitable for publication in MyCOTAXON?........... p.402
CRE OUDIISSION DIOCEGUIC © tin. an. See eee eee 402
Dw) PE LCDALING LEX er ten clans sod asl ttecelarncchie ts Stas, ee RMmEeee = tec 403
Are Preparing tilistrations’ tare tes re ee ees eee 407
Dr we PECPTEVIEW NT. Sie oe tts TET en ee: ne nee ne, Pere 409
6. _ Nomenclatural & French Language review ......../0...1..-. 409
gM We Pinal submission ative. ae Teen e ae eee 409
Seebinalautbor checklists (5. cordate. oh tee ornre nee eee 410
O see OLTECHIONS DOL Cy ya 3 orate pleas, Pla ene easels 41]
LO ca DLAI D OPED ELIS ala Ral ee ce i 41]

402

1. What is suitable for publication in Mycotaxon?

MyYcoTAXON is restricted to papers on the taxonomy and nomenclature of fungi. We intend this
broadly to include monographic works, reviews of taxonomic groups and/or taxonomic criteria,
arguments dealing with specific nomenclatural problems, proceedings of symposia on taxonomic
or nomenclatural matters, and well-documented floras. Papers that deal with other mycological
disciplines (cytology, ecology, genetics, phylogenetics, physiology, etc.) should be submitted to
another journal unless their primary focus is taxonomic. Prospective authors are encouraged to
send a draft to the Editor-in-Chief for consultation regarding suitability of their manuscripts for
publication in the journal.

Articles may be of any length. Most authors pay no page charges, although sole/senior authors who
exceed 100 pages per year may be charged $18 per excess page. Authors are granted one halftone
plate for every ten (10) pages of text (11-20 text pages qualify for 2 halftones, 21-30 pages for 3
halftones, etc.). Fees are $40 for each excess halftone plate. Black & white line drawings, phylotrees,
graphs, and tables are not considered halftones and count as text in assessing page charges. There
are also fees for digitizing original artwork, converting non-standard graphics files to TIF or EPS
format, and correcting author errors in PDF proofs.

About regional (distributional) checklists

Until 2003, Mycoraxon published annotated regional checklists of fungi, which often served as
first fungal records from under-explored areas. Now, web-based documents offer a searchable
interface and permit rapid integration of new information. Thus, MycoTaxon no longer publishes
regional complete fungal inventories in the print journal, instead inviting authors to publish 1- to
4-page summaries of longer checklists posted on the Internet. Both urts to checklists posted on
authors own websites and downloadable PDF checklists are posted on <www.mycotaxon.com/
weblists/>. There is a one-time $25 posting fee for uploading a ppred distributional paper onto the
MycoTaxon weblist page.

Summaries must adhere to the same editorial requirements as regular manuscripts. Both original
checklists and summaries undergo peer and nomenclatural review before final submission to the
Editor-in-Chief. Checklist authors are strongly encouraged to cite references used to identify the
taxa in their research and must include the URL to their checklist in the abstract. Authors wishing
to post on Mycotaxon’s webpage should contact the Business Manager <info@mycotaxon.com>,
who will upload their PDF checklist after final editorial approval. All pprs, which may be updated
for a $10 revision fee, must display original submission and revision dates on the first page.

2. Mycotaxon submission procedure

Authors are encouraged to download the more detailed instruction PDF (containing full clone
preparation instructions + sample manuscript), and Reviewer Guidelines + Checklist, MycoTaxon
Word? shell, and submission form document files from the Instructions to Authors webpage on
<www mycotaxon.com> before preparing a manuscript for MycoTaxon. (All files will also be E-
mailed by the Editor-in-Chief on request.)

Authors who wish to prepare their own press-quality ppFs using a desk-top publishing application
must pre-flight their files through Sheridan Press before final submission and be able to insert
masthead and page numbers exactly as requested at press-time. Those intending to submit text for
scanning and digital conversion should first contact the Editor-in-Chief for special instructions.

Please be aware that editors open only E-mails that have “Mycotaxon” followed by author
name and reference number or title word in the subject headers. Authors should add
<editor@mycotaxon.com>, <Ilnorvell@pnw-ms.com>, <PennycookS@LandcareResearch.co.nz>,

403

and <info@mycotaxon> to their list of permitted incoming addresses. Authors who mail hard copy
are reminded to package all materials securely, enclose address information within the packet, and
to use stiff boards, bubble wrap & plastic cases to protect artwork/CDs.

Peer Review (Step 1)

Authors send formatted manuscript text & graphics files with the MycoTaxon instruction PDF
and reviewer guidelines to two experts for presubmission peer review. English grammar,
nomenclature, and author citations must be checked by at least one reviewer.

Peer reviewers (i) return edited manuscripts to authors and (ii) E-mail forms & review summaries
to authors & MycotTaxon Editor-in-Chief immediately after the first review.

Nomenclature & Presubmission Review (Step 2)

Authors send revised & formatted master text clone (no graphics) and peer reviewer E-mail
addresses to the Nomenclature Editor and (when appropriate) French Language Editor.

The Nomenclature & French Language Editors return annotated clones with a list of needed
corrections to the authors, peer-reviewers, and Editor-in-Chief.

Authors correct manuscript (consulting peer reviewers when necessary).

Final submission (Step 3)—Authors E-mail or post the Editor-in-Chief

Manuscript ppF/MSworp preview file or print copy with fully formatted, legends, tables & footnotes
with graphics either embedded or placement indicated;

Master & body text clones (and table/legend clones when tables/figures are included);

Graphics as original hard copy or digital JpG/TiF/zPs file. All images must set in grayscale mode.
Photo halftones must have a minimum of 300 dpi resolution; black & white line art must have
900-1200 dpi resolution. (All resolutions are scaled for a 4.33” or 11 cm print area width.)
(Contact the Editor-in-Chief to determine fees for scanning hard-copy original artwork and
converting embedded megafiles or MSWorp pictures to required JpG/TIF/EPs formats); and

MycotTaxon submission form and short cover letter.

Editorial review and press-preparation (Step 4)

The Editor-in-Chief (i) acknowledges submission (usually within 2 weeks) and (ii) after editorial
review either E-mails approval and requests author statement that clones are accurate or
returns marked clones to the author for revision.

Authors return revised files and/or a paragraph stating that all text is error-free and that the Editor-
in-Chief may adjust graphics, legends, and tables as needed during press preparation.

The Editor-in-Chief merges all author files in InDesign to prepare a press-quality PDF file. The PDF
proof is sent to the authors for final inspection before going to press. All fees should be sent to
the Business Manager at this time.

3. Preparing text and text clones

Authors must prepare concise, well-formatted, error-free copy that accurately conveys the author's
ideas with an economy of space. Articles may be written in either English or French. Authors
submitting copy in English should follow one uniform spelling and grammatical convention
(American or British) throughout the manuscript.

Digital submission is encouraged, with MSWord? text files and Adobe Photoshop® graphics
files preferred. Sheridan Press, which prints MycoTaxon, provides a PDF booklet <http://www.
sheridanpress.com/whitepapers.htm> that explains how to prepare illustrations for publication.
The Press also permits authors to submit up to 3 digital TIF files to “Digital Expert” <http://
dx.sheridan.com/> for free diagnosis of potential problems prior to submission. Authors wishing

404

to prepare their own press PDF files must contact the Editor-in-Chief for special instructions and
pre-flight their PDF with Sheridan Press before final submission.

Hard-copy submission is still accepted, but authors are asked to ask the Editor-in-Chief for
additional guidance before submission. MycoTaxon now charges a $5 per page/illustration
scanning fee to digitize hard copy and is unable to scan artwork larger than 23 x 31cm (9 x 12”).

Clones: What are they and how are they used?

MycotTaxon asks authors to submit text clones for nomenclatural and final editorial reviews. These
‘clones’ contain all formatted text that will appear in the published paper, but no illustrations, which
should be submitted separately. The four text clone types are master (for review & final submission)
and body, legend, and table (for final submission). Authors submitting preflighted ppFs approved by
Sheridan Press for publication need not submit clones.

The master text clone contains ONLY text (no graphics) used during peer and nomenclatural
review where MycoTaxon masthead mockup, tables, legends, footnotes, breaks, and empty lines
indicating graphics placement are all present. The body text clone is the master clone with masthead,
empty paragraph lines, tables, footnotes, legends, and line, section & page breaks removed. The
legend text clone contains all footnotes & legends with explanatory text for placing each footnote
and illustration. The table text clone contains all formatted title+table+footnote text. (Two table
text clones are submitted when tables have differing (i.e., landscape vs. portrait) orientations.) Text
clones must be correct! The complete manuscript is used only as a placement guide for tables and
figures. The clones are combined with illustrations to generate the final PDF press file.

Pages 7-8 in the ‘MycotTaxon Instructions to Authors’ PDF (which can be downloaded
for free from www-mycotaxon.com website) explain in detail how to prepare clones.
Authors are also encouraged to write the Editor-in-Chief for additional assistance if
needed.

Text must conform to the following specifications

Print area size is 11 x 17.5 cm (4.33 x 6.89”). The MycotTaxon Word shell has been formatted
for a US letter (A3) paper size with 5.25 cm top/bottom & 5.3 cm side margins. It also contains a
mock-up of the Mycotaxon logo and header for the first page. Those using other word-processing
applications should follow the above guidelines, allowing 2.5 cm (1”) for the title page masthead
on the first page.

Fonts & Paragraph formatting— Authors are asked to use two basic font families: serif TIMES or
TIMES NEW ROMAN (TNR)—and sans serif ARIAL Of HELVETICA (HELV). Characters not displayed
on keyboards (a, f, ut, x) should be selected from the syMBOLs menu if not available in the regular
fonts. COURIER is used only when comparative columnar arrangement is essential (e.g., for DNA
sequences). (All other fonts require editorial permission.) Lines must be single-spaced, and
text formatted with 1 1/2 spaces between lines is not acceptable. Authors should use paragraph
format menu options rather than hit the return key twice to separate paragraphs or stand-alone
subheadings or use the tab key to indent paragraph first lines by 0.5 cm.

Note: Standard elements of an article are the title, author address information, abstract,
key words, main text, figure legends, acknowledgments, and references. The MyCOTAXON
instruction PDF offers a properly formatted sample manuscript and includes other
helpful manuscript preparation suggestions.

405

Required formats

* Title—Font: Arial, 11-pt, Bold, sentence case (never upper or title); Paragraph: no full stop (dot)
at the end (unless ending with an abbreviation), no indent, center aligned.

Special: Set Latin scientific names in bold italic. Titles should not exceed three lines. Author
citations are not acceptable unless authors demonstrate why an authority is necessary to the title.
Abbreviate genus names after the first use, but otherwise avoid abbreviations. Use arabic (not
roman) numerals. Example:

Studies in Agaricales 3:
Phaeocollybia phaeogaleroides and P. rifflipes,
new western North American species

¢ Author names—Font: Times, 10-pt, Roman (regular), ‘SMALL Caps’; Paragraph: no indent, center
aligned.

Special: Given names and initials always stand before surnames. Separate authors with commas,
but use ‘&’ before the last author's name.

¢ Address information—Font: Times, 9-pt, Italic; Paragraph: no indent, center aligned, no periods
at line ends; Placement: E-mail address (required*) on top line; Institution/Street on middle line;
City, Code, Country on bottom line.

Special: *Junior author E-mail addresses recommended, but optional. Do not end lines with
commas or periods (except for abbreviations).

¢ Abstract—Font: Times, 8-pt; set ‘Abstract’ and ‘Key words’ in bold and precede em-dash and
remaining paragraph/list formatted in regular or italic as needed. Paragraphs: 1 cm right & left
margins, no indent, fully justified.

Abstract: Abstracts briefly summarize the content & conclusions and list all new taxa (but not
authorities unless differentiating homonyms). English abstracts are required; 1-2 abstracts in other
languages are permitted for longer articles. Abstracts should not exceed 15 printed lines.

Key words: Up to five key words or phrases are permitted. Do not repeat terms already used in
the title or abstract. Separate list items with commas. Capitalize only proper nouns.

* Subheadings: Primary (stand-alone)—Font: Arial 10-pt, Bold/Bold Italic; Paragraph: no indent,
center aligned. Secondary (stand-alone)—Font: Times 10-pt, Bold/Bold Italic; Paragraph: no indent,
left aligned. Arial 10-pt regular (roman) and Arial 9-pt, Bold/Bold Italic are optional secondary
subheadings.

Taxonomic (special) — Font: Times; Size & Style: Latin name—10-pt Bold Italic, Author citation—
9-pt regular; ‘nom. nov. & ‘Fig. #”—9-pt bold. Paragraph: hanging indent, left aligned; set right tab
to 11 cm and use tab to justify Fig. # at right.

* Basic text—Font: Times 9-pt; Paragraphs: fully justified. Select 6-pt gaps or 0.5 cm first line
indents to separate paragraphs (not both).

Introduce your subject briefly by citing significant background literature. Provide necessary
abbreviations and other data in a brief Materials & Methods section (8-pt font permitted here).
Document your own observations concisely, stressing new discoveries. Minimize confusion
between generic epithets beginning with the same initial letter by abbreviating one using the first
two letters of the generic name. Italics are required for Latin scientific names of taxa up through
and including order or reserved for emphasis; common Latin abbreviations (e.g., i.e., inter al., etc.)
and references are not to be italicized. List author citations once only: in the taxonomic heading
where a new taxon is proposed or where first mentioned in the text. Authors should list previously
misidentified taxa as ‘misapplied’ not ‘sensu + author + reference:

Required references: Consult the current INTERNATIONAL CODE OF BOTANICAL NOMENCLATURE
<http://www.bgbm.fu-berlin.de/iapt/nomenclature/...> when describing new taxa or proposing
new combinations. Author citations must follow either the updated Kirk & Ansell’s AUTHORS OF

406

FUNGAL NAMES <http://www.indexfungorum.org/Names/Names.asp> or INTERNATIONAL PLANT
NAMES INDEX <http://www.ipni.org/ipni/query_author.html>. Consult INDEX HERBARIORUM
<http://www.nybg.org/bsci/ih/searchih.html> for herbarium/collection acronyms.

Authors describing new taxa must cite relevant acronyms and numbers to facilitate retrieval by
readers and deposit new names/data in MycoBank <http://www.mycobank.org>, type specimens
in an official public herbarium, ex-type strains in a public culture collection, and/or sequence data
in GenBank <http://www.ncbi.nih.gov/Genbank/submit.html>.

* Latin diagnoses, nomenclators, and ‘Specimens examined’— Font: Times, 8-pt; Paragraph: margins
indented ~1cm, fully justified with first line flush. Special: Italicize all Latin text in diagnoses but
only Latin scientific names in nomenclators & ‘Specimens examined’

* Acknowledgments—Font: Times, 8-pt. Paragraph: no indent, left aligned, fully justified. Special:
Acknowledge or thank pre-publication peer reviewers here.

* Literature cited—Font: Times, 8-pt; Paragraph: Hanging indent, no line spaces between entries.
Required: All references must be cited in the main text. Follow a consistent citation style throughout.
Never use more than one space between entries. Author names: substitute initials (no periods after
initials) for given names, order surnames before initials and do not separate with commas, separate
author entries only by commas and never by “&” or “and’, and place a period (dot) after the last
author entry. Standardize journal abbreviations.

Examples (consult also MycoTAxon sample manuscript in Instructions PDF):

Kirk PM, Cannon PF, David JC, Stalpers JA. 2001. Ainsworth & Bisby’s dictionary of the fungi.
CAB International, Surrey UK.
Senior AA, Junior BB. 1997. Title with Latin name here. MycoTaxon 56: 254-272.

Useful references: See BOTANICO-PERIODICO-HUNTIANUM (BPH: Lawrence & al. 1968),
BOTANICO-PERIODICO-HUNTIANUM/SUPPLEMENTUM (BPH/S: Bridson 1991), TAXONOMIC
LITERATURE, (TL: Stafleu & Cowan 1976-1988), and SUPPLEMENTS TO TAXONOMIC LITERATURE
(TL2: Stafleu & Mennenga 1992-1995) for recommended abbreviations.

Pay particular attention to the following

Hyperlinks—Disable hyperlinks in all clones. Clones with active hyperlinks will be returned to
the author for correction. Be aware that text imported from PDFs or websites frequently retains
the original hyperlinks or appear in foreign [unrecognizable] fonts during the press conversion
process. When in doubt, authors should retype the text themselves.

Italics & underlines—Reserve italics only for Latin taxonomic names or emphasis. Names of all
taxa from subspecific to ordinal levels must be italicized; using italics for higher-level names is at
the author's discretion. Do not italicize common ‘Latin’ abbreviations (e.g., et al., etc., inter al.) or
reference titles. Never underline text intended for publication.

Symbols—Generate diacritical marks and symbols (e.g., a, fi, 1, x) by using special keystrokes (e.g.,
“option+m’ for 1) or by inserting from the ‘symbols’ menu. When possible, select symbols from the
corresponding text font; in Word insert ‘y’ via the Insert > Symbol > Times pathway. Some symbols
(e.g., x’) exist only in the ‘Symbols’ font. Authors should list symbols inserted from the Symbols
(instead of the Times/TNR menu) on the submission form.

Punctuation—Place commas, periods, and other punctuation in the same font style as the word
directly preceding them. For instance, commas stand in italics after words in italics, in bold after
words in bold, and in bold italic after words in bold italic. However, the closing mark of paired
marks such as parentheses, square brackets, quotation marks, single quotation marks, and long
dashes exhibits the same font style as its companion open mark, even when preceded by a word ina
different style. With the exception of the sanctioning colon (e.g., Fr. : Fr.), no space stands between

407

a punctuation mark and the preceding text. Likewise, no space stands between an initial paired
mark (e.g., open parenthesis) and the first word. In computer-formatted manuscripts, only one
space follows a full stop at the end of a sentence.

The hyphen, en-dash, and em-dash have different uses—The hyphen separates word elements and
breaks at line end. Do not introduce hyphens to long words in text clones as they may appear in
midline after ppF conversion. The en-dash (keyed on a ‘Mac’ using ‘option+dash’) is longer, and
does not break at line end. Use an en-dash with spaces for ‘minus’ in mathematical notation and
without spaces in range expressions: the en-dash in ‘8-10’ keeps the ‘8’ and ‘10’ together on one
line. The em-dash (‘shifttoption+dash on a Mac) is the longest and—generally—is reserved for
emphatic clauses that are otherwise enclosed in parentheses. No spaces are used.

Spelling and grammatical errors—All co-authors should proofread text for spelling, typographic,
and grammatical errors; grammar and spell checkers can also be helpful. The two most common
spelling errors are still (i) misspelling authors’ own names & addresses (!) and (ii) spelling names of
taxa one way in the text and another way in figure captions.

Non-native English speakers must ask someone fluent in English or French to proofread the
paper before each review (peer and nomenclatural) and again before final submission. Additional
attention should be given to Latin diagnoses, which should be brief. Diagnoses that list only the
key characters separating a proposed new taxon from closely related ones generally contain fewer
errors than more complicated descriptions. Save details for the technical description.

4. Preparing illustrations

Color option: Those wishing to publish color illustrations should correspond with
Sheridan Press before final submission. Current press charges are $475 per color page.
Returns: MycoTAxoNn will return original illustrations to authors who include a self-
addressed envelope that is stamped or submitted with sufficient International Postal
Reply Coupons, with their final submission.

Size & placement

All articles published in MycoTaxon begin on an odd-numbered (right-hand) page. It is preferable
to place a figure on a right-hand page facing the text first referring to the illustration. Group figures
to facilitate species comparisons and keep page numbers to a minimum. Do not border or edge
photographs and drawings with a line. Illustrations are best formatted at publication size. Plan to
place figure legends below figures (preferred) or at the bottom of pages facing illustrations.

Line drawings

Authors may submit originals, digital images prepared from scanned originals, or high quality
reduced photocopies of original artwork. Authors with access to computer scanners and
photographic software are encouraged to digitize original drawings themselves.

Digital files— Digital files that incorporate fonts or vector information should be submitted as
1200dpi T1F (in bitmap mode) or 900dpi EPs files. Simple line drawings can be scanned using
software such as ADOBE PHOTOSHOP’, but more sophisticated illustration software (e.g., ADOBE
ILLUSTRATOR’) should be used to convert phylotrees and other drawings containing vector
information to EPs format. Image adjustments — e.g., insertion of scales, numbers, and arrows —
should be handled in such applications. Remember that digital figures should not include legends,
which belong in the legend text clone.

Hard copy— Authors who submit digital text with hard copy artwork may include photocopies
within a manuscript printout to indicate figure placement; however, they should also submit line

408

drawings separately without legends. Authors who submit exclusively hard copy materials should
position line drawings onto existing text pages with captions printed directly below or to the side
of each drawing. With care, authors generally scale down oversized drawings using the reduction
feature on photocopiers without decreasing image quality and assemble an attractively arranged
plate from the cut & paste illustrations and captions.

Photographic ‘halftones’

MycoTAxon prints only grayscale (“black & white”) photographs, but authors who submit film-
based (not digital) prints may submit color photos for conversion to grayscale if necessary. Both
grayscale and color photographs have a “continuous tone” requiring transformation into a separate
halftone image before they can be printed for publication. (A halftone image consists of many
variously sized and spaced dots, which are easily seen using a hand lens.).

Digital grayscale halftones— Photographic software such as ADOBE PHOTOSHOP” allows preparation
of compressed jp files (useful for peer review) and T1F files (non-compressed files used in journal
publications). Tir or ypc halftones must be set in grayscale mode with a minimum resolution of
300-600 dpi (dots per inch) matching the target width, generally 4.33” (11 cm). Authors who group
photographs into plates should ensure that the contrast among individual photographs is not too
great; individual photographs within plates may be set flush or separated by a 1-2mm white or black
band. Authors who prepare their own pps for printing may insert both line and photographic art
using publishing software (e.g. INDESIGN®).

Negative-based photographs—To prepare negative-based photographic plates, crop individual
photographs so that edges touch and the plate is exactly 4.33” (11 cm) page wide. Mount
photographs on separate sheets of heavy white paper or matte board. Apply annotations (arrows,
numbers, scales, etc.) and band strips after the photographs are positioned and be certain to allow
space around the photograph for editorial markings. NOTE: Authors must not submit halftone
prints prepared from digital files as hard copy intended for publication; they should submit instead
grayscale computer files formatted as described above.

Labeling

Title all graphic files (JPG, TIE, EPS) with the first author’s name and figure number (e.g., name_fig#.
tif). Label all original artwork hard copy with the first author’s name and figure number on the
reverse side.

Final note about digital images

The Editor-in-Chief is able to convert a good many different file formats quickly to TIF or EPs
files in ADOBE PHoTosHopP’®. Therefore, there are no fees for converting PHOTOSHOP, BMP, JPG,
PCX, PICT, PIXAR, PNG, SCITEX CT, or TARGA files, provided they open in PHoTOsHopP in proper
grayscale/bitmap mode and with the required resolution. A $5 fee is charged for processing each
MSWorp embedded mega- or picture file through ILLUSTRATOR” before press.

The Editor-in-Chief cannot improve the quality of a bad image. Authors should submit as clear and
clean an image as possible but must remember that, in science, reality supersedes beauty. Do not
‘over-photoshop or otherwise distort images.

Authors who do use artwork to enhance certain features within a photograph must explain what
has been added in the accompanying figure legend.

———— ee ——————————— eee

409

5. Peer review

Mycoraxon is unusual among scientific journals in that authors are expected to obtain their own
peer reviews before submission by contacting two scientists in their field but outside the senior
author's home institution. When authors are uncertain whom to approach for manuscript review,
they may send their title and abstracts to the Editor-in-Chief for the names of suitable reviewers.
Although both MycoTaxon Nomenclature Editor and Editor-in-Chief will review each manuscript
and may solicit outside reviews when necessary, English grammar, nomenclature, and author
citations must have first been thoroughly checked by at least one of the two peers. Authors whose
first language is not English are urged to contact a native English-speaking expert to serve as one
peer-reviewer.

The corresponding author sends each reviewer the Reviewer Guidelines & Checklist document file
with one of the following: a master text clone with individual ypc files, a MsworD manuscript with
embedded figures, or a printed manuscript with photocopied figures. (Guidelines and checklist
can be downloaded from <http//:;www.mycotaxon.com> or E-mailed by the Editor-in-Chief).
After review, each expert returns annotated text to the corresponding author and sends the formal
checklist and brief comments to the corresponding author and the Editor-in-Chief.

Authors should revise manuscripts following reviewer suggestions and must explain during final
submission which recommendations were not followed and why. They may also ask experts for
additional guidance during the post-nomenclatural review revision and may add reviewers who
make major improvements as co-authors. The Editor-in-Chief acknowledges all peer reviewers
in the closing pages of each volume, but authors should also thank peer reviewers in their own
acknowledgements.

6. Nomenclatural and French Language Review

After peer review, all authors must E-mail their master text clone file to the MycoTAxoNn
Nomenclature Editor, who reviews text for adherence to the International Code of Botanical
Nomenclature and standardization of author citations. Manuscripts written in French should be
sent to the French Language Editor at the same time. These editors determine whether a manuscript
is ready for final submission and return annotated clones with a list of needed corrections to the
authors, peer-reviewers, and Editor-in-Chief. Graphics files are to be sent only by editorial request.
Be certain to write ‘MyCcoTaxon review: [Senior author surname] [genus/order name] [date]” in
E-mail subject headers.

7. Mycotaxon final submission

Final submission materials should be sent to the Editor-in-Chief. Materials may be E-mailed
or sent by registered airmail (signature required). (Ask permission before E-mailing messages
& attachments exceeding 10 mgb.) Authors who intend to submit print-ready manuscripts for
scanning should contact the Editor-in-Chief before preparing their final submission. The following
items must be received before final manuscript review is begun by the Editor-in-Chief:

Two expert peer reviews—/sent by reviewers to the Editor-in-Chief]

Presubmission reviews from the Nomenclature Editor (& French Language Editor, when the
submission is in French)—[sent by Editors to Editor-in-Chief ]

Manuscript Text—[a] One PDF/document file OR a manuscript printed to show approximate
figure placement. Print hard copy on only one side; pages may be stapled and have author
+ page number headers unless intended for scanning. [b] Master text clone and body,
legend, & text clone document files as needed. (Consult “Text & text clones’ above and the
posted MycoTaxon author instruction ppF for more information.)

410

Illustrations— Digital: E-mail T1r or Eps files (preferred) or airmail on CDs. Other graphic

formats are also accepted, but fees are accessed for time-consuming file conversions. Hard
copy: See instructions above. There is a $5 per page or figure to be scanned.

Brief cover letter accompanied by MYCOTAXON submission form—The submission form can

be downloaded from the Mycotaxon webite.)

Consult the Author’s Checklist below before sending the final submission. Remember
to prepare back-ups to safeguard against loss or damage to files in transit.

8. Author Checklist

All authors are responsible for providing error-free, properly formatted text and will
benefit by downloading the Mycotaxon Word shell and the expanded Instructions
for Authors pprF files from <http//:www.mycotaxon.com/instructions.html >. Those
submitting press-pprs and photo-ready hard copy are also both designer and printer
of their paper and acknowledge that the Editor cannot change submitted text. Authors
who do not understand instructions are urged to ask their peer reviewers or the Editor-
in-Chief for help!

° Text format (very important)

Fonts and paragraphs all conform to MycoTAxon requirements (see above).

The backs of camera-ready manuscript pages are numbered and labeled with a soft pencil.
The body clone file contains no empty paragraph lines, initial tab settings, line breaks (main
title excepted), or graphics files. All footnotes, legends, and tables are removed.

The legend clone file contains only footnotes & figure legends, each accompanied by
instructions noting on which page to place the item in the final manuscript.

All tables are placed in one table clone. If both ‘landscape’ and ‘portrait’ tables are present,
they may be placed in two clones according to orientation.

The title is in Arial 11-pt bold (Latin names in bold italics), sentence-case, and does not end
in a full stop (abbreviations excepted). Taxonomic authorities are not included.

Manuscript author names are centered & in Times, 10-pt roman (regular), ‘SMALL Caps.
Addresses are centered, in Times, 9-pt italic, with E-mails at top with hyperlinks disabled,
institutional information in the middle, and Street -> Country information at bottom.

The Abstract and Key words are centered with margins indented by 1-cm and in Times, 8-pt
font. ‘Abstract’ and “Key words’ are in bold and other text is in regular except for italicized
Latin names. The key words list contains only five terms separated by commas, does not
repeat words in title or abstract, and does not end with a full stop.

ALL text is single-spaced. Leading is 10-pt for paragraphs containing 8-pt font.

Latin scientific names for all taxa from subspecies through order are italicized.

Author citations conform to INSI or Kirk & Ansell, occur only once for each taxon, and have
been checked by the Nomenclature Editor and at least one peer reviewer.

No commas stand between author names and (first) dates in text references.

Literature cited references follow a consistent order, conform to MycoTaxon guidelines,
have hanging indents, and are in 8-pt Time/TNR.

e Illustrations

Graphics are < 11 x 17.5 cm or authors have editorial permission to send oversized plates.

Photographs or composite plates fill the entire width of the page (except where text or legend
takes part of the width)

Digital halftones are in T1F format, grayscale mode, and 300-600 dpi per 4.33” width.

———_—— EES

!
1

411

— Figures submitted for scanning are mounted separately from the text on heavy stock and are
clearly numbered & labeled with author name & brief title on the reverse side.

— Legends are separate from artwork. They do not contain taxonomic author citations.

— The corresponding author has dated backup copies of all materials submitted.

- Final submission items

— Peer review checklists & comments have been sent by two expert reviewers to MYCOTAXON.
— Master text clone has been reviewed by the Nomenclature Editor.

— Master text clone written in French has been reviewed by the French Language Editor.

— Final master text and body clones (with legend & table clones as needed)

— Illustrations digital files of proper resolution or hard copy

— PDF/ MSWord file or printed manuscript showing figure placement

— Brief cover letter and completed MycoTaxon submission form

9. Mycotaxon corrections policy

Mycortaxon has always expected authors to submit manuscripts that are free of errors and ready
to publish when they arrive on the editorial desk. All coauthors are assumed to have viewed and
approved text prior to submission. Immediately after final editorial approval, all must again double-
check all files to return error-free clones to the Editor-in-Chief for processing.

The Editor-in-Chief processes clone and graphics files using ADoBE INDEsIGNn®. Text may shift
during this process, but InDesign generally distributes text evenly and displays few unsightly gaps
in justified lines. Authors receive a pre-publication ppF for final approval and so will have a chance
to correct errors introduced by PDF conversion.

Correction of author errors after PDF conversion is costly and time-consuming: MYCOTAXON now
charges a minimum of $10 per error to correct mistakes present in approved clones and $60 per
error to correct mistakes discovered after the files have been sent to press. There is no charge for
correction of author errors when authors send corrected clones to the Editor-in-Chief before the
PDF-conversion process is begun.

Mycortaxon corrects errors resulting from computer or editorial error free of charge. [Errors
present in approved clones are considered author and not conversion errors.] MycoTAXxoON also
lists, free of charge, corrections of all published errors in the Errata.

10. Ordering reprints or downloadable PDFs

Mycotaxon sends all authors a print-quality PDF file before publication and one copy of the
printed article to the corresponding author immediately after publication; a local printer can make
high quality reprints from either PDF or print. A ppr explaining how to order 100+ reprints or
arrange for Sheridan Press to host the author's ppF file on its website can be downloaded from
<http://www.mycotaxon.com/authors/reprints.html>.

Still have questions?

Contact the Editor-in-Chief at editor@Mycotaxon.com
OR
Download the ‘MycoTaxon Instructions’ to Authors PDF and
check the FAQ on our website at
<http://www.mycotaxon.com>

412

RECENT BOOKS FROM MY COTA XON
Prices include surface mail shipment (for more books see www.mycotaxon.com/books.html)

Mycotaxon, Ltd., P. O. Box 264, Ithaca, NY 14851-0264, U.S.A.

Fungi of China, by S. C. Teng.
Mycotaxon, Ltd. 1996, Hardbound, xiv + 586 pp., 426 illustrations, map, portrait, index, 8-1/2x11 inches. $79.00.
Airmail price varies by country: enquire. ISBN 0-930845-05-6.
Edited by Richard P. Korf, with a foreword by Teng’s daughter, Rosaline Z. Deng.
Proceeds from sales go to the Teng family.
Special for Mycotaxon subscribers: deduct $20 from regular price!

What reviewers say about Teng’s Fungi of China:
“... one of the most valuable books on the fungi of China ever published in English.” —Mycologia 90: 1091-1092, 1998.
“... a great big blue uncompromising brick of a book ... an instant classic. Anyone interested in identification of fungi,
particularly in Asia, should get this book immediately. Mycology owes another debt to Dick Korf for his sympathetic
and intelligent editing of this superb work.” —Bibliography of Systematic Mycology 10(6): xlviii-xlix. 1998.
“The book is important for any researcher interested in the systematic relationships, diversity, and distribution of fungi on a
global scale.” - New Zealand Journal of Botany 35: 265-266. 1977.

Fungi of Northwestern China, edited by Wen-Ying Zhuang.
Mycotaxon, Ltd. 2005. Hardbound, 430 pp., 26 x 18.5 cm. US$40.00 plus postage. ISBN 0-930845-14-5.
(Please order direct from Wen-Ying Zhuang, PO Box 2714, Beijing 100080, China; zhuangwy@sun.im.ac.cn).

Some 3887 named species belonging to 759 genera of fungi (slime molds, plasmodiophoromycetes, chytrid, oomycetes, zygomycetes,
lichens, non-lichenized ascomycetes, anamorphic fungi, rusts, smuts, and the basidiomycetous macrofungi) hitherto known from
Gansu, Ningxia, Qinghai, Shaanxi and Xinjiang, China are listed. Useful references, detailed tropical distribution, and hosts or
substrates are provided for each species. Contributing authors: Shuang-Lin Chen, Lin Guo, Shou-Yu Guo, Ying-Lan Guo, Shu-Xiao
Sun, Shu-Xia Wei, Hua-An Wen, Xiao-Qing Zhang,Jian-Yun Zhuang, and Wen-Ying Zhuang.

Higher Fungi of Tropical China, edited by Wen-Ying Zhuang.
Mycotaxon, Ltd. 2001. Cloth bound, 485 pp., 26 x 18.5 cm. US$50.00 plus postage. ISBN 0-930845-13-7.
(Please order direct from Wen-Ying Zhuang, PO Box 2714, Beijing 100080, China; zhuangwy@sun.im.ac.cn).

Some 5056 named species belonging to 1192 genera of higher fungi hitherto known from tropical China are listed. Useful references,
detailed tropical distribution, and hosts or substrates are provided for each species. Contributing authors: Lin Gou, Shou-Yu Guo,
Ying-Lan Guo, Xiao-Lan Mao, Shu-Xiao Sun, Shu-Xia Wei, Hua-An Wen, Zhi-He Yu, Xiao-Qing Zhang, Jian-Yun Zhuang, and
Wen- Ying Zhuang.

A Monograph of the Fungus Genus Cercospora, by Charles Chupp
Published by the author, Ithaca. 1953. Hardbound, 667 pp. 222 illustrations, octavo, $25.00. Airmail, $45.00
Proceeds from sales go to the Chupp family.
Still a classic after a half century.
Mycotaxon Cumulative Index for Volumes XLI-LX (1991-1996)

Karen D. Gettelman, Richard P. Korf, Susan C. Gruff & Ian E. Korf
Mycotaxon, Ltd. 1998. Softbound, 296 pp., 6x9 inches. $35.00. Airmail, $55.00. ISBN 0-930845-07-2.

Mycotaxon Cumulative Index for Volumes XXI-XL (1984-1991)

Richard P. Korf & Susan C. Gruff
Mycotaxon, Ltd. 1991. Softbound, 352 pp., 6x9 inches. $30.00. Airmail, $50.00. ISBN 0-930845-01-3.

Mycotaxon Cumulative Index for Volumes I-XX (1974-1984)

Richard P. Korf & Susan C. Gruff
Mycotaxon, Ltd. 1984. Softbound, 232 pp., 6x9 inches. $17.50. Airmail, $37.50.
ISBN 0-930845-00-5.

FUNGAL DIVERSITY RESEARCH SERIES (published in Hong Kong): Mycotaxon, Ltd. now ships rapidly from
the U.S. to North American customers. All prices are postpaid. Titles include: Marine Mycology—A Practical
Approach, Kevin D Hyde & Stephen B. Pointing (eds.), $100, 2000. Genera of Ascomycetes from Palms, by
Kevin D. Hyde, Joanne E. Taylor & Jane Frohlich, $100, 2000. Palm Microfungi, by Jane Frélich & Kevin D. Hyde,
$100, 2000. A World Monograph of Anthostomellaa, by Binsheng Lu & Kevin D. Hyde, $100, 2000. Checklist of
Hong Kong Fungi, by B.S. Lu, K.D. Hyde, W.H. Ho, H.M. Tsui, M.K.M. Wong, Yanna & D.Q. Zhou, $20, 2000.
Bio-Exploitation of Filamentous Fungi, Stephen B. Pointing & Kevin D. Hyde (eds.), $100, 2001. Fungi in Marine
Environments, Kevin D. Hyde (ed.), $80, 2002. Smut fungi from New Zealand—Fungi of New Zealand volume
2, by Kalman Vanky & Eric H.C. McKenzie, $50, 2002. The Genus Mycena in South-Eastern Australia, by Chery]
A. Grgurinovic, $80, 2002. Freshwater Mycology, by C.K.M. Tsui & K.D. Hyde, $80, 2003. Myxomycetes of New
Zealand—Fungi of New Zealand volume 3, by Stephen L. Stephenson, $50, 2003. Microfungi of Tropical and
Temperate Palms, by Joanne E. Taylor & Kevin D. Hyde, $80, 2003. Revision of the genus Amphisphaeria, by
Y.Z. Wang, André Aptroot & Kevin D. Hyde, $60, 2004. For details see the Hong Kong University website:
www.hku.hk/ecology/mycology/FDRS/index.htm

STATEMENT OF OWNERSHIP, MANAGEMENT, AND CIRCULATION OF MYCOTAXON, REQUIRED BY ACT
OF 12 AUGUST 1970: SECTION 3685, TITLE 39, UNITED STATES CODE, FILED 14 OCTOBER 1985.

Mycotaxon is published quarterly by Mycotaxon, Ltd., 316 Richard Pl., Ithaca, NY 14850-
3129. General Business office: P.O. Box 264, Ithaca, NY 14851-0264. USPS Publication #16-121,
ISBN 0093-4666. Editor: Lorelei Norvell, 6720 NW Skyline Blvd., Portland, OR 97229-1309.
Business Manager & Contact Person: Richard P. Korf, P.O. Box 264, Ithaca, NY 14851-0264 (phone
607-273-0508). Owner: Mycotaxon, Ltd. Stockholders owning or holding 1 percent or more of
the total amount of stock are: Ian F. Korf, 510 Lake Blvd. #166, Davis, CA 95616; Kumiko T. Korf,
316 Richard Pl., Ithaca, NY 14850; Mario T. Korf, 700 Walnut St. #3, San Carlos, CA 94070; Mia
K. LeBeau, 1356 N. Ogden Dr., Los Angeles, CA 90046; Noni K. Vidal, 313 Richard PI., Ithaca, NY
14850.

The known bondholders, mortgagees and other security holders owning or holding 1 percent or
more of the total amount of bonds, mortgages, or other securities are: NONE.

Circulation: Average number of copies printed for each issue during the preceding 12 months:
675; for single issue nearest to filing date: 675. Sales through dealers and carriers, street vendors,
and counter sales: NoNE. Average number of paid mail subscribers during preceding 12 months,
540; for single issue nearest to filing date: 534. Average number of free copies distributed by mail
during preceding 12 months, 50; for single issue nearest to filing date:51. Average number of free
copies distributed outside the mail during the preceding 12 months, 2; for single issue nearest
filing date, 2. Percent paid and/or requested circulation during the preceding 12 months, 91.216%;
for the single issue nearest to filing date: 90.971%. Average number of copies distributed during
the preceding 12 months, 592; for single issue nearest to filing date, 587. Average number of
undistributed copies for office use during the preceding 12 months, 83; for single issue nearest
filing date, 88.

I certify that the statements made by me above are correct and complete.

Signed, Richard P. Korf, Business Manager
September 22, 2005.

MYCOTAXON is published quarterly during the periods of January-March, April-June,
July-September, and October-December by MycotTaxon, Ltp., 316 Richard Pl., Ithaca, NY
14850-0264. USPS Publication # 16-121, ISSN # 0093-4666. Periodical postage paid at Ithaca, NY,
and at additional mailing offices. Subscription rates for 2005: In U.S. and possessions, one year,

$330; reduced rate for personal subscribers, one year, $150. Foreign subscriptions, add $40 for
IMEX air mail.

POSTMASTER!
Send address changes to MycoTaxon, LTp.
P.O. Box 264, Ithaca, NY 14851-0264 USA

[Content continued from inside front cover]

Paecilomyces parvosporus, a new species with its relatives from Yunnan

Province, China Yanfeng Han, Zongqi Liang, Huali Chu & Jichuan Kang
Notes on Otidea from Xinjiang, China Wen- Ying Zhuang
Book reviews and notices David L. Hawksworth

Indices & Information

Nomenclatural novelties proposed in volume 94

Author index for volume 94

Reviewers for volume 94

Mycoraxon online resources—Index to Fungous and Lichen Taxa, cumulative
indices, distributional checklists, past volumes online, information for authors
e reviewers, search features

Errata

MycorTaxon Instructions to authors

Recent books from MycoTAxon

357
365
ov 1

os
394
398

399
400
401
412

a
a
on wa

ara “ ap snegllgre
aly t

“
+

mee a

<
er
Pa #
=e

EDITORS OR MYCOTAXON —

Lorelei L. Norvell, EptroR-IN-CHIEF duh R. perme Nomenc atone, laut
Pacific Northwest Mycology Service . -PennycookS@LandcareResearch.co.nz__
6720 NW Skyline Boulevard Manaaki Whenua Landcare Research -
Portland, OR 97229, U.S.A Auckland, New Zealand |
David L. Hawksworth Karen D. Gettelman Grégoire L. Hennebert
Book REVIEW EDITOR INDEX EDITOR FRENCH LANGUAGE EDITOR ©
MycoNova, Calle Aguila 12 510 Lake Blvd., Apt. 166 - 32 Rue delElevage —
Colonia La Maliciosa, Mataelpino Davis, CA 95616 B-1340 Ottignies - LLN
ES-28411 Madrid, Spain US.A. . ih cet Belgium _ |

MYCOTAXON is a quarterly, peer-reviewed journal devoted to mycological | taxonomy and. nomenclat
All articles are reviewed by specialists prior to submission. Publication is open to everyone. Papers may bi
English or in French. Summaries in those or any additional languages desired by the authors are given for longs
articles. Printing i is on high quel ia nee, book paper. Authors prepare: their own sdepate files after havi

Ss UBSCRIPTI ON INFORMATI ON
Current volumes contain at least 400. pages. All subscriptions are on an ‘
volumes each year. Personal subscriptions are available at a substantially reduced ate for t
to deposit their copies in a library other than their personal one within | 3 ye
the MYCOTAXON ORDER DEPARTMENT, P.O. Box 264, , Ithac
and availability of back volumes are posted on-line at <www.myco
Email from <info@mycotaxon.com>. Mycotaxon may be «
such exchanges from journals, institutions, or individuals with d
addressed to the Order Department. Vaeglabhgeacg aes
ane, angnal subscription rates for 2005 é

oa as oa B be: Se
4 ;

; REGULAR dgviitahed aa ‘ = : a ;
‘PERSONAL (individual) a ome tae
All back volumes ypeieeie volumes 22, m4, 240) 35 4

Ciarudatine Index to Taxa in 1 Volumes 61- i sad the Cun
<www. mycotaxon. com>. ; Saye

MYCOTAXON i is also partially available in mpniiryits fein National Andiee = Poblishing. geil !
napubco.com>. Tear sheets or photocopies of individual articles may be obtained from ISI Docume!
<www.isidoc.com>. Many back volumes are available as free downloads adie Lanes By)

org.uk/cyberliber/index.htm> under ‘Catalogues & Journals’ goer rrged Fee Le ieee: Cate here
CONTACTING M YCOTAXON ’S EDI TOR-IN-CHIEF BY. E-MAIL OR FAX a iT
To reach the Editor-in-Chief reper eine manuscripts, E-mail to Piiuiaaitacies com> or fae to Lore

Norvell at +503.297.3296. RUNS Ce Rare te ie Steer a hae

CONTACTING M YCOTAXON *°S ORDER DEPARTMENT B YE _MAIL OR FAX ¥
To reach the Order Department for information or placing orders, you may E- mail to <infogmycotaxon, ;

com> or you may Fax to. aba Ranta, Ltd., ci case at 1 ie aaa, and Bisdeer en —April
+727.321.1460. be TGenterca pas av

Atle

THE INTERNATIONAL JOURNAL OF FUNGAL TAXONOMY e& NOMENCLATURE

AY COTAXON

CONTENTS

‘onomic studies on Ustilaginomycetes—26 _ Kalman Vanky
Imusia ea comb. nov. on riod toads Ove E. Eriksson

Chane: -Lin Hou, Roland Kirschner & Chee-Jen Chen
ae of Pinacate and Great Altar Desert biosphere reserve Martin Esqueda,
Martha Coronado, Alfonso Sanchez, Evangelina Pérez-Silva & Tedfilo Herrera
: oe and a new record of Lycoperdaceae from India

ies Dipika Bisht, J R. Sharma, Hanns Krcise & Kanad Das

pecies revision: Mitremyces zanchianus versus Calostoma zanchianum
Turi S Baseia, eae G. Soe & es D. Calonge

"a - Zhu Li, Fatone Han & Zongqi Liang
gt ve of the genus eaukeina (Ascomycota, Pezizales, Sarcoscyphaceae)
Teresa Iturriaga & Donald H. Pfister

aus Hu, Yan Li, Minghe Mo & Keqin Zhang
Miptia Labulioinls a new species from Taiwan Sheng-Hua Wu
ulating minimum sample sizes for taxonomic measurements: examples using
manns Peronospora spore data Andrew J. Hamilton & James H. Cunnington
1 icholoma borgsjoeénse, a new species from a boreal coniferous forest in

ennoscandia | S. Jacobsson, S$. Muskos & E. Larsson
ew ey of Meliola thalliformis from Brazil Dartanha J. Soares,
Douglas Ferreira Parreira & Robert Weingart Barreto
issula i in Himalaya 2: Four new taxa Kanad Das, S.L. Miller & J.R. Sharma
¢ distinction between Menegazzia cincinnata and M. valdiviensis (Parmeliaceae)

i Mo6nica T. Adler, Susana Calvelo & John A. Elix

truffle and truffle-like fungi 13: Tuber quercicola and T: whetstonense,

: ew ae from Oregon, and T: candidum redescribed Jonathan L. Frank,
ee Darlene Southworth & James M. Trappe
NO ew species of Parmotrema (Parmeliaceae, Lichenized Ascomycota)

n Brazil Cristine G. Donha & Sionara Eliasaro
, [Content continues inside front cover]

ISSN 0093-4666 MYXNAE 95: 1-350 (2006)

For subscription details, availability on microform, and
__ availability of articles as photocopies or tear sheets, see back cover

nus scleroticus ty (Go Malcolin J. Ryley

January-March 2006

ree

113

117

133

137

181
185

189

201
205

AL?

229

241

[Content continued from front cover]
Russula siamensis: a new species of annulate Russula from Thailand
S. Yomyart, J. Piapukiew, R. Watling, A.J.S. Whalley & P. Sihanonth
Embellisia oxytropis, a new species isolated from Oxytropis kansuensis in China
Qi Wang, Hideyuki Nagao, Yu-ling Li, Hong-sheng Wang & Makoto Kakishima
Some hyphomycetes from Brazil. Two new species of Brachydesmiella, two new
combinations for Repetophragma, and new records
Rafael F. Castaiteda-Ruiz, Luis Fernando Pascholati Gusm4o,
Gabriela Heredia Abarca & Masatoshi Saikawa
Russula in Himalaya 3: A new species of subgenus Ingratula
Kanad Das, J.R. Sharma & N.S. Atri

Wallemia, a genus newly recorded from China Guangyu Sun, Miao Zhang,
Rong Zhang, Huining Ma & Mark L. Gleason
Phialophora sessilis, a lithobiont fungus Giuseppe Caretta, Solveig Tosi,

Eduardo Piontelli & G.S. de Hoog
Revision of Termitomyces species originally described from China
B.-H. Tang, T.-Z. Wei & Y.-J. Yao
Two new species of Marasmius (Basidiomycota, Marasmiaceae) from Brazil
Carla Puccinelli & Marina Capelari
Geastrum hirsutum: a new earthstar fungus with a hairy exoperidium
I.G. Baseia & ED.Calonge
Tricholoma lavendulophyllum, a new species from Yunnan, China
Fu-Qiang Yu, Yun Wang & Pei-Gui Liu
Changes and additions to the North American lichen mycota — V
Kerry Knudsen & James C. Lendemer
Four new lichens from Turkey Kenan Yazici & Ali Aslan
Two new species in the genus Morchella (Pezizales, Morchellaceae) from China
Shu-Hong Li, Yong-Chang Zhao, Hong-Mei Chai & Ming-Hui Zhong
Notes on some species of the lichen genus Lecidea from India
D.K. Upreti, S. Nayaka & M.P. Andreev
Contributions to the macrofungi of Bolu and Diizce Provinces, Turkey
Dursun Yagiz, Ahmet Afyon, Muhsin Konuk, Stephan Helfer
First isolation of Aphanomyces frigidophilus (Saprolegniales) in Europe
Isabel Ballesteros, Maria P. Martin & Javier Diéguez-Uribeondo

Indices & Information
Nomenclatural novelties proposed in volume 95
Author index
Reviewers
Errata
From the Editor-in-Chief

247

261

aie

277

281

285

293

301

305

309
315

318

323

331

335

34]
343
347
348
349

~MYCOTAXON

THE INTERNATIONAL JOURNAL OF FUNGAL TAXONOMY & NOMENCLATURE

A. R. MANN LIBRARY

JUN 2 7 2006

ITHACA, NY 14853 _

Volume 95, 2006

COMPLETE IN ONE VOLUME

CONSISTING OF VI + 350 PAGES INCLUDING FIGURES

EDITOR-IN-CHIEF

LORELEI L. NORVELL
editor@mycotaxon.com
Pacific Northwest Mycology Service
6720 NW Skyline Boulevard
Portland, Oregon 97229-1309 USA

ASSOCIATE EDITORS
NOMENCLATURE EDITOR BOOK REVIEW EDITOR
SHAUN R. PENNYCOOK Davip L. HAWKSWORTH
PennycookS@LandcareResearch.co.nz MycoNova, Calle Aguila 12
Manaaki Whenua Landcare Research Colonia La Maliciosa, Mataelpino
Auckland, New Zealand ES-28411 Madrid, Spain
FRENCH LANGUAGE EDITOR INDEX EDITOR
GREGOIRE HENNEBERT KAREN D. GETTELMAN
32 Rue de l’Elevage 510 Lake Blvd., Apt. 166
B-1340 Ottignies - LLN, Belgium Davis, CA 95616 U.S.A.

EDITORIAL ADVISORY BOARD

Dona.p H. PFISTER, Cambridge, Massachusetts, USA (1997-2007), Chair
Gary J. SAMUELS, Beltsville, Maryland, USA (1997-2006), Past Chair
WEN-YING ZHUANG, Beijing, China (2003-2008)

CAROL A. SHEARER, Urbana, Illinois, USA (1998-2009)

SHAUN Ross PENNYCOOK, Auckland, New Zealand (2005-2010)
SEPPO HUHTINEN, Turku, Finland (2006-2011)

Published by
MYCOTAXON, LTD, P. O. BOX 264
Ithaca, NY 14581-0264, USA

www.mycotaxon.com
Printed in the United States of America
© Mycotaxon, Ltd, 2006

MYCOTAXON

VOLUME NINETY~-FIVE TABLE OF CONTENTS

Taxonomic studies on Ustilaginomycetes—26 Kalman Vanky
Kalmusia amphiloga comb. nov. on Bambusa Ove E. Eriksson
A new species and new records of Rhytismatales from Taiwan

Cheng-Lin Hou, Roland Kirschner & Chee-Jen Chen
Macromycetes of Pinacate and Great Altar Desert biosphere reserve

Martin Esqueda, Martha Coronado, Alfonso Sanchez,
Evangelina Pérez-Silva & Teofilo Herrera
A new species and a new record of Lycoperdaceae from India

Dipika Bisht, J.R. Sharma, Hanns Kreisel & Kanad Das
Notes on the type, synonyms, and other specimens of the balansioid fungus,
Nigrocornus scleroticus Malcolm J. Ryley
Rick's species revision: Mitremyces zanchianus versus Calostoma zanchianum
[uri G. Baseia, Vagner G. Cortez & Francisco D. Calonge
Taxonomic studies on Indian Phellinus s.l. species: parsimony analysis using
morphological characters Prasad Lamrood & Aristételes Gdes-Neto
Paecilomyces verticillatus, a new species isolated from soil in China
Zhu Li, Yanfeng Han & Zongqi Liang
A monograph of the genus Cookeina (Ascomycota, Pezizales, Sarcoscyphaceae)
Teresa Iturriaga & Donald H. Pfister
A new nematode-trapping hyphomycete of Arthrobotrys
Weifeng Hu, Yan Li, Minghe Mo & Keqin Zhang
Hyphodontia tubuliformis, a new species from Taiwan Sheng-Hua Wu

Calculating minimum sample sizes for taxonomic measurements: examples using
Gaumann’s Peronospora spore data

Andrew J. Hamilton & James H. Cunnington
Tricholoma borgsjoeénse, a new species from a boreal coniferous forest in
Fennoscandia S. Jacobsson, S. Muskos & E. Larsson
A new variety of Meliola thalliformis from Brazil
Dartanha J. Soares, Douglas Ferreira Parreira & Robert Weingart Barreto

Russula in Himalaya 2: Four new taxa _—‘ Kanad Das, S.L. Miller & J.R. Sharma

The distinction between Menegazzia cincinnata and M. valdiviensis (Parmeliaceae)

Monica T. Adler, Susana Calvelo & John A. Elix
NATS truffle and truffle-like fungi 13: Tuber quercicola and T. whetstonense,
new species from Oregon, and T: candidum redescribed

Jonathan L. Frank, Darlene Southworth & James M. Trappe

ill

a7,

1h)

133

TSF

181
185

189

195

201
205

Ze?

IV
Two new species of Parmotrema (Parmeliaceae, Lichenized Ascomycota)
from Brazil Cristine G. Donha & Sionara Eliasaro
Russula siamensis: a new species of annulate Russula from Thailand
S. Yomyart, J. Piapukiew, R. Watling, A.J.S. Whalley & P. Sihanonth
Embellisia oxytropis, a new species isolated from Oxytropis kansuensis
in China Qi Wang, Hideyuki Nagao, Yu-ling Li,
Hong-sheng Wang & Makoto Kakishima
Some hyphomycetes from Brazil. Two new species of Brachydesmiella, two new
combinations for Repetophragma, and new records
Rafael F. Castaneda-Ruiz, Luis Fernando Pascholati Gusmao,
Gabriela Heredia Abarca & Masatoshi Saikawa
Russula in Himalaya 3: A new species of subgenus Ingratula
Kanad Das, J.R. Sharma & N.S. Atri
Wallemia, a genus newly recorded from China Guangyu Sun, Miao Zhang,
Rong Zhang, Huining Ma & Mark L. Gleason
Phialophorea sessilis, a lithobiont fungus Giuseppe Caretta, Solveig Tosi,
Eduardo Piontelli & G.S. de Hoog
Revision of Termitomyces species originally described from China
B.-H. Tang, T.-Z. Wei & Y.-J. Yao
Two new species of Marasmius (Basidiomycota, Marasmiaceae) from Brazil
Carla Puccinelli & Marina Capelari
Geastrum hirsutum: a new earthstar fungus with a hairy exoperidium
I.G. Baseia & ED.Calonge
Tricholoma lavendulophyllum, a new species from Yunnan, China
Fu-Qiang Yu, Yun Wang & Pei-Gui Liu
Changes and additions to the North American lichen mycota - V
Kerry Knudsen & James C. Lendemer
Four new lichens from Turkey Kenan Yazici & Ali Aslan
Two new species in the genus Morchella (Pezizales, Morchellaceae) from China
Shu-Hong Li, Yong-Chang Zhao, Hong-Mei Chai & Ming-Hui Zhong
Notes on some species of the lichen genus Lecidea from India
D.K. Upreti, S. Nayaka & M.P. Andreev
Contributions to the macrofungi of Bolu and Diizce Provinces, Turkey
Dursun Yagiz, Ahmet Afyon, Muhsin Konuk, Stephan Helfer
First isolation of Aphanomyces frigidophilus (Saprolegniales) in Europe
Isabel Ballesteros, Maria P. Martin & Javier Diéguez-Uribeondo

241

247

261

281

205

295

301

305

309

els

323

33i]

385

Indices & Information
Nomenclatural novelties proposed in volume 95
Author index
Reviewers
Errata
From the Editor-in-Chief

PUBLICATION DATE FOR VOLUME NINETY-FOUR

MYCOTAXON for OcTOBER-DECEMBER, VOLUME 94 (1-412 + I-VI)
was issued on May 11, 2006

MYCOTAXON

Volume 95, pp. 1-65 January-March 2006

Taxonomic studies on Ustilaginomycetes - 26

KALMAN VANKY

vanky.k@cityinfonetz.de
Herbarium Ustilaginales Vanky (HUV)
Gabriel-Biel-Str. 5, D-72076 Tiibingen, Germany

Abstract—Fifteen new species of smut fungi are described: Doassansiopsis tomasii,
Microbotryum afromontanum, Pilocintractia adrianae, Sporisorium andropogonis-
chinensis, S. andropogonis-eucomi, S. andropogonis-pumili, S. distachyum, S. ingoldii,
S. livingstoneanum, S. scholzii, Ustanciosporium virginianum, Ustilago gabonensis,
U. penniseti-purpurei, U. pentaschistidis, U. trichogena. New names proposed are:
Sporisorium andropogonis-gabonensis and S. clintonianum. New combinations
are: Heterodoassansia hygrophilae, Sporisorium andropteri, S. sanctae-catharinae,
S. semisagittatum, S. sorghastri, S. zilligii, Ustilago jardineae. Taxa placed in synonymy
are: Entyloma lavrovianum, Leucocintractia leucodermoides, Pericladium flavesci,
Sorosporium chloridicola, S. platense, Sphacelotheca rhaphidis, Tilletia cynodontis,
Ustilago andropogonis-hirtifolii, U. liebenbergii. A lectotype is designated for Ustilago
chloridicola. Keys are given to the species of Pilocintractia and to the smut fungi of
Andropogon, Chloris, Jardinea, Leptochloa, Nymphaea, Phacelurus, Rhytachne, and
Sorghastrum.

Key words—nomenclature, smut fungi, synonym, taxonomy

The smut fungi of Andropogon (Poaceae)

Andropogon L. is a genus with about 100 species in the tropics belonging to the subfam.
Panicoideae, tribe Andropogoneae, subtribe Andropogoninae (Clayton & Renvoize,

- 1986:349). Numerous smut fungi have been described on it. Zundel (1930), in his

monograph of the Ustilaginales attacking Anropogon, recognised 76 species. Since 1930,
the classification of both the grasses and the smut fungi has changed considerably.
Many “Andropogon” species in Zundel’s paper do not belong to this genus any more,
and many smut fungi do not belong to the genus under which they were treated by
Zundel. On Andropogon s. str. 32 species of smut fungi could be distinguished, including
6 new species. At the same time, Sorosporium platense was found to be a synonym of
Sporisorium andropogonis, and Ustilago andropogonis-hirtifolii a synonym of Sporisorium
stuhlmannii.

The smut fungi of Andropogon were compared also with the six smut fungi described
on the closely related Schizachyrium (comp. Vanky, 2003:36-43; 2004a:74). These six
species proved to be distinct from the species on Andropogon. However, several smut
fungi occur on both Andropogon and Schizachyrium species. The recognised smut fungi
of Andropogon are:

1. Jamesdicksonia brunkii (Ellis & Galloway) J. Walker & R.G. Shivas, 1998:1212.
Ustilago brunkii Ellis & Galloway, March 1890:31. — Tolyposporella brunkii (Ellis &
Galloway) G.P. Clinton, 1902:147. — Tilletia brunkii (Ellis & Galloway) Duran,
1972:2572 (invalid comb., no basionym and place of publication indicated; ICBN
33.2). — Type on Andropogon argenteus (= A. ternarius), USA, Texas, Brazos Co.,
College Station, 1890, H.S. Jennings, BPI 192453.
Ustilago apiculata Ellis & Galloway, in Jennings, May 1890:29. — Type on Andropogon
saccharoides, USA, Texas, Brazos Co., College Station, 1890, H.S. Jennings, BPI
192453; isotype BPI 157287! (syn. by Clinton, 1902:129, confirmed).

Sori on the adaxial surface of the leaf sheaths, forming striae fusing into a blackish-
brown, agglutinated to granular-powdery coat of spore masses, showing through the
outer surface of the leaf sheaths, between the veins, as pale lead coloured striae of various
length. Spores globose, subglobose to ovoid (in some specimens to subpolyhedrally
irregular), extremely variable in size, 10-18 x 10-20(-24) um in diameter, yellow to dark
reddish-brown; wall 3-8 um thick, composed of a homogenous, uniform endospore of
1-2 um, and a multilayered, smooth exospore, sometimes with a short, hyaline papilla.
(Spore measurements made in unheated lactophenol because in heated lactophenol or
in water the spore wall and the spores swell considerably). Spore germination (Duran,
1972:2572, fig. 17; Bauer et al., 2001:420, fig. 9) results in holobasidia producing apically
4-8, allantoid, fusiform, symmetrical, septate basidiospores which do not fuse but
germinate apically producing ballistoconidia. Asymmetrical ballisto basidiospores are
also produced on the basidia on sterigmata.

On Andropogon barbinodis Lag. (Bothriochloa barbinodis (Lag.) Herter; A. saccharoides

Sw. var. barbinodis (Lag.) Hack.; A. saccharoides Sw. var. leucopogon (Nees) Hack.), A

bicornis L., A. gerardii Vitman, A. hirtiflorus (Nees) Kunth var. pubiflorus (Nees) Kunth,

A. perforatus Trin. ex Fourn., A. saccharoides Sw. (A. torreianus Steud.; Bothriochloa

saccharoides (Sw.) Rydb.), A. ternarius Michx. (A. argenteus Ell.; A. argyraeus Schult.),

Dichanthium sericeum (R. Br.) A. Camus, D. sericeum subsp. polystachyum (Benth.)

B.K. Simon, Schizachyrium hirtiflorum Nees (Andropogon hirtiflorus (Nees) Kunth; S.

sanguineum (Retz.) Alston var. hirtiflorum (Nees) S.L. Hatch); Australia, N., C. & S.

America, West Indian Antilles.

2. Jamesdicksonia caribensis M. Piepenbring, 2003:220.

Type on Andropogon bicornis, Dominican Republic, Azua Prov., Cordillera Central, La
Cumbre, 3.III.1930, E.L. Ekman, S; isotype BPI 192463!

Sori forming striae on the leaves and leaf sheaths, linear, 0.2-0.5 x 1-5 mm, or longer by
confluence, initially covered by the epidermis which ruptures longitudinally disclosing
the black, agglutinated to granular spore mass. Spores very variable in shape and size,
globose, ellipsoidal, lemon-shaped or irregular, often with appendages, 7-14 x 8-16(-18)
uum, light to medium dark olivaceous-brown; wall uneven, 1.5-6.5 um thick, including a
thin, uniform endospore, and a multilayered, smooth exospore of variable thickness.

On Andropogon bicornis L.; West Indian Antilles (Dominican Rep., Puerto Rico).

Jamesdicksonia caribensis differs from J. brunkii in having smaller and more irregular
spores and a thinner spore wall.

3. Macalpinomyces ovariicolopsis (Vanky) Vanky, 2002a:427.
Sporisorium ovariicolopsis Vanky, 2000:203. — Type on Andropogon gayanus, Zimbabwe,
Matabeleland North Prov., 12 km N of Lusulu, alt. 1010 m, 16.III.1999, C. & K. Vanky,
HUV 18903!; isotypes BPI 746891, IMI 380467, S.

Sori in sessile spikelets, infecting only a few in the inflorescence, leaving intact the
outermost floral envelopes, lemon-shaped or obovoid with acute or subacute tip,
3-5 x 5-10 mm, covered by a thick, initially green later brown peridium of host and
fungal origin which ruptures and opens irregularly disclosing the agglutinated to
semi-powdery, dark brown mass of spores intermixed with sterile cells. The sori start
to develop at the basal part of the ovaries. The distal part of the seeds may persist on
the top of young sori as an acute tip. Spores single when mature, subglobose, ovoid or
ellipsoidal, (5.5-)6.5-8(-9.5) x (6.5-)7-11 tm, yellowish-brown; wall even, 1-1.5 um
thick, prominently, rather densely echinulate. Sterile cells in loose, irregular groups or in
short rows, single cells subglobose, ovoid or irregular, with one or two flattened sides,
5-9 x 6-11(-14) um, hyaline; wall thin, c. 0.5 um, smooth.
On Andropogon gayanus Kunth; Africa (Malawi, Zambia, Zimbabwe).

4. Sporisorium andropogonis (Opiz) Vanky, 1985:113.

Uredo (Ustilago) andropogonis Opiz, 1824:43 (as ‘andropogi’). — Sphacelotheca
andropogonis (Opiz) Bubak, 1912:25. — Cintractia andropogonis (Opiz) Kochman,
1936:75. — Type on Andropogon angustifolius (= Dichanthium ischaemum), Czech
Rep., Dablizerberg [Dablice] Mt., near Prague, F.M. Opiz.

For taxonomic synonyms such as Ustilago ischaemi Fuckel, U. cylindrica Peck, U.
bothriochloae-intermediae Padwick, Sphacelotheca chloridis Mundk., S. heteropogonis-
triticei L. Ling, S. bothriochloae Y.C. Wang, Sorosporium baluchistani S. Ahmad, see
Vanky, 2004b:226-227.

Sorosporium platense Hirschhorn, 1941:348 (as ‘platensis’). — Sphacelotheca platensis
(Hirschh.) Hirschhorn, 1986:129. — Type on Andropogon saccharoides, Argentina,
Buenos Aires, Fac. de Agron. y Veter., XII.1936, E. Hirschhorn, Herb. Hirschhorn 363;
isotype LPS 3057! (syn. nov.).

Sori usually destroying the entire inflorescence, rarely confined to the spikelets, cylindrical
or bifurcate at their distal part, 1-10 mm wide, 1.5-7 cm long, partly hidden by the
terminal leaf sheath, initially covered by a well developed, yellowish-brown peridium
which ruptures irregularly and flakes away disclosing the dark brown, semiagglutinated
to powdery mass of spore balls, spores and groups of sterile cells surrounding a simple
or ramified, irregular columella of the length of the sorus, the remnants of the floral
axis and branches. Infection systemic. Spore balls loose, subglobose, ellipsoidal, oblong
or irregular, 20-100 x 40-160 um, dark reddish-brown, composed of tens of spores
which separate very easily. Spores single when mature, globose, ovoid, ellipsoidal
to slightly irregular, (6.5-)7-10 x 7.5-11 um, light olivaceous-brown; wall even, 0.5-1
tum thick, finely, densely punctate-verruculose, spore profile smooth to wavy, in SEM
spores minutely echinulate, between the spines, finely and densely verruculose. Spore
germination (Brefeld, 1883:96, Pl. XI, figs. 1-2; Vanky, Deml & Oberwinkler, 1988:185)
results in four-celled basidia on which lateral and terminal basidiospores are produced.
Sterile cells in irregular groups or chains among the spores and also forming the
peridium, globose to irregularly polygonal, flattened on contact sides, 6-16(-22) um

long, subhyaline to yellow tinted, with numerous droplets, collapsed in old specimens;

wall even, 0.5-1 tm thick, smooth.

On Andropogon arctatus Chapm., A. barbinodis Lag., A. chinensis (Nees) Merr., A.
imperatoides (Hack.) Lillo, A. liebmannii Hack., Andropogon sp., Bothriochloa bladhii
(Retz.) S.T. Blake (B. glabra (Roxb.) A. Camus), B. caucasica (Trin.) C.E. Hubb., B. decipiens
(Hack.) C.E. Hubb., B. ewartiana (Domin) C.E. Hubb., B. intermedia (R. Br.) A. Camus,
B. pertusa (L.) A. Camus, Dichanthium annulatum (Forssk.) Stapf, D. insculptum (A.
Richard) Clayton (Andropogon pubescens Vis.), D. ischaemum (L.) Roberty (Andropogon
angustifolius Sibth. & Sm.; A. ischaemum L.; B. ischaemum (L.) Keng), Diheteropogon
amplectens (Nees) Clayton (Andropogon amplectens Nees), Heteropogon contortus (L.)
P. Beauv. ex Roem. & Schult., H. triticeus (R. Br.) Stapf ex Craib; cosmopolitan (Europe,
Africa, Asia, Australia, N., C. & S. America).

Fig. 1. Sori of Sporisorium andropogonis-chinensis in all sessile and pedicelled spikelets of
Andropogon chinensis (type). Habit, and enlarged two infected spikelets. To the left a healthy
inflorescence. Bars = 1 cm for habit, and 2 mm for the detail drawing.

5. Sporisorium andropogonis-chinensis Vanky, sp. nov.
Typus in matrice Andropogon chinensis (Nees) Merr., Zambia, Eastern Prov., 407 km
ENE urbe Lusaka, 14°16°54” S, 31°37'41” E, alt. 1070 m.s.m., 18.1V.2001, leg. C., T. & K.
Vanky. Holotypus in Herbario Ustil. Vanky, HUV 21063!

Sori in spiculis et sessilibus et pedicellatis eiusdem inflorescentiae, longe ellipsoidales, cca.
1 x 3-5 mm, involucris floralibus plus-minus obtecti, peridio pallide brunneo cooperti, quo
irregulariter rupto massam atrobrunneam, semiagglutinatam usque granuloso-pulveream
glomerulorum sporarum et sporarum columellam compactam, attenuatam, saepe apice
breviter bifurcatam circumdantium ostendentes. Glomeruli sporarum globosi, ovoidei
usque late ellipsoidales, 20-30 x 25-40(-50) um, flavidobrunnei, e 10-50(?) sporis leviter
dissociabilibus compositi. Sporae dimorphae: externae earum globosae, subglobosae,
ellipsoidales usque parum irregulares, 6,5-9 x 7,5-10,5 um, flavidobrunneae; pariete
inaequali, 0,5-1 um crasso, in superficie externa crassiore, moderate dense prominenter
verruculoso, imago obliqua eorum serrata. Sporae internae forma et magnitudine sporis
externis cca. aequales, pallide flavidobrunneae; pariete aequali, 0,2-0.3 um crasso, levi.
Cellulae steriles absentes.

Sori (Fig. 1) in all, sessile and pedicelled spikelets of an inflorescence, long ellipsoidal,
c. 1x 3-5 mm, more or less hidden by the floral envelopes and covered by a pale brown
peridium which ruptures irregularly disclosing the dark brown, semiagglutinated
to granular-powdery mass of spore balls and spores surrounding a stout, narrowing
columella, often with a shortly bifurcate tip. Spore balls (Figs. 4, 5) globose, ovoid to
broadly ellipsoidal, 20-30 x 25-40(-50) um, yellowish-brown, composed of 10-50(?)
spores which separate easily. Spores (Figs. 4, 5) dimorphic, outer spores globose,
subglobose, ellipsoidal to slightly irregular, 6.5-9 x 7.5-10.5 um, yellowish-brown; wall
uneven, 0.5-1.5 um, thicker on the free surface which is moderately densely, prominently
verrucose, spore profile serrate. Inner spores about the shape and size of the outer spores,
pale yellowish-brown; wall even, 0.2-0.3 um thick, smooth. Sterile cells absent.

On Andropogon chinensis (Nees) Merr; C. Africa. Known only from the type

collection.

6. Sporisorium andropogonis-eucomi Vanky, sp. nov.
Typus in matrice Andropogon eucomus Nees, South Africa, Mpumalanga Prov., 9 km
NE urbe Graskop, via R534, 24°51’50” S, 30°51'21” E, alt. 1590 m.s.m., 22.1.1997, leg. C.
e& K. Vanky. Holotypus in Herbario Ustil. Vanky, HUV 21060; isotypi in BPI, BRIP, IMI,
PREM.

Sori inflorescentiam totam destruentes, cylindrici, cca. 1 x 6-12 mm, vagina folii supremi
obtecti, propter hoc tantum apicibus eorum protrudentes, primo peridio flavidobrunneo
cooperti, quo irregulariter rupto massam semiagglutinatam usque granuloso-pulveream,
nigram glomerulorum sporarum et columellarum nonnullarum filiformium, tenuium
ostendentes. Glomeruli sporarum subglobosi, ovoidei, ellipsoidales, elongati vel parum
irregulares, (20-)25-40 x (25-)30-50 um, atro-rubrobrunnei, e sporis (2-)4-15(-20?)
pressu separantibus compositi. Sporae in glomerulis magnis, dimorphae, externae earum
subglobosae, ovoideae, ellipsoidales usque parum irregulares, 12-15 x 13,5-18.5(-20)
um, atro-rubrobrunneae; pariete inaequali, 0,8-2,5(-3) um crasso, in superficie externa
verrucis magnis moderate dense distributis, in lateribus contactis leniter verrucoso. Sporae
internae subpolyedricae, magnitudine eadem sporarum externarum cca. aequales, sed
colore pallidiores; pariete tenuiori, aequali vel inaequali, leniter punctato-verruculoso.
Cellulae steriles absentes.

Fig. 2. Sori of Sporisorium andropogonis-
eucomi in all inflorescences of
Andropogon eucomus (type). To the left
some healthy inflorescences.

Bar = 1 cm.

Sori (Fig. 2) destroying the whole inflorescence, cylindrical, c. 1 x 6-12 mm, hidden
by the uppermost leaf sheath from which only the tip of the sori protrudes, at first
_ covered by a yellowish-brown peridium which ruptures irregularly disclosing the black,
semiagglutinated to granular-powdery mass of spore balls and several filiform, slender
columellae. Spore balls (Figs. 6, 7) subglobose, ovoid, ellipsoidal, elongate or slightly
irregular, (20-)25-40 x (25-)30-50 um, dark reddish-brown, composed of (2-)4-15(-20?)
spores that separate by pressure. Spores (Figs. 6, 7) in larger balls dimorphic, outer
spores subglobose, ovoid, ellipsoidal to slightly irregular, 12-15 x 13.5-18.5(-20) pm,
dark reddish-brown; wall uneven, 0.8-2.5(-3) tm thick, with moderately densely
situated, large warts on the free surface, finely verrucose on the contact sides. Inner
spores subpolyhedral, about the size of the outer spores, paler coloured; wall thinner,
even or uneven, finely punctate-verruculose. Sterile cells absent.

On Andropogon eucomus Nees; S. Africa. Known only from the type collection.
Sporisorium andropogonis-eucomi is closest to S. pseudomaranguense (type on
Andropogon sp., South Africa), from which it differs especially by fewer spores in the
balls and larger spores with thicker spore wall.

7. Sporisorium andropogonis-gabonensis Vanky, nom. nov.
Replacing Sorosporium congoense L. Ling, Lloydia 16:186, 1953a (not Sporisorium congense

(Syd. & P. Syd.) Vanky, type on Hyparrhenia diplandra). — Type on Andropogon

gabonensis, Congo, N. Dembo, VI.1906, H. Vanderyst B32, BR 339! Paratypes on

Andropogon gabonensis, Congo, N. Dembo, 23.V1.1908, H. Vanderyst, BR 275; Congo,

Kinshasa, 4.V1.1906, H. Vanderyst, BR 1326.
Sori in the spikelets protruding beyond the enveloping glumes, cylindrical, c. 1.5 x
7-18 mm, initially covered by a greyish-brown peridium which ruptures from its apex
disclosing the dark brown, semiagglutinated to powdery mass of loose spore balls and
spores surrounding several filiform columellae. Spore balls globose, ovoid, ellipsoidal,
oblong or irregular, 30-75 x 30-100 pm, dark reddish-brown, composed of tens of spores
which separate easily. Spores globose, subglobose, ovoid, ellipsoidal to slightly irregular,
6-9 x 7-10 um, pale reddish-brown; wall uneven, 0.5-1 tm thick, sparsely, prominently,
low verrucose, spore profile smooth to finely wavy. Sterile cells not seen.

On Andropogon gabonensis Stapf; C. Africa (Congo).

The specific epithets congoense and congense are confusingly similar and are considered
as orthographic variants (homonyms), hence the proposed new name andropogonis-
gabonensis (ICBN Art. 53.3).

8. Sporisorium andropogonis-pumili Vanky, sp. nov.
Typus in matrice Andropogon pumilus Roxb., India, Maharashtra State, Pune (Poona),
2 km SW of M.A.C.S., 18°34 N, 73°58’ E, alt. cca. 600 m, 23.X.1992, leg. C. & K. Vanky.
Holotypus in Herbario Ustil. Vanky, HUV 21041! Paratypus: 15 km W urbe Pune, National
Defence Academy, 18°34’ N, 73°50’ E, alt. cca. 720 m, 20.X.1992, leg. C. & K. Vanky, HUV
21040!

Sori in spiculis nonnullis et sessilibus et pedicellatis inflorescentiae eiusdem, cylindrici,
saepe parum arcuati, 0,5-1 x 4-10 mm, involucris floralibus partim obtecti, primo peridio
crasso, cremeo cooperti, quo ab apice eius irregulariter rupto massam glomerulorum
sporarum nigrescentibrunneam primo agglutinatam, serius granulosopulveream,
columellam centralem longam, filiformem, simplicem circumdantem ostendentes.
Glomeruli sporarum forma et magnitudine varii, subpolyedrice irregulares, elongati,

Fig. 3. Sori of Sporisorium andropogonis-pumili in some sessile and pedicelled spikelets of
Andropogon pumilus (type). Bar = 1 cm.

rarius ovoidei vel ellipsoidales, 30-100 x 40-130 um, atro-rubrobrunnei usque subopaci,

permanentes, e pluribus decem sporis pressu difficiliter separabilibus compositi. Sporae

dimorphae: externas earum subglobosae, ellipsoidales usque subpolyedrice irregulares,

9-12,5 x 10,5-14,5 um, uniformiter flavidobrunneae; pariete sine ornamentis aequaliter

cca. 0,5 um crasso, pariete libero cum ornamentis 1,5-3 um crasso: etiam sub LM conspicue

cum verrucis dense dispositis, filiformibus, 1-2,5 um longis, in medio superficiei liberae

altissimis, pariete contacto cca. 0,5 um crasso apparenter levi, sub SEM valde leniter

verruculoso. Sporae internae rotundae, subpolyedriciter irregulares, magnitudine cellulis

externis cca. aequales, pallide flavidobrunneae; pariete aequali, tenui (cca. 0,3 um), levi.

Cellulae steriles absentes.
Sori (Fig. 3) in some sessile and pedicelled spikelets of an inflorescence, cylindrical, often
slightly bent, 0.5-1 x 4-10 mm, partly hidden by the floral envelopes, initially covered
by a thick, cream coloured peridium which ruptures irregularly from its apex disclosing
the blackish-brown, first agglutinated later granular-powdery mass of spore balls
surrounding a long, filiform, simple, central columella. Spore balls (Figs. 8, 9) varying
in shape and size, subpolyhedrally irregular, elongated, more rarely ovoid or ellipsoidal,
30-100 x 40-130 um, dark reddish-brown to subopaque, permanent, composed of tens
of spores separating with difficulty by pressure. Spores (Figs. 8, 9) dimorphic, outer
spores subglobose, ellipsoidal to subpolyhedrally irregular, 9-12.5 x 10.5-14.5 um,
uniformly yellowish-brown; the wall without ornamentation is uniformly c. 0.5 um
thick, with ornamentation the free wall is 1.5-3 um thick, as seen by LM provided with
densely situated, filiform, 1-2.5 um long warts, highest in the middle of the free surface,
contact walls apparently smooth, in SEM very finely verruculose. Inner spores rounded,
subpolyhedrally irregular, about the size of the outer spores, pale yellowish-brown; wall
even, thin (c. 0.3 um), smooth. Sterile cells absent.

On Andropogon pumilus Roxb.; S. Asia (India).
Sporisorium andropogonis-pumili is closest to S. everhartii, from which it differs especially
by the morphology of the outer spores. In S. everhartii these are 8-15 um long, medium
dark reddish-brown with paler and darker areas, caused by the uneven, 0.5-1.5 (-2.5)
um thick wall, and the warts of the free surface are up to only 0.5 ym high.

9. Sporisorium andropogonis-schirensis (L. Ling) Vanky, 2005a:262.

Sphacelotheca andropogonis-schirensis L. Ling. 1953a:181. — Type on Andropogon
schirensis, Congo, Bandundu, II.1914, H. Vanderyst 3555, BR 1349; isotypes in BPI
193953, K, HUV 18276!

Sori in all spikelets of an inflorescence, ellipsoidal, 1-1.5 x 2-3.5 mm, evident between the
spreading glumes, initially covered by a brown, rather thick peridium which ruptures
from its apex disclosing the dark brown, semiagglutinated to powdery mass of loose
spore balls, spores and groups of sterile cells, surrounding a stout, tapering columella.
Spores single when mature, subglobose, ellipsoidal, ovoid to slightly irregular, 6.5-9 x
7-10.5(-11) um, yellowish-brown; wall even, 0.5-0.7 tm thick, finely, rather sparsely
to moderately densely verruculose-echinulate, spore profile in LM smooth, in SEM,
between the small spines finely, densely verruculose. Sterile cells in irregular groups,
collapsed in old specimens, single cells 7-15.5 jum long, hyaline; wall thin (c. 0.5 um),
smooth.

On Andropogon appendiculatus Nees, A. schirensis A. Rich.; C. & S. Africa. (Congo,

South Africa).

10. Sporisorium andropogonis-tectorum (L. Ling) Vanky, 2004a:106.
Ustilago andropogonis-tectorum L. Ling, 1953b:152. — Type on Andropogon tectorum,

Sierra Leone, Hill Station, 27.VIL.1941, EC. Deighton M2302, IMI 10966; isotype

BPI 157098. Paratype on Andropogon tectorum, Nigeria, 1936, J. West 69, IMI 44426;

isoparatype HUV 17809!
Sori destroying the whole young floral shoots, transforming each into an elongated,
somewhat curved, up to 20 cm long, whip-like structure, initially covered by the epidermis
which flakes away disclosing the olivaceous-brown, semiagglutinated to powdery mass
of spores intermixed with sterile cells, produced around a stout, narrowing columella
with longitudinal furrows. Spores globose, subglobose, often flattened on one side,
7.5-9.5 x 8-10.5(-12) um, yellowish-brown; wall slightly thinner on one side, 0.4-0.8 um
thick, finely, densely verrucose-echinulate, spore profile wavy to finely serrulate. Sterile
cells in irregular groups, single sells 8-16 tm long, subhyaline, usually collapsed; wall c.
1 um thick, smooth.

On Andropogon tectorum Schum.; Africa.

11. Sporisorium bicornis (Henn.) Vanky 1996:103.
Ustilago bicornis Henn., in Pazschke, 1896a:50. — Sphacelotheca bicornis (Henn.) Zundel,

1930:140. — Type on Andropogon bicornis, Brazil, Campo Bello, IV.1894, E. Ule

2079:
Sori in considerably swollen spikelets of a few racemes of an inflorescence, appearing as
witches’ brooms. Single sori long-cylindrical, 0.5-1 x 10-30 mm, curved, first covered
by a thick, brown, fungal peridium which ruptures from its distal part disclosing the
chocolate-brown, powdery mass of loose spore balls and spores surrounding a well
developed central columella. Spores single when mature, globose, subglobose, ovoid,
ellipsoidal or slightly irregular, 6-9.5 x 6.5-11(-12) um yellowish-brown; wall even, 0.5-1
jum thick, moderately densely punctate to echinulate, spore profile smooth to finely wavy.
Sterile cells few among the spores, varying in shape and size, 4-12 um long, hyaline, thin-
walled (c. 0.5 um), smooth, forming shorter or longer chains.

On Andropogon bicornis L.; S. America (Brazil, Colombia).

In its appearance, Sporisorium bicornis resembles S. holwayi from which it differs
especially by spore measurements, which in S. holwayi are 9-14 x 10-16(-18) um.

12. Sporisorium braziliense (Zundel) M. Piepenbring, 2002a:54 (as ‘braziliensis’).
Sphacelotheca braziliensis Zundel, 1931:297. — Type on Andropogon leucostachyus, Brazil,
State Minas Gerais, Serra do Cipo, 28.III.-1.IV.1925, A. Chase 9168, BPI 177294!;
isotype BPI 177295!
Sphacelotheca macrotrichis Zundel, 1933:354 (as ‘macrothricis’). — Type on Andropogon
macrothrix, Brazil, State Minas Gerais, Uberlandia (Uberabinha), 15.]II.1930, A.
Chase 11253, BPI 178070!; isotype BPI 178069! (syn. by Piepenbring, 2003:90).

Figs. 4, 5, Spore balls and spores of Sporisorium andropogonis-chinensis on Andropogon chinensis,
in LM and in SEM (type).

Figs. 6, 7. Spore balls and spores of Sporisorium andropogonis-eucomi on Andropogon eucomus, in
LM and in SEM (type).

Figs. 8, 9. Spore balls and spores of Sporisorium andropogonis-pumili on Andropogon pumilus, in
LM and in SEM (type). Bars = 10 um.

Sori in all spikelets of an inflorescence, cylindrical, 0.8-1.5 x 3-5 mm, first covered by a
thin greyish peridium which ruptures irregularly disclosing the dark brown, powdery
mass of loose spore balls and spores, surrounding a flagelliform central columella. Spores
single when mature, globose, ovoid, ellipsoidal, slightly flattened on one side (6.5-9 um
wide), 8.5-12 x 9-14 um, light to medium dark yellowish-brown; wall 0.5-1.2 um thick,
thinner on the flattened side, moderately densely verrucose-echinulate, spore profile
wavy. Sterile cells among the spores not seen.

On Andropogon leucostachyus Kunth, A. macrothrix Trin., Andropogon sp.; S. America

(Brazil).

13. Sporisorium culmiperdum (J. Schrot.) Vanky, 1993:40.
Ustilago culmiperda J. Schrét. in Hennings, 1896b:212. — Sphacelotheca culmiperda (J.
Schrot.) G.P. Clinton, in Zundel, 1930:143. — Type on Andropogon bicornis, Brazil,
Santa Catarina, near Joinville, V.1883, E. Ule 1627, BPI 159932; isotypes BPI 194444,
195257.
Sori in the whole inflorescence, long linear, 1-2 mm wide, 3-7 cm long, partly hidden
by the terminal leaf sheath, first covered by a dark brown peridium which flakes away
revealing a blackish-brown, dusty spore mass surrounding a well-developed, often bent
columella. Spores globose, subglobose to ovoid, 12-18 x 14-19 um, medium to dark
reddish-brown with a paler, rounded area (germ pore) of 5-7 um diameter; wall 1.5-2
tum thick, thinner at the paler areas, surface finely, densely verrucose-echinulate. Spore
germination (Piepenbring, 1996:97) results in four- to several-celled basidia, producing
basidiospores. Sterile cells absent. :
On Andropogon bicornis L., A. gerardii Vitman var. hondurensis R.W. Pohl, A. glomeratus
(Walter) Britton, Stern. & Poggenb.; N., C. & S. America.

14. Sporisorium distachyum Vanky, sp. nov.

Typus in matrice Andropogon distachyos L., Ethiopia, Arsi Reg., 241 km SE urbe Addis
Abeba, 77 km S pag. Asela, 07°22’57.3” N, 39°15°08.9” E, alt. 2985 m.s.m., 4.X1I.2004,
leg. T. & K. Vanky. Holotypus in Herbario Ustil. Vanky, HUV 20909; isotypi in Vanky,
Ust. exs. no. 1286. Paratypus in matrice Andropogon abyssinicus Fresen., Ethiopia, Arsi
Reg., 162 km SE urbe Addis Abeba, 2 km N pag. Asela, 07°59'14.9” N, 39°08’39.6” E, alt.-
2345 m.s.m., 3.X1.2004, leg. T. & K. Vanky, HUV 20908; isoparatypi in Vanky, Ust. exs.
no. 1287.

Sori in spiculis omnibus et sessilibus et pedicellatis inflorescentiae eiusdem, organa
interna floralia destruentes, inter involucra distantia floralia prominentes, cilindrici, cca.
1 x 2-4 mm, primo peridio atrobrunneo cooperti, quo mature ab apice rupto massam
glomerulorum sporarum nigram, semiagglutinatam usque pulveream et sporarum atque
cellularum sterilium columellam brevem, simplicem, centralem circumdantem ostendentes.
Glomeruli sporarum laxi, mature dissoluti. Sporae in maturitate earum singulae,
globosae, subglobosae, ovoideae, ellipsoidales usque parum subpolyedrice irregulares,
9-12 x 10,5-13,5 um, mediocriter atro-flavidobrunneae, cum poro germinationis leviter
pallidiore, rotundo, diametro cca. 3 um; pariete parum inaequali, 0,5-1(-1,5) um crasso, ad
poros germinationis tenuiore, leniter, dense verrucoso-echinulato, imago obliqua sporarum
levis usque leniter serrulata. Cellulae steriles in catervis irregularibus, cellulae singulae
forma et magnitudine variae, globoideae, ellipsoidales usque plerumque irregulares, latere
uno vel lateribus nonnullis deplanatis, 4,5-14,5 x 6-16 um, hyalinae; pariete aequali, 0,5-1
um crasso, levi.

Fig. 10. Sori of Sporisorium distachyum in all sessile and pedicelled spikelets of Andropogon
distachyos (type). Habit, and enlarged an infected spikelet. To the left a healthy inflorescence.
Bars = 1 cm for habit, and 3 mm for the detail drawing.

Sori (Fig. 10) in all, both sessile and pedicelled spikelets of an inflorescence, destroying
the inner floral organs, showing between the spreading floral envelopes, cylindrical, c.
1 x 2-4 mm, first covered by a dark brown peridium which early ruptures from its apex,
disclosing the black, semiagglutinated to powdery mass of spore balls, spores and sterile
cells surrounding a short, simple, central columella. Spore balls (Figs. 13, 14) loose,
early disintegrating. Spores (Figs. 13, 14) single when mature, globose, subglobose,
ovoid, ellipsoidal to subpolyhedrally slightly irregular, 9-12 x 10.5-13.5 um, medium
dark yellowish-brown, with a slightly paler, rounded germ pore of c. 3 um diameter;
wall slightly uneven, 0.5-1(-1.5) um thick, thinner at the germ pores, finely, densely
verrucose-echinulate, spore profile smooth to finely serrulate. Sterile cells (Figs. 13, 14)
in irregular groups, single cells variable in shape and size, globoid, ellipsoidal to usually

irregular, with one or several flattened sides, 4.5-14.5 x 6-16 um, hyaline; wall even,
0.5-1 um thick, smooth.
On Andropogon abyssinicus Fresen., A. distachyos L.; Africa (Ethiopia).

15. Sporisorium ellisii (G. Winter) M. Piepenbring, 2003:103.
Sorosporium ellisii G. Winter, 1883a:2 (Jan.); 1883b:7 (Jan.). — Lectotype (design. by
Jackson, 1908:148) on Andropogon virginicus, USA, New Jersey, Newfield, X.1880, J.B.
Ellis, NY; isolectotypes in Ellis, N. Amer. Fgi. no. 1099, BPI 179797.
Sori destroying the whole inflorescence, long cylindrical, 1-2 x 10-50 mm, more or
less hidden by leaf sheaths, initially covered by a pale brown, well-developed peridium
which ruptures irregularly at maturity disclosing the blackish-brown, granular-powdery
mass of spore balls and spores surrounding a long, thin columella often with bifurcate
tip. Sori rarely confined to the spikelets only. Spore balls subglobose, ellipsoidal, oblong
to irregular, 30-80 x 40-100 um, dark reddish-brown, composed of tens of spores which
separate easily by pressure. Spores subglobose, ellipsoidal to usually subpolyhedrally
slightly irregular, 11-15 x 12-18.5(-20) um, reddish-brown with irregular paler and
darker areas; wall uneven, 1-2.5 um thick, including an even, pale endospore and a
pigmented, unevenly thickened, densely, prominently low verruculose-echinulate
exospore, spore profile wavy to finely serrulate. Sterile cells not seen.
On Andropogon elliottii Chapm., A. glomeratus (Walter) Britton, Stern. & Poggenb., A.
virginicus L., Andropogon sp., Schizachyrium scoparium (Michx.) Nash (Andropogon
scoparius Michx.); N. America (USA).
Sporisorium ellisii is closest to S. guaraniticum (Speg.) Vanky, type on Schizachyrium
condensatum, Paraguay, in which the spores are dimorphic, with smooth inner spores,
the spore wall is thicker (2.5-4 um) and more finely ornamented.

16. Sporisorium everhartii (Ellis & Galloway) M. Piepenbring, 1999:462.
Sorosporium everhartii Ellis & Galloway, 1890:32. — Tolyposporium everhartii (Ellis &
Galloway) Dietel, in Engler & Prantl, 1897:14. — Type on Andropogon virginicus,
USA, New Jersey, Newfield, X.1887, coll. N. A. F. 2265b, BPI 179946.

Sori in the sessile spikelets of all or of some spikelet pairs of an inflorescence, narrow
cylindrical, 0.5-1 x 10-15(-20) mm, protruding between the outermost floral envelopes,
first covered by a pale brown peridium which ruptures irregularly from its apex
disclosing the blackish-brown, agglutinated to granular-powdery mass of spore balls
surrounding a long, filiform, flattened central columella of the length of the sorus. The
sori ripen from their apex which may be already empty of spores whereas their basal
part is still unripe. Spore balls varying in shape and size, globose, ovoid, ellipsoidal,
oblong to irregular, 30-100 x 50-130 tm, dark reddish-brown, composed of tens of
firmly united spores which separate by hard pressure. Spores dimorphic. Outer spores
ellipsoidal, tangentially elongated, slightly subpolyhedrally irregular or subcuneiform,
7-12 x 8-15 um, medium dark reddish-brown with paler and darker areas, according
to the unevenly thickened wall; wall 0.5-1.5 um or up to 2.5 um thick at the angles,
free surface coarsely, moderately densely verrucose-echinulate, warts up to 0.5 um high,
spore profile wavy to serrulate. Inner spores rounded subpolyhedrally irregular, about
the size of the outer spores, pale yellowish-brown; wall even or slightly uneven, c. 0.5
um thick, smooth. Spore germination (Duran, 1987:65; Piepenbring, 1999:465) results in
4-7-celled, mononucleate basidia giving rise to ellipsoidal, mononucleate basidiospores.

Sterile cells not seen.
On Andropogon brachystachyus Chapm., A. floridanus Scribner, A. gerardii Vitman, A.
glomeratus (Walter) Britton, Stern. & Poggenb. (A. macrourus Michx.), A. microstachyus
Desv. ex Hamilt., A. tener (Nees) Kunth, A. ternarius Michx., A. urcatus Muhl., A.
virginicus L., A. virginicus var. hirsutior (Hack.) Hitchc., Schizachyrium hirtiflorum
Nees (Andropogon hirtiflorus (Nees) Kunth), S. scoparium (Michx.) Nash (Andropogon
scoparius Michx.); N. America (USA, Mexico, Cuba).
Reports of this smut from Africa (comp. Zundel, 1938:304; 1953:59) refer to other
smut fungi. That on Hyparrhenia ruprechtii (= Hyperthelia dissoluta), from S. Africa, is
Sporisorium ischaemoides (Henn.) Vanky, PREM 7770! That on “Andropogon diplandrus
Hack.” (= Hyparrhenia diplandra (Hack.) Stapf), from Congo, is certainly one of the
several Sporisorium species on this host plant, known from Africa. “Sorosporium
everhartii on Andropogon ischaemum L. from South Africa (PREM 7770, BPI 179880)
represents Sporisorium ischaemoides on Hyperthelia dissoluta (Nees ex Steud.) Clayton.

17. Sporisorium fastigiatum Vanky, 2000:206.

Type on Andropogon fastigiatus, Zimbabwe, Matabeleland North Prov., 25 km SE of

Binga, alt. c. 690 m, 15.11.1999, C. & K. Vanky, HUV 18910!; isotypes BPI 746885 and

in Vanky, Ust. exs. no. 1066. Paratype on Andropogon fastigiatus, Matabeleland North

Prov., c. 50 km NW of Lusulu, alt. c. 970 m, 16.11.1999, C. & K. Vanky, HUV 18911!
Sori in all sessile and pedicelled spikelets of the inflorescence, completely destroying
them, ovoid, 1-2 x 2-4 mm, first covered by a thick, pale yellowish-brown peridium
which bears remnants of floral envelopes. At maturity, the peridium ruptures in several
places disclosing the semi-agglutinated, blackish-brown mass of spores and sterile
cells surrounding a stout, central columella, usually with short lateral branches. Rarely,
the sori may comprise the whole inflorescence or a part of it. Spores when young in
irregular, loose balls, single when mature, subglobose, ellipsoidal, usually rounded,
subpolyhedrally irregular, 8-11 x 9-13.5 um, reddish-brown; wall even or slightly
uneven, 0.5-0.8 um thick, apparently smooth to finely, densely punctate or punctate-
echinulate, spore profile smooth to very finely serrulate. Sterile cells in compact, rounded
or elongated groups, 15-25 x 20-35 um, these may be agglutinated in short chains; single
cells irregular, subpolyhedral with flattened sides, rarely ovoid, 5-13 um long, subhyaline
with homogenous content; wall 0.5-1 um thick, smooth.

On Andropogon angustatus (Presl) Steud., A. fastigiatus Swartz (Diectomis fastigiata

(Swartz) Kunth); Africa (Guinea, Zimbabwe), C. & S. America (Nicaragua, Venezuela).

18. Sporisorium gayanum Vanky & C. Vanky, in Vanky, 2000:205.

Type on Andropogon gayanus, Zimbabwe, Matabeleland North Prov., 12 km N of Lusulu,

alt. c. 1010 m, 16.II1.1999, C. & K. Vanky, HUV 18899!; isotypes BPI, IMI 380465, S, and

in Vanky, Ust. exs. no. 1065.
Sori in all sessile and pedicelled spikelets of the inflorescence, leaving intact only the
outermost floral envelopes, rarely also a few anthers, cylindrical with acute tip, c. 1 x
5-10 mm, covered by a pale yellowish-brown peridium which ruptures early from its
apex and curls disclosing the blackish-brown, first agglutinated, later granular-powdery
mass of spore balls and 3-6 filiform columellae. In young stage, the peridium often bears
remnants of inner floral organs or aborted anthers. Spore balls varying in shape and
size, broadly ellipsoidal, ovoid, oblong or irregular, 35-90 x 40-120(-140) um, reddish-

brown to opaque, permanent, composed of tens to about a hundred tightly packed
spores. Spores dimorphic. Outer spores subpolyhedrally irregular, 8-12 x 10.5-14.5 um,
dark reddish-brown with slightly uneven, 1-2 um thick wall, prominently verruculose-
echinulate on the free surface which appears finely serrulate in median view; inner
spores subpolyhedrally or polyhedrally irregular, often elongated, tightly packed, the
size of the outer spores or somewhat smaller, subhyaline or pale yellowish-brown; wall
thin, c. 0.5 um, even, smooth. Sterile cells few, in small groups or chains; single cells
subglobose, oblong or irregular, with flattened sides, 5-13 um long, hyaline; wall thin,
c. 0.5 um, smooth.

i On Andropogon chinensis (Nees) Merr., A. gayanus Kunth; Africa (Malawi, Zambia,

Zimbabwe).

19. Sporisorium holwayi (G.P. Clinton & Zundel) Vanky, 1993:40.

Sphacelotheca holwayi G.P. Clinton & Zundel, in Zundel, 1930:143. — Type on Andropogon
bicornis, Bolivia, Prov. Sur Yungas, Villa Aspiazu, 31.V.1920, E.W.D. & M.M. Holway,
BPI 177831.

Sphacelotheca kellermanii G.P. Clinton & Zundel, in Zundel, 1930:142. — Lectotype on
Andropogon leucostachyus (det. A. Chase), Guatemala, Los Amates, 15.JII.1905, W.A.
Kellerman 7601-A (design. by Piepenbring, 2003:108) BPI 178042!; isolectotypes BPI
178041!, 178045! (syn. by Piepenbring, 2003:108).

Sori in groups of spikelets, bunched and forming witches’ brooms. One or several
witches’ brooms of various sizes may occur in the same inflorescence. Individual sori
linear, often curved, 0.7-1 x 10-40 mm, initially covered by a greyish-brown peridium
which splits longitudinally exposing a blackish-brown mass of spores intermixed
with few, irregular groups of sterile cells surrounding a well-developed, horn-shaped,
central columella. Spores single when mature, subglobose, ovoid to irregularly oblong or
subpolyhedral, 9-14 x 10-16(-18) um, dark reddish-brown; wall even or slightly uneven,
c. 1.5 um thick, evidently, moderately densely echinulate, spore profile serrulate. Sterile
cells varying in shape and size, smaller than the spores, subhyaline to light yellowish-
brown, collapsed with age.
On Andropogon bicornis L., A. leucostachyus Kunth; C. & S. America.

Sporisorium holwayi differs from the similar S. bicornis especially in having much larger,
darker, thick-walled spores.

20. Sporisorium leucostachys (Henn.) M. Piepenbring, 2003:110.
Ustilago leucostachys Henn., in Pazschke, 1896a:50. — Sphacelotheca leucostachys (Henn.)
Zundel, 1930:144. — Type on Andropogon leucostachyus, Brazil, State Minas Gerais,
Serra do Itatiaia, 11.1894, E. Ule 2096, HBG; isotypes BPI 162412, HUV 17523!
Sori destroying the whole inflorescence, long linear, c. 2 mm wide, 5-7 cm long, partly
enclosed by leaf sheaths, first covered by a thick, light brown peridium which ruptures
irregularly disclosing the dark brown, granular powdery mass of spore balls surrounding
a long, well-developed columella. Spore balls subglobose, ovoid, ellipsoidal, oblong to
slightly irregular, 30-70 x 40-100 um, dark reddish-brown, composed of tens of spores
which separate by pressure. Spores subglobose, ovoid, ellipsoidal to usually rounded,
subpolyhedrally slightly irregular, (10.5-)11-13.5 x 12-16 tm, medium dark reddish-
brown, with paler and darker areas; wall uneven, 0.5-1.5 um thick, moderately densely,

finely to prominently verrucose, especially on the free surface of the spores, spore profile
smooth, wavy or serrulate. Sterile cells lacking.
On Andropogon leucostachyus Kunth; S. America (Brazil).

21. Sporisorium livingstoneanum Vanky, sp. nov.

Typus in matrice Andropogon gayanus Kunth, Zambia, Southern Prov., 10 km N urbe

Livingstone, 17°47'45” S, 25°51°10” E, alt. 960 m.s.m., 14.IV.2001, leg. T., C. & K. Vanky.

Holotypus in Herbario Ustil. Vanky, HUV 21070!; isotypi in BPI, BRIP et IMI. Paratypi

in matrice Andropogon chinensis (Nees) Merr., Zambia, Lusaka Prov., 169 km ENE urbe

Lusaka, 15°04°10” S, 29°45'22” E, alt. 900 m.s.m., 17.IV.2001, leg. T., C. & K. Vanky, HUV

21072! et Lusaka Prov., 201 km E. urbe Lusaka, 15°00°18” S, 29°58’22” E, alt. 760 m.s.m.,

27.1V.2001, leg. C. & K. Vanky, HUV 21073; isoparatypi in BPI, BRIP et IMI.

Sori in spiculis nonnullis et sessilibus et pedicellatis inflorescentiae eiusdem, longe cylindrici,

arcuati vel torti, 1-1,5 x 5-20(-25) mm, primo peridio crasso, cremeo cooperti, quo ab apice

eius irregulariter rupto massam nigrobrunneam, semiagglutinatam usque granuloso-

pulveream glomerulorum sporarum et columellarum nonnullarum, filiformium plerumque

partim vel omnio in columellam decrescentem, planam, taeniaeformem coalescentium

ostendentes. Glomeruli sporarum forma et magnitudine varii, globosi, ovoidei, elongati,

vel subpolyedrice irregulares, 30-140 x 30-150 um, glomeruli globoidei diametro 30-140

um, atro-rubrobrunnei, subopaci vel opaci, permanentes, e sporis pluribus decem usque

pluribus centum, pressu valido difficiliter separabilibus compositi. Sporae dimorphae,

externae earum subglobosae, ovoideae, ellipsoidales usque subpolyedrice parum irregulares,

7,5-10,5 x (8-)9-13(-14) um, flavido- usque rubrobrunneae; pariete inaequali, 0,5-2 um

crasso, in lateribus contactis tenui, ad angulos et in superficie libera crassissimo, verrucis

0,5(-1) um altis vel spinis moderate dense distributis inclusis, imago obliqua sporarum

superficiei liberae undulata usque leniter serrulata, eadem in lateribus contactis levis.

Sporae internae globoideae, ovoideae vel roundato-subpolyedricae, magnitudine sporis

externis cca. aequales, pallide flavidobrunneae; pariete aequali, cca. 0,4-0,8 um crasso,

levi, sub SEM ruguloso. Cellulae steriles absentes.
Sori (Fig. 11) in some sessile and pedicelled spikelets of an inflorescence, long
cylindrical, bent or curled, 1-1.5 x 5-20(-25) mm, first covered by a thick, cream coloured
peridium which ruptures irregularly from its apex disclosing the blackish-brown,
semiagglutinated to granular-powdery mass of spore balls and several long, filiform
columellae, which usually partly or completely fuse into a narrowing, flat, band-like
columella. Spore balls (Figs. 15, 16) varying in shape and size, globose, ovoid, elongated
or subpolyhedrally irregular, 30-140 x 30-150 um, globoid balls 30-140 in diameter, dark
reddish-brown, subopaque or opaque, permanent, composed of tens to hundreds of
spores which separate with difficultly by hard pressure. Spores (Figs. 15, 16) dimorphic,
outer spores subglobose, ovoid, ellipsoidal to subpolyhedrally slightly irregular, 7.5-10.5
x (8-)9-13(-14) um, yellowish- to reddish-brown; wall uneven, 0.5-2 um thick, thin on
the contact sides, thickest at the angles and on the free surface, including the moderately
densely situated, 0.5(-1) um high warts or spines. Spore profile on the free surface wavy
to finely serrulate, on the contact sides smooth. Inner spores globoid, ovoid or rounded
subpolyhedral, about the size of the outer spores, pale yellowish-brown; wall even, c.
0.4-0.8 um thick, smooth. Sterile cells absent.

On Andropogon gayanus Kunth, A. chinesis (Nees) Merr.; C. Africa (Zambia).

Etymology: This species is named after the Zambian city Livingstone, close to the Victoria

Falls, where this smut was first collected.

Fig. 11. Sori of Sporisorium livingstoneanum in some sessile and pedicelled spikelets of Andropogon
gayanus (type). Habit. To the left a healthy inflorescence. Bar = 1 cm.

22. Sporisorium mexicanum (Vanky) Vanky & Cunnington, in Cunnington, Vanky &
Shivas, 2005:98.
Lundquistia mexicana Vanky, 2004c:161. — Type on Andropogon gerardii, Mexico,
Durango State, 57 km WSW of Durango, Hwy no. 48, alt. 2538 m, 19.X1.2003, T. & K.
Vanky, HUV 20498; isotypes in Vanky, Ust. exs. no. 1202. Paratype on Schizachyrium
mexicanum, Mexico, Mexico State, 18.5 km W of Toluca, Hwy no. 1, alt. 2812 m,
6.X1I.2003, C. & K. Vanky, HUV 20526; isoparatypi in BPI and IMI.

Sori on the top of sterile shoots as dark, long, slender, bent bodies composed of
numerous vascular bundles and among them spore masses and sterile cells destroying
the parenchymatous tissues. At maturity the host tissue disintegrates and the dark
brown, semiagglutinated to powdery mass of spores and sterile cells is successively
liberated leaving behind a 2-5 mm wide, 15-40 cm long, twisted and curled fascicle of
numerous, filiform columellae. Spores globose to subglobose, 8-10.5 x 8-11 um, medium
dark yellowish-brown; wall 2-2.5 um thick including the 1.5-2 um high, anastomosing
warts which form an irregular, labyrinthiform or incompletely and irregularly reticulate
pattern. Warts in optical median view acute. Sterile cells single, in short chains or in
small, irregular groups. Single cells subglobose or ellipsoidal with flattened contact sides,
7-13 um long, subhyaline to pale yellowish-brown; wall even, c. 0.5 um thick, smooth.
Spore germination (Vanky, 2004c:161 + fig. 2) results in 4-celled basidia (often in 3+1
arrangement), measuring 2-2.5 x 15-25 um. On the basidia, laterally and terminally,
ovoid basidiospores measuring 1.5-2.5 x 4-5.5 um are produced on sterigmata. The
basidiospores bud like yeast cells giving rise to yeast colonies.

On Andropogon gerardii Vitman, Schizachyrium mexicanum (Hitchc.) A. Camus; N.

America (Mexico). Known only from the type collections.

23. Sporisorium occidentale (Seym. ex G.P. Clinton) Vanky & Snets., in Vanky,
990-270:
Sphacelotheca occidentalis Seymour ex G.P. Clinton, 1902:141, nom. nud.; 1904:389.
— Type on Andropogon furcatus (= A. gerardii), USA, North Dakota, Bismarck,
30. VIII.1884, A.B. Seymour, BPI 69513; isotypes HUV 1980, Ellis & Ev., N. Amer. fgi.
no. 2265/a, HUV 12914!

Sori in all sessile and pedicelled spikelets of an inflorescence, cylindrical, 1-1.5 x 5-10
mm, initially covered by a thick, light brown, fungal peridium which ruptures irregularly
_at maturity disclosing the blackish-brown, semiagglutinated mass of spore balls, spores
and sterile cells surrounding a simple, narrowing, central columella. Spore balls loose,
early disintegrating. Spores slightly irregular, subpolyhedral, ovoid to oblong, 12-16 x
13.5-18 um, yellowish-brown; wall uniform, thin, c. 0.5 um, finely and densely punctate-
echinulate, spore profile finely serrulate. Spore germination (on MYP, at room temp., in
4 days) results in 4-celled basidia the cells of which give rise to long, septate, ramifying
hyphae. Sterile cells in groups or chains, very variable in shape and size, usually smaller
than the spores, 8-15 um long, rarely up to 22 um long, collapsed in old specimens,
hyaline, with a few oil droplets; wall thin, c. 0.5 um, smooth.

On Andropogon gerardii Vitman (A. furcatus Muhl.; A. provincialis Lam. not Retz.),

A. glomeratus (Walter) Britton, Stern. & Poggenb., A. hallii Hack., A. virginicus L.,

Schizachyrium scoparium (Michx.) Nash (Andropogon scoparius Michx.); N. America

(Canada, USA).

24. Sporisorium polliniae (Magnus) Vanky, 1983:331.
Sorosporium polliniae Magnus, 1900:433 (as ‘Sorisporium’). — Type on Pollinia distachya
(= Andropogon distachyos), Judaea [= Israel], Jaffa Distr., Bab-el-Wad, 15.V.1897, J.
Bornmiiller 1015; isotypes in Bornmiiller, Iter syriacum 1897, no. 1015, BPI 180134!
Sorosporium icosiense Maire, 1917:145. — Type on Andropogon distachyos, Algeria, near
Icosium, Télemly, El-Biar, coll. R. Maire. (syn. by Ling, 1951:47).
Sori in all, both sessile and pedicelled spikelets of an inflorescence, destroying the
innermost floral organs, cylindrical or corniculate, 1-1.5 x 7-10 mm, partly hidden by
the glumes, covered by a yellowish-brown peridium which splits longitudinally in several
places exposing the blackish-brown, granular-powdery mass of spore balls and a central,
filiform, sometimes apically bifurcate columella. Spore balls subglobose, ellipsoidal to
irregular, 20-40 x 25-55 um, reddish-brown, composed of few to many (10-40 or more?)
spores, initially firm but disintegrating readily at maturity. Spores subglobose, ellipsoidal,
usually slightly subpolyhedrally irregular, 7-11 x 8-14 um, yellowish- to reddish-brown,
verrucose to echinulate on the free surface, punctate to apparently smooth on the
contact sides; wall uneven, 1-2 um thick, thickest at the angles and on the free surface,
inner spores pale yellowish-brown, wall even, c. 0.5 um thick, smooth. Spore germination
(on potatoglucoseagar, at room temp., in 2 days) results in long, 4-celled basidia with
fusiform basidiospores on short sterigmata at the septa and on the apex of the basidium.
Sterile cells absent. The peridium is composed of long chains of hyaline, thin-walled,
elongated or irregular cells (8-16(-20) um long), with 1(-2) oil droplets.
On Andropogon abyssinicus Fresen., A. distachyos L. (Pollinia distachya (L.) Spreng.;
Chrysopogon distachyos (L.) Rossi); Mediterranean region (S. Europe, N. & NE. Africa,
incl. Ethiopia, Asia).
Specimens collected in Ethiopia have larger and more compact spore balls. In other
respects they are identical with the type.

25. Sporisorium provinciale (Ellis & Galloway) Vanky & Snets., in Vanky, 1990:271.
Sorosporium ellisii var. provinciale Ellis & Galloway, 1890:31. — Sorosporium provinciale
(Ellis & Galloway) G.P. Clinton, 1902:145. — Lectotype on Andropogon provincialis (=
A. gerardii), USA, (design. by Clinton, 1902:145) Montana, Saline Co., near Emma,
3.V1.1889, C.H. Demetrio, BPI 179762; isolectotypes in Ellis & Ev., N. Amer. fgi. no. .
2425, HUV 5231! Syntype BPI 179759.
Sori on the top of shoots comprising the whole inflorescence and inflorescence
axis, cylindrical, 2-5 mm wide, up to 12 cm long, sometimes bearing remnants of
_inflorescence branches or spikelets distally, partly enclosed by the leaf sheath, first
covered by a light brown peridium which lacerates at maturity disclosing the blackish-
brown, granular-powdery mass of spore balls and the interwoven and interconnected,
filiform columellae of remnants of host vascular tissue. Spore balls globoid to oblong
or somewhat irregular, 25-55 x 30-75 um, medium dark yellowish-brown, composed
of 5-35 (or more?), loosely connected spores. Spores rather uniform, globose, ovoid or
slightly irregularly subpolyhedral, 12-16 x 13-19 um, yellowish-brown; wall 3-4 um
thick, minutely, sparsely to moderately densely verrucose, spore profile finely wavy.
Spore germination (on MYP, at room temp., in one week) results in 4-celled basidia on
which long, cylindrical or naviculiform basidiospores are produced on well developed
sterigmata. The basidiospores become multiseptate and produce small, slightly bent
secondary sporidia. Sterile cells in groups or chains, single cells varying in shape and

size, usually smaller than the spores, 8-15, rarely up to 22 ttm long, collapsed in old
specimens, hyaline, with a few oil droplets; wall thin, c. 0.5 um, smooth.
On Andropogon gerardii Vitm an (A. provincialis Lam.; A. furcatus Muhl.), A. hallii Hack.,
A. microstachyus Desv., A. virginicus L., Schizachyrium hirtiflorum Nees (Andropogon
hirtiflorus (Nees) Kunth), S. scoparium (Michx.) Nash (Andropogon scoparius Michx.);
N. America (Mexico, USA).

26. Sporisorium pseudomaranguense (Zundel) Vanky, 2005a:262.

Sorosporium pseudomaranguense Zundel, 1938:309. - Type on Andropogon sp. (det. A.
Chase), South Africa, Natal, Mooi River, 21.11.1917, A.O.D. Mogg, PREM 10073;
isotype HUV 18007!

Sori destroying the whole inflorescence, long linear, c. 2 mm wide, 3-5 cm long, hidden
by the uppermost leaf sheath from which only the tips of the sori protrude, initially
covered by a thick, yellowish-brown peridium which ruptures irregularly liberating the
dark brown, granular-powdery mass of spore balls and groups of sterile cells surrounding
numerous, long, filiform, slender columellae. Spore balls subglobose, ovoid, ellipsoidal,
oblong or slightly irregular, 30-70 x 40-130 um, dark reddish-brown to subopaque,
composed of tens of spores that separate by pressure. Spores varying in shape and size,
subglobose, ellipsoidal to subpolyhedrally irregular, 8-12 x 9-14.5 um, dimorphic. Outer
spores rounded, larger, dark yellowish- to reddish-brown; wall irregular, 0.8-1.2 um
thick, prominently, moderately densely verrucose-echinulate, spore profile serrulate.
Inner spores subpolyhedral, smaller, pale yellowish-brown; wall even, c. 0.5 um thick,
finely punctate-verruculose. Sterile cells few, in irregular groups or short chains, single
cells ellipsoidal to usually irregular with flattened sides, 8-12 um long, hyaline; wall c.
0.5 um thick, smooth.
On Andropogon sp.; S. Africa. Known only from the type collection.

27. Sporisorium sanctae-catharinae (Zundel) Vanky, comb. nov.
Basionym: Ustilago sanctae-catharinae Zundel, Mycologia 43:268, 1951 (nom. nov.). —
Ustilago occulta Hennings, 1897:212 (later homonym, not U. occulta (Wallr.) Rabenh.,
Herb. viv. myc. no. 1898, 1874). — Type on Andropogon sp., Brazil, Santa Catarina,
Caraga, III.1892, E. Ule 1888, HBG!
Sori on the top of sterile shoots including also the uppermost leaves and leaf sheaths,
transforming them into slender, bent, cylindrical, distally narrowing bodies, up to 5mm
wide and 10 cm long, initially covered by host epidermis which ruptures longitudinally
in many places disclosing the dark brown, semiagglutinated to powdery mass of spores,
sterile cells and numerous filiform columellae of vascular bundles. Spores globose,
subglobose, broadly ellipsoidal, 5.5-7(-8) x 6.5-9 um, dark yellowish-brown; wall 1-1.5
um thick including the cylindrical, often anastomosing, labyrinthiform warts, with
flattened tip; in SEM the spore surface appears cerebriform. Sterile cells in small groups,
single cells subglobose, ellipsoidal or slightly irregular, 10-15 um long, yellowish-brown,
collapsed in old specimen; wall even, c. 0.5 um thick, finely punctate-echinulate, profile
smooth to finely wavy.
On Andropogon sp.; S. America (Brazil). Known only from the type locality.

Sporisorium sanctae-catharinae is closest to S. mexicanum (type on Andropogon gerardii),
from which it differs by smaller spores and lower warts with flattened tip.

28. Sporisorium scholzii Vanky, sp. nov.
Typus in matrice Andropogon schirensis A. Rich., Zambia, Eastern Prov., 407 km ENE
urbe Lusaka, 14°16°54” S, 31°37'41” E, alt. 1070 m.s.m., 18.IV.2001, leg. C., T. & K. Vanky.
Holotypus in Herbario Ustil. Vanky, HUV 21062! Paratypus in matrice Andropogon
schirensis, Zambia, Lusaka Prov., 124 km ENE urbe Lusaka, 15°08'59” S, 29°21°45” E, alt.
1035 m.s.m., 17.1V.2001, leg. T., C. & K. Vanky, HUV 21065!
Sori in spiculis nonnullis sessilibus inflorescentiae eiusdem, longe cylindrici, 1-1,5 x 7-15
mm, primo peridio crasso, cremeo cooperti, quo apice eius irregulariter rupto massam
nigram, granuloso-pulveream glomerulorum sporarum et columellarum nonnullarum,
longarum filiformium ostendentes. Glomeruli sporarum forma et magnitudine varii,
subpolyedrice irregulares, interdum elongati, raro globosi, 70-140 x 80-180(-200) um,
atro-rubrobrunnei usque plerumque opaci, permanentes, e sporis pluries decem vel pluries
centum pressu valido tantum difficiliter separatis compositi. Sporae dimorphae, externae
earum globosae, subglobosae, ellipsoidales usque rotundato-subpolyedricae, 9-10,5 x
9-11(-12) um, mediocriter atro-olivaceobrunneae; pariete inaequali, 0,5-1 um crasso,
in superficie libera valde leniter punctato-verruculoso, imago obliqua sporarum levis.
Sporae internae rotundate subpolyedricae vel polyedricae, magnitudine sporis externis
cca. aequales, pallide olivaceobrunneae; pariete aequali, 0,3-0,5 um crasso, levi, sub SEM
ruguloso. Cellulae steriles absentes.
Sori (Fig. 12) in some sessile spikelets of an inflorescence, long cylindrical, 1-1.5
x 7-15 mm, initially covered by a thick, cream coloured peridium which ruptures
irregularly from its apex disclosing the black, granular-powdery mass of spore balls and
several long, filiform, columellae. Spore balls (Figs. 17, 18) varying in shape and size,
subpolyhedrally irregular, sometimes elongated, rarely globose, 70-140 x 80-180(-200)
um, dark reddish-brown to usually opaque, permanent, composed of tens or hundreds of
spores which separate with difficultly by hard pressure. Spores (Figs. 17, 18) dimorphic,
outer spores globose, subglobose, ellipsoidal to rounded subpolyhedral, 9-10.5 x
9-11(-12) um, medium dark olivaceous-brown; wall uneven, 0.5-1 um thick, finely
punctate-verruculose on the free surface, spore profile smooth. Inner spores rounded
subpolyhedral or polyhedral, about the size of the outer spores, pale olivaceous-brown;
wall even, 0.3-0.5 um thick, smooth, in SEM appearing wrinkled. Sterile cells absent.
On Andropogon schirensis A. Rich.; C. Africa. Known only from the type collections.
Sporisorium scholzii differs from S. andropogonis-pumili in which the spore balls are
larger and darker, and the outer spores of the balls are provided with densely situated,
1-2.5 um long, filiform warts. It differs also from S. livingstoneanum in which the
columellae are often band-like, the spore balls are smaller, and the outer spores of the
balls are provided with moderately densely situated, 0.5(-1) um high warts or spines.
Etymology: This species is named in the honour of Professor Hildemar Scholz (Berlin,
Germany), an excellent and helpful person, outstanding specialist of the Poaceae of the
world, and also of the smut fungi, author of several books on grasses and on the smut
fungi of Germany (1988a, b, 2000, 2004).

29. Sporisorium seymourianum (G.P. Clinton) M. Piepenbring, 2003:89.
Sphacelotheca seymouriana G.P. Clinton, 1904:387. — Lectotype on Andropogon virginicus,
USA, Alabama, Auburn, 14.X.1897, Earle & Baker, (design. by Piepenbring, 2003:89)
BPI 193990; isolectotypes BPI 193989, Seymour & Earle, Econ. Fgi., Suppl. C. no. 531,
HUV 17711!, Syd. Ust. no. 189, HUV 1660! Syntypes in Seymour & Earle, Econ. Fgi.,
Suppl. C. no. 122, HUV 9710!

_ Fig. 12. Sori of Sporisorium scholzii in some sessile spikelets of Andropogon schirensis (type).
Habit. Bar = 1 cm.

Sori in all sessile and pedicelled spikelets of an inflorescence, cylindrical, 0.5-1 x 3-7
mm, partly hidden by floral envelopes, first covered by a pale brown peridium which
ruptures from its apex disclosing the dark brown, agglutinated to powdery mass of spore
balls, spores and sterile cells surrounding a simple, narrowing, central columella. Spore
balls irregular, early disintegrating. Spores rounded, subpolyhedrally slightly irregular,
7-11 x 8-13.5 um, yellowish-brown; wall even, c. 0.5 um thick, finely, densely punctate-
verruculose, spore profile smooth. Sterile cells in irregular groups, single cells about the
size of the spores, hyaline, collapsed in old specimens; wall c. 0.5 um thick, smooth. —
On Andropogon gerardii Vitman, A. ternarius Michx., A. virginicus L., Schizachyrium
scoparium (Michx.) Nash (Andropogon scoparius Michx.); N. America (USA).

30. Sporisorium stuhlmannii (Henn.) Vanky, 2004a:107.

Ustilago stuhlmannii Hennings, 1893:3. — Sphacelotheca stuhlmannii (Henn.) Zundel,
1930:136. — Type on Andropogon sp., “Central Afrikan. Seengebiet” (Central African
Lakes Territory), Ukami, Mrogoro, 18.V.1890, E Stuhlmann 63, “Emin Pascha
Expedition’, BPI 198126!

Ustilago andropogonis-hirtifolii Henn., in Holway, 1899:274 (as ‘andropogonis-hirtefoli?’).

— Sphacelotheca andropogonis-hirtifolii (Henn.) G.P. Clinton, 1902:141.— Sporisorium
andropogonis-hirtifolii (Henn.) M. Piepenbring, 2003:88. — Type on Andropogon
hirtifolius var. pubiflorus, Mexico, Michoacan, Patzcuaro, 20.X.1898, E.W.D. Holway
3216, B; isotypes BPI 157091, 157093, HBG, Sydow, Ust. no. 201, HUV 9766! (syn.
nov.)

Ustilago andropogonis-saccharoidis Henn., in P. Sydow, Ustilagineen no. 251 (nom.
nud.). — Sphacelotheca andropogonis-saccharoidis (Henn.) Cif., in Ciferri & Herter,
1932:531 (comb. invalid.). — Type on Andropogon saccharoides, Mexico, Jalisco,
Chapala, 17.[X.1899, E.W.D. Holway; isotypes in Syd. Ustil. no. 251, HUV 3154!
(syn. by Clinton, 1902:129). The host plant in the HUV copy of Syd. Ustil. no. 251 is
Andropogon perforatus (det. K. Vanky).

Sori comprising the entire inflorescence, elongate, 1-3 mm wide, 5-10 cm long, partly
enclosed by leaf sheaths, initially covered by a thick, brown peridium which flakes away
disclosing the semiagglutinated to powdery, dark olivaceous-brown mass of spores and
sterile cells surrounding a long, sometimes bifurcate columella often with short lateral
branches. Sori rarely restricted to the spikelets, then c. 1 x 5-10 mm. Spores subglobose,
ellipsoidal to usually rounded, subpolyhedrally slightly irregular, 8-12 x 9-13.5 um,
yellowish-brown; wall even, c. 0.5 um thick, finely, densely punctate to verruculose-
echinulate, spore profile smooth, finely wavy to finely serrulate. Spore germination
(Duran, 1987:87 & 102) results in 4-5-celled basidia producing basidiospores. Sterile
cells in irregular groups, single cells 6.5-13 um long, subhyaline; wall thin, c. 0.5 um,
smooth, collapsed in old specimens.
On Andropogon barbinodis Lag. (Bothriochloa barbinodis (Lag.) Herter), A. hallii
Hack., A. hirtifolius J. Presl var. pubiflorus Hack., A. lateralis Nees, A. perforatus Trin. ex
Fourn., A. saccharoides Sw. (Bothriochloa saccharoides (Sw.) Rydb.), A. wrightii Hack.,
Andropogon sp.; Africa, N. America (Mexico, USA), Caribic Islands (Dominican Rep.).
The sori, spores and sterile cells of the types of Ustilago andropogonis-hirtifolii and those
of U. stuhlmannii are identical hence they are considered to be synonyms.

31. Sporisorium zilligii (Zundel) Vanky, comb. nov.
Basionym: Sphacelotheca zilligii Zuandel, Mycologia 22:142, 1930. — Type on Andropogon

sp., South Africa, Cape Province, Vryburg, 25.11.1921, A.O.D. Mogg, PREM 20666;

isotypes BPI 192099, BPI 195088, HUV 18128!
Sori destroying the whole inflorescence, long linear, 1-2 x 10-30 mm, partly hidden by
leaf sheaths, initially covered by a thick, brown peridium which flakes away disclosing
the dark brown, semiagglutinated to powdery mass of spore balls, spores and sterile cells
surrounding a stout, bifurcate or much ramifying columella. Spore balls loose, composed
of tens or a hundred of easily separating spores. Spores globose, ovoid, ellipsoidal to
slightly irregular, varying in size, 5.5-9.5(-10.5) x 6-13(-16) um, yellowish-brown; wall
even, c. 0.5 um thick, finely, densely punctate-verruculose, spore profile smooth. Sterile
cells in irregular groups, single cells subglobose, ellipsoidal, irregular, 8-16(-18) tm
long, subhyaline to pale yellowish-brown tinted, collapsed in old specimen; wall c. 1 um
thick, smooth.

On Andropogon sp.; S. Africa. Known only from the type collection.

Doidge (1950:384), and after her Zundel (1953:115), stated that the host plant is a
Cymbopogon sp., not Andropogon as originally given. Unfortunately, no healthy host
plant is preserved. Judged from the sori, I doubt that the host is a Cymbopogon (comp.
Vanky, 2003:31).

32. Ustilago andropogonis-tuberculati Brefeld, 1895:108.
Type on Andropogon tuberculatus, India, Simla, comm. Barclay (type where?).
Sori in the ovaries, compact, hard, black. Spores remarkably variable, rounded, 10-13
ttm in diameter, dark brown. Spore germination (Brefeld, 1895:108, Plate VI, figs. 24,
25) results in long, narrow, 4-celled basidia on which long ellipsoidal basidiospores are
produced.
On Andropogon tuberculatus Hack.; S. Asia (India).

No specimen was available for study. Description taken from the original. Collection
and study of this species is desired as the generic position is uncertain.

Invalid names, uncertain, excluded and undescribed species

Sphacelotheca furcata var. congoensis Zambettakis, 1979(1980):410.
Invalid name, no Latin diagnosis, and no type designated (ICBN 36.1 & 37.1).
On Andropogon sp., Congo, BR.

Sphacelotheca tonkinensis (Henn.) Zundel, 1930:134.

Uredo tonkinensis Hennings, 1895a:11. — Type on Andropogon sp., N. Vietnam, Tonkin,

Hanoi (type where’).

Sori destroying the ovaries, 2-3 mm long, at first concealed by the glumes, covered
by a brown peridium, which dehisces from the apex revealing a brown spore mass
surrounding a well-developed columella. Spores globose to subglobose, regular, 9-12 um
in diameter, reddish-brown; wall thick, two-layered, smooth. Spore content granular-
vacuolate.

Type not seen. Description taken from Zundel (1930:134). This species belongs to
the genus Sporisorium. However, the short and incomplete description does not allow a
sure identification.

Sporisorium moniliferum (Ellis & Everh.) L. Guo, 1990:82.
Type on Heteropogon contortus (L.) P. Beauv. ex Roem. & Schult., USA.

Zundel (1953:100) mentions this smut also on Andropogon glomeratus (Walter)
Britton, Stern. & Poggenb. from the USA, Va. The specimen in BPI 178090! (USA, Va.,
Williamsburg, 28.VI.1921, E.J. Grimes) represents another, probably an undescribed
species.

Ustilago amadelpha is Ustilago scitaminea
Ustilago amadelpha Syd., P. Syd. & E.J. Butler, 1912:249. — Type on “Andropogon sp.’ (=
misnamed Saccharum sp.), India.
It is identical with the later published Ustilago scitaminea Syd. on Saccharum officinarum
L., India (Vanky, 2004a:114), a name that was proposed for conservation (Vanky &
Shivas, 2005:180).

Sporisorium sp. nov.

On Andropogon gayanus Kunth, Nigeria, Prov. Zaria, Samaru, 20.11.1961, E. Harris, IMI

S71
Sori in the spikelets, cylindrical, up to 2 cm long, covered by a peridium which ruptures
disclosing the dark brown, granular powdery mass of spore balls surrounding a central
columella. Spore balls variable in shape and size, ovoid, usually oblong or irregular,
40-120 x 50-180(-210) um, olivaceous brown, rather permanent, composed of tens
to hundreds of spores. Spores dimorphic, outer spores ellipsoidal, 6.5-9 x 6.5-10(-11)
uum, brown; wall c. 1 um thick, on the free surface prominently verrucose. Inner spores
subpolyhedrally irregular, subhyaline with c. 0.5 um thick, smooth wall. Sterile cells not
seen

It differs from all known Sporisorium species on Andropogon. However, the IMI

specimen I have seen is too scanty to be designated as the type of a new species. It is
presented here to call attention to it.

Figs. 13, 14. Spores and sterile cells of Sporisorium distachyum on Andropogon distachyos, in LM
and in SEM (type).

Figs. 15, 16. Spore balls and spores of Sporisorium livingstoneanum on Andropogon gayanus, in LM
and in SEM (type).

Figs. 17, 18. Spore balls and spores of Sporisorium scholzii on Andropogon schirensis, in LM and in
SEM (type). Bars = 10 um.

Key to the smut fungi of Andropogon and Schizachyrium

(S. = Sporisorium)

1. Sori on the leaves or leaf sheaths as striae. Spore wall thick, multilayered ............ 2
<= SOLl arid Spore Wall NOU SOR, crc.scscct wees ceraeee cceevcee te. RCN ee U Ree, cotemee ee eee 3
2. Spores 10-20(-24) um long; wall 3-8 um thick... Jamesdicksonia brunkii
— Spores 8-16(-18) um long; wall 1.5-6.5 um thick........... Jamesdicksonia caribensis
34 -Soron theitop or shoots asww hip Uke Strucuites tats c.ca._.ce)--1e see oes 4
FO GELINIOL SO vndnen scnteebcecseecenca Meese: prsaelearssyated sUdeee nes tte VeOneeen en oh occbocues cobartteneerosdoiansetcservcreeaee 7
4. Columella one, stout, with longitudinal furrows. Spore wall 0.4-0.8 um thick,

trier :OTt OMe Sider... ,.c err: te eee gee ei ree eee S. andropogonis-tectorum
— Columellae several, filiform. Spore wall thicker, not thinner on one side.............. 5
5. Spores 13-19 um long; wall 3-4 um thick, minutely verruculose...... $. provinciale
=... Spores:smaller: wallithinner ses :..caueeseses sete eee eee ty eres coc eee ne 6
6. Spores 8-11 um long; wall 2-2.5 um thick, including the 1.5-2 um high,

ANASTOMOSIS WaltS meres scetcetae tte -oacs-tel ses goatsessetes omaecuseectrseteers sere S. mexicanum
— Spores 6.5-9 um long; wall 1-1.5 um thick, including the cylindrical, single or

anastomosing, labyrinthiform or cerebriform warts ............. S. sanctae-catharinae
7G )\e ool destroying tne whole tniorescenCe..)...ar nrc emt eee ee erates ee, 8
7-8 201 restricted taithe spikelets Ory aries: metic. eeee eerste oes cere te 19
8. ‘Spores dimorphic; Columellasiliform, one’or Numerous. ...2.. cece cscscecstetesestaaeees 9
— Spores not dimorphic. Columella stout, one, sometimes branching... 14
Os eae Olumiella Ome ween. c re et eee Nasa, once ee teers st. UNE eee 10
cromiie OLUM ELIAS MUIMECTOUS a. ctgess ct .ceste 1 tates iano mena eae teeming ots tn treme nee ae 13
LO mo porevmallcpersistents eset, ween tee veces een Oat ner tes, oa eae een 11
=) opore, DallsieasilysSeparating tiem see Nicene cement. Sei hie eee ee 12
Pisses pores: 1015213: 5 LION Oe... comme eee eee eee Tea S. absconditum
=e gropores, 1 5-20(=2175 ii lone erases tee ere sree tet: cee tie S. blakeanum
12. Spores 10.5-17 um long, free surface coarsely echinulate ............:.... S. zambianum
— Spores 13-20 um long, free surface finely verrucose...........seseee S. guaraniticum
13. Spores 13.5-18.5(-20) um long. Sterile cells absent........... S. andropogonis-eucomi
— | Spores 9-14:5 um long. Sterile cells present...:.............0.:2-07-- S. pseudomaranguense
1Ase sspores very variable in sizey6-13(-16) pmlOng ccs encase seen seecectnsoaaenee tee S. zilligii
Eom SDOTES less Varta lepiinGiZe exe em tree cee oe ce tare ree cao rateae sh ee eee ee 5
15.) YSporesuay (0720) Umi lon oon... co. tema een eee ccs eee. ok s8 2, SLO LE, Oem 16
Ae SPOPOLES SIMA Cte screech tac ete ee RR SE Maircs scythe fen cee nee Ne is
16. Spores regular, with a rounded paler area .....scssssssssssssssssesssssseeeesssees S. culmiperdum
— Spores mostly slightly irregular, with irregular, paler and darker areas......S. ellisii
V7 5 Les pOres 7250-11 UL LONG oes re. coker ae eens ee cere eee S. andropogonis
= PPESPOLES LAL Ser’. s cause is ete tetra dine ual ea nt ten aee fear eet scentete mee 18
13," ‘Spores 9-13.5,umulong: wall even, 0;5 Wan (hicks: ne Metce cen vee 9. Stuhlmannii
— Spores 12-16 um long; wall uneven, 0.5-1.5 um thick... eee S. leucostachys
19(7). Sori in the ovaries, compact, hard, black.......... Ustilago andropogonis-tuberculati

sormuuthe spikelets; not hardand black Jiscssccee-rssevsee ces nae ee 20

PUMeeOOrLiTysOMe Spikelets Ol/ Aly INLOLESCEMCG Maem cetrtsetet cs csccsceutscsescstesnoesesestecs |
— Sori in all spikelets, both sessile and pedicelled, or only sessile ones of an
inflorescence (excepting sometimes’s. everhartii)it..M nde RL A aaa ene DY

21. Sori producing groups of witches’ brooms in the inflorescence ..........cccseseseseseees 22
Bem Ol NOL Producing’ WItCHES ‘DFOOI Same. dae hace haces accccespeerane seated 23
Se memopOless Os LOE) (ity LON Gre. wt ealt tented. atcceccurt feuecdaacrtbeo -sasgnieoreseaincl S. holwayi
ea POres:O.o- FMD ) MI LONG 790.4 Recoasnssdepat Mit hie ota -gde Wt. Ne een S. bicornis
Peep Ores NOL In-permanent balls; notdimOrphiGy.... .0it.eed. «esse MOOR ot Ph ites cay 24
Smee opores in permanent Dalisy CIMOLrpNic,.:...ssass-seceto ere rename ete ets cesccs 25
24. Spores prominently echinulate, single .................... Macalpinomyces ovariicolopsis
— Spores finely punctate-verruculose, in loose balls... eessesesseeeeeeeseseees S. berndtii
25. Columella one, simple. Warts 1-2.5 um long, filiform.......$. andropogonis-pumili
— Columellae several, or one, fused, band-like. Warts shorter, not filiform............ 26
26. Columellae several. Outer spores finely punctate-verruculose .............. S. scholzii
— Columella often band-like. Outer spores with 0.5(-1) um high warts or spines.....
sere Ante bet hector Hh 1 tine Wer rindconlin Re irra tlth e keerrt eet tase S. livingstoneanum

27(20). Columellae several, filiform (or one, filiform in S. schizachyrii) ......tceeeeee 28
— Columella one, flagelliform or stout, simple or with branches... cece: 30
Z5, spores not dimorphic, 7-10 Wim long a. tesesececee- dee S. andropogonis-gabonensis
BEE SPOLesCITNOL DIC Lal OC lecat vac, Nececrcrseie aati gee ae tea Re tea 29
eee poles o-10, 5 1m) Ong olelile Cells ADSelin eet tease tnne S. schizachyrii
SEE SDOLeSt 5-14 Si lone oletle Celis pl csclilee mcs me tet ar eee, S. gayanum
UM SOLES HCUITIOL OUI Cet ptvarte basa tetraA ied Ue i Bee ee ee eck ads Re 31
— Spores not dimorphic. Spore balls ephemeral or very loose uu... eeeeeeeeceeeeeeeeeees 35
31. Spore balls loose, 25-40(-50) um long... eeseeseeeeees S. andropogonis-chinensis
Smee Spore Dalls:permanent ongersstay oo ogee, eet Mier teen ee hes oti 32
32. Spore balls 50-130 um long. Outer spores 8-15 um long ....... eee S. everhartii
— Spore balls 50-180(-210) um long. Outer spores 6.5-10 um long «0... eee S. sp.
PS mamoporesis5. 18 unmlong ae melt eee eet e, ROU OI atest des, S. occidentale
a eoporesssmialleretter sed emey ole Pah ee) Ah ile, he ah ao Le ers 34
Samaroterile cellgtabseritoe ewer, | ee perenne er ee Me ctas sss near, sce deena 35
ont = oS WAS OAK Gy VSS ST eer rt eR ae Spi A Pete Aue CUNO «NE toe eR 9 rs 36
Soe oDore wall 0.5.1.2 Umm thicks thinner. On ONESINe ae ai cess asses S. braziliense
— Spore wall 1-2 um thick, uneven, thickest at the angles «0.0... eee S. polliniae
Co mop Oresyi-L0,0(21D) iin lone eee sce ees S. andropogonis-schirensis
mame opores larcer, up. tol 3S. one ath screener igre tee eee eee a7
37. Spore wall 0.5-1(-1.5) um thick, with a paler, thinner germ pore, finely, densely
Verricose-echinilatewsactss. saeettetaccsesaid. Pelee eee eet ame Reece noe S. distachyum

— Spore wall thinner, germ pore lacking, more finely ornamented... 38
38. Sori completely destroying the spikelets. Spore wall 0.5-0.8 um thick. Sterile cells
in compact, rounded or elongated Srovips. 2.20.2 ce Anise sceysceecees S. fastigiatum

Sori not so. Spore wall c. 0.5 um thick. Sterile cells not so........... S. seymourianum

The smut fungi of Sorghastrum (Poaceae)

Sorghastrum Nash, in the subfam. Panicoideae, tribe Andropogoneae, subtribe Sorghinae,
is a genus of about 16 species in Africa and tropical America. It is a relative of Sorghum
(Clayton & Renvoize, 1986:341). Five smut fungi could be recognised on Sorghastrum:

1. Macalpinomyces ugandensis Vanky, 2003:50.
Type on Sorghastrum stipoides, Uganda, Rakai Distr., 40 km SW. of Masaka, 6 km NE.
of Kyotera, alt. 1190 m, 27.11.2002, T., C. & K. Vanky, HUV 19992; isotypes BPI,
MHU, Vanky, Ust. exs. no. 1177. Paratype on Loudetia phragmitoides, HUV 19993;
isoparatypes BPI, K, MHU.
For description and illustrations see Vanky, 2003:50-52 & 55.
On Sorghastrum stipoides (Kunth) Nash, and Loudetia phragmitoides (Peter) C.E. Hubb.;
C. Africa (Uganda).

2. Sporisorium clintonianum Vanky, nom. nov.

Replacing Sphacelotheca chrysopogonis G.P. Clinton, Proc. Boston Soc. Nat. Hist. 31:387,
1904 (not Sporisorium chrysopogonis Vanky, 1983:327). — Type on Chrysopogon
nutans (= Sorghastrum nutans), Mexico, Chapala, 1901, E.W.D. Holway, BPI 177307;
isotopotypes in Seymour & Earle, Econ. fgi., Suppl. C, no. 118, HUV 9706!

Soriin all ovaries ofan inflorescence, c.3-5 mm long, showing between the spreading floral
envelopes, initially covered by a thin peridium which ruptures disclosing the blackish-
brown, semiagglutinated to powdery mass of spores and sterile cells, surrounding a
simple, central columella. Spores single when mature, subglobose, ellipsoidal to usually
slightly irregular, 7-9.5 x 7.5-10.5 um, light yellowish-brown; wall even, c. 0.5 um thick,
finely, densely punctate, spore profile smooth. Sterile cells in large, irregular groups,
single cells globoid, ellipsoidal or irregular, with flattened contact sides, 6.5-12 x 6.5-13
um, subhyaline; wall c. 1 um thick, smooth, collapsed in old specimens.

On Sorghastrum nutans (L.) Nash (Chrysopogon nutans (L.) Benth.); N. America

(Mexico, USA).
Fischer (1953:134) considered Sphacelotheca chrysopogonis to be a synonym of S.
cruenta (J.G. Kiihn) Potter (= Sporisorium cruentum (J.G. Kuhn.) Vanky, type on
Sorghum saccharatum (L.) Pers.). However, the two differ in sorus, spore and sterile cell
morphology which, in my opinion, is sufficient to treat them as two separate species.

3. Sporisorium sorghastri (Zundel) Vanky, comb. nov.

Basionym: Sphacelotheca sorghastri Zundel, in Massey & Zundel, Phytopathology 32:545,
1942. — Type on Sorghastrum elliottii, USA, Virginia, Pittsylvania Co., 2 miles W of
Chatham, Moses Mill Pond, 4.1X.1941, A.B. Massey 5059, BPI 193999!

Sori destroying the whole inflorescence, long linear, 2-4 mm wide, 7-10 cm long, at
first covered by a thick, pale brown peridium that ruptures irregularly, flakes away,
exposing the dark brown, semiagglutinated to powdery mass of spores and sterile cells
surrounding a central columella with several long, filiform branches. Spores single
when mature, subglobose, ovoid, ellipsoidal to slightly irregular, 7-10(-11) x 8-11(-12)
tum, yellowish-brown; wall even, c. 0.5 um thick, finely, densely punctate-verruculose,
spore profile smooth. Sterile cells in irregular groups or chains, single cells ellipsoidal
or irregular, with flattened contact sides, 7-12 x 8-16 um, hyaline; wall thin, c. 0.5 um,
smooth, collapsed in old specimens.
On Sorghastrum elliottii (Mohr) Nash; N. America (USA).

4. Sporisorium tepicense (Duran) M. Piepenbring, 2003:129.

Sphacelotheca tepicensis Duran, 1970:1098. — Type on Sorghastrum incompletum, Mexico,
Nayarit State, 38.6 km SE of Tepic, Hwy. Mex. no. 15, 29.X.1969, R. Duran, WSP
58550; isotype HUV 14419!

Sori in all ovaries of an inflorescence, ovoid or ellipsoidal, 0.5-0.8 x 1-2 mm, showing
between the spreading floral envelopes, first covered by a thin, fragile, dark brown
peridium which ruptures irregularly at maturity disclosing the blackish-brown,
semiagglutinated mass of spores and sterile cells surrounding a thin, central columella
of the length of the sorus. Spores single when mature, globose, ovoid or ellipsoidal, 6.5-9
x 7-11 um, medium dark reddish-brown; wall even, 0.5-1 tm thick, densely, coarsely
verrucose, spore profile wavy to finely serrulate. Sterile cells in short chains, or in small
groups, single cells globoid, ellipsoidal to usually irregular with flattened contact sides,
5.5-12 x 5.5-15 um, pale yellowish-brown; wall c. 1 um thick, smooth.

On Sorghastrum incompletum (J. Presl) Nash; N. America (Mexico). Known only from

the type collection.

5. Tolyposporella chrysopogonis G.F. Atkinson, 1897:16.
Type on Chrysopogon nutans (= Sorghastrum nutans), USA, Alabama, Auburn, autumn,
Duggar, no special collection designated.

Sori on inner surface of leaf sheaths, by which they are concealed, forming linear, more
or less confluent, initially subepidermal, later bursting striae filled with black, granular-
agglutinated masses of spore balls. Spore balls subglobose, oblong, subpolyhedral,
usually more or less irregular, 40-80 x 50-175 um, reddish- to blackish-brown, opaque,
composed of numerous, firmly agglutinated spores, separating with difficulty. Spores
subglobose, ovoid, usually irregular, (7-)8-9.5 x 8-13(-15) um including the thin (c. 1
um), dark endospore but excluding the irregularly thickened (2.5-8(-14) um), laminated,
light yellowish-brown, smooth exospore which, on the outer spores of the ball may be
excessively thickened forming long (up to 14 um), often bent appendages; with such
thickenings of the spore wall the spores may reach 30 um in length. Spores “germinating
by a delicate promycelium which becomes branched, septate. Sporidia borne laterally,
single, subclavate or fusoid, 2-2.5 x 9-12 um” (Atkinson, 1897:16).

On Sorghastrum nutans (L.) Nash (Chrysopogon nutans (L.) Benth.; C. avenaceus

(Michx.) Benth.; S. avenaceum (Michx.) Nash), S. stipoides (Kunth) Nash; C. Africa

(Uganda), N. America (USA).

Key to the smut fungi of Sorghastrum

1. Sori on the inner surface of leaf sheaths. Spore wall 3-9(-15) um thick «i.
oe ace Ree eet re ethed OE ee vem RO pe ai Tolyposporella chrysopogonis
em orelsewheressporewvall.0.9. TaumthiCk yo aie te eee ticle eres 2

2. Sori on the top of shoots forming up to 1 m long, flagelliform tubes ..........00..0..
La ARE rie BALROG RS OR AT ARR ORD MOAT RE ani ty oh arpa ear Macalpinomyces ugandensis

= SOL MI OUSOm ete eee eT ee SU cscs sg Ra cas aspera Rcassas MMOS (Roly pete occas eas Os 3
3 SOUL AU NOLeMEOTeS COCO ieee ree ee Sporisorium sorghastri
~ SON LOS OVALICSE ok cite Mansel esesesieth te ote coer sce ee ee eee ew oe 4
SPOrEes Gensely, Goatsehy, VELIUCOSE) teeth crctonsttise ecg tees Sporisorium tepicense

SPOLESCENSEly Ney UNCLALC e.cecetectescks, fertonseoseteesntees Sporisorium clintonianum

The smut fungi of Leptochloa (Poaceae)

Leptochloa P. Beauv. (including Diplachne P. Beauv.), in the subfam. Chloridoideae,
tribe Eragrostideae, subtribe Eleusinae, is a genus of 40 species throughout the tropics,
warm temperate parts of America and Australia (Clayton & Renvoize, 1986:208). On
Leptochloa and Diplachne seven smut fungi are recognised:

1. Tilletia leptochloae Thirumalachar & Pavgi, 1968(1969):253.
Type on Leptochloa filiformis (= L. panicea), India, Rajasthan, Ajmer, X.1955, P.N. Mathur
1259, HCIO(?).

According to the original description, sori in the ovaries, few ovaries in the panicle
attacked to form dirty green, minute, round bodies up to 1 mm in diameter, half enclosed
by the glumes and rupturing irregularly to expose black, dusty spore mass. Spores
globose, subglobose, ovoid, 12.9-17.2 um in diameter; wall medium thick, ornamented
with short, blunt, triangular processes. Sterile cells numerous, globose to subglobose,
occasionally irregular, about the size of the spores, hyaline, thick-walled, smooth.

On Leptochloa panicea (Retz.) Ohwi (L. filiformis Nees), L. uniflora A. Rich; S. Asia

(India).

2. Tilletia salzmannii Maire, in Maire & Werner, 1937:47.
Type on Koeleria salzmannii (= Leptochloa salzmannii), Morocco, Moyen-Atlas, Plateau
d'Ito, alt. 1450 m, VII.1921, R. Maire, MPU; isotype HUV 13106!
Sori in the ovaries, ovoid or lemon-shaped, 0.5-0.8 x 1-1.5 mm, hidden by the floral
envelopes, dark brown, covered by a thin membrane of the pericarp which ruptures
irregularly disclosing the dark brown, semiagglutinated to powdery mass of spores and
sterile cells. Spores globose to broadly ellipsoidal, 18-24(-28) x 18.5-26.5(-28) um, pale to
medium yellowish-brown; wall 2.5-3.5 um thick, usually completely, rarely incompletely
reticulate, 6-10 meshes per spore diameter, muri 1-2(-2.5) um high. Sterile cells globose,
ovoid to irregular, 10-17 um long, hyaline; wall even, c. 1 um thick, smooth, content
homogeneous.
On Lophochloa salzmannii (Boiss. & Reuter) H. Scholz (Koeleria salzmannii Boiss. &
Reuter); N. Africa (Morocco), S. Asia (Iran).
In the original description of T. salzmannii, the spores were cited as 14-18 um. These
results could not be confirmed by study of the type specimen under standard conditions
(spores in lactophenol, gently heated to boiling point).

3. Tranzscheliella amplexa (Syd.) Vanky, 2004a:109.
Ustilago amplexa Sydow, 1924:278. — Type on Diplachne fusca, Egypt, Belbes in the delta

of Nile River, V.1880, G. Schweinfurth; isotypes Thtimen, Mycoth. univ. no. 1818,

HUV 3854!
Sori surrounding the upper internodes of sterile shoots, 0.2-0.3 x 10-15 cm, partly hidden
by leaf sheaths, initially covered by a thin, greyish peridium which flakes away disclosing
the olivaceous-brown, powdery mass of spores. Spores globose, subglobose, rarely ovoid
or broadly ellipsoidal, flattened, in side view 4-5 um wide, in plane view 5.5-6.5(-7) x
6-7(-7.5) um, medium yellowish-brown; wall even, c. 0.5 um thick, slightly thinner on
the flattened sides, in LM smooth, in SEM finely, moderately densely verruculose.

On Diplachne fusca P. Beauv. ex Roem. & Schult.; N. Africa (Egypt).

3}9)

4, Tranzscheliella serena (Syd.) Vanky, 2004a:109.

Ustilago serena Sydow, 1937:24. — Type on Diplachne fusca, Australia, New South Wales,

between Warren and Collie, 1.1936, L. Fraser 195; isotypes IMI 44656, HUV 17815!
Sori surrounding the uppermost culms, partly hidden by leaf-sheaths, initially covered by
a delicate, grey or lead-coloured peridium which flakes away disclosing the olivaceous-
brown, powdery mass of spores. Spores globose to broadly ellipsoidal, 6.5-8 x 7-10
tum, pale yellowish-brown; wall even, c. 0.5 um thick, smooth in LM, finely, sparsely
verruculose in SEM.
On Diplachne fusca P. Beauv. ex Roem. & Schult.; Australia. Known only from the type
collection.

T. serena differs from T. amplexa especially in the larger, paler spores.

5. Ustilago heterogena Hennings, 1904:155.
Type on Leptochloa virgata, Brazil, Rio Jurua, Bom Fim, X.1900, E. Ule 2675. Topotype:
1901, E. Ule, in Mycoth. brasil. no. 3, HUV 3712!

Sori in various parts of the host plants, forming conspicuous galls or fusiform swellings
on stems, leaves, inflorescence, often about 15 x 40 mm or larger, up to 2 x 12 cm, or
restricted to the spikelets and as small as 0.5-1 mm in diameter, first covered by a thick,
brown peridium of host tissues which ruptures irregularly at maturity disclosing the
dark chocolate-brown, semiagglutinated to powdery mass of spores. Spores varying in
shape and size, globose, subglobose, ellipsoidal, oblong, irregular, occasionally bent or
with an acute tip, (7-)8-13 x 9-13.5(-15) um, medium dark reddish-brown; wall even, c.
1 um thick, densely low echinulate, spore profile finely serrulate.

On Leptochloa filiformis (Lam.) P. Beauv. (L. mucronata Kunth), L. scabra Nees, L.

virgata (L.) P. Beauv., L. viscida (Scribner) Beal; N. America (Mexico, USA), S. America

(Brazil).

6. Ustilago ornata Tracy & Earle, 1895:175.
Type on Leptochloa mucronata (= L. filiformis), USA, Mississippi, Starkville, 1.X.1894,
S.M. Tracy, BPI 164358, 164361; isotypes in Ellis & Ev., N. Amer. fgi. no. 3340, HUV
9325!, HUV 4257! Topotype: 27.VHI.1895, S.M. Tracy; isotopotypes in Seymour &
Earle, Econ. fgi. no. 542, HUV 7306!, and Reliquiae Seymourianae, HUV 9931!
Sori in ovaries, infecting only some in the inflorescence, ovoid, often with a short, acute
tip, 0.7-1 x 1-1.8 mm, initially covered by a thin layer of the pericarp which ruptures
irregularly disclosing the dark brown, semi-powdery mass of spores, or the sori fall off
the plant entirely. Spores varying in size, globose, ovoid, ellipsoidal, rarely oblong or
irregular, 9-14.5 x 10-16 um, yellowish-brown; wall even, c. 0.5 um thick, prominently,
moderately densely echinulate, spines up to 1.5 um high, in SEM between the spines
finely verrucose.
On Leptochloa filiformis (Lam.) P. Beauv. (L. mucronata Kunth), L. uninervia (Presl)
Hitchc. & Chase (L. imbricata Turb.); N. America (USA).

7. Ustilago thaxteri Zundel, 1939:579.
Type on Leptochloa uninervia (det. A. Chase), Argentina, Buenos Aires, 29.IX.1905, R.
Thaxter, BPI 168169!; isotypes FH 7899, 7907, 7911, HUV 18704!
Sori destroying the whole inflorescence and extending down to and surrounding the
upper portions of the stem, long cylindrical, 1-3 mm in width, 10 cm or more in length,

at first partly hidden by leaf sheaths and covered by a greyish-silvery delicate membrane
which flakes away revealing a semiagglutinated to powdery, olivaceous-brown spore
mass. Spores globose, ovoid to ellipsoidal or slightly irregular, (7-)8-10.5 x 8-11(-12)
um, light olivaceous-brown; wall even, c. 0.5 tm thick, apparently smooth to very finely
punctate, in SEM finely, moderately densely verrucose.
On Leptochloa uninervia (Presl) Hitchc. & Chase; $. America (Argentina).

A Tilletia, collected on Leptochloa uniflora A. Rich in Nyasaland (= Malawi), N.A.,
Kalembo, 8.VI.1955, C. Jackson 1684, represents a new species. Unfortunately, the IMI
60435 specimen contains only some spores on the envelope. Because of the paucity of
the specimen, no formal description was made, only an informative one, to call attention
to this bunt.

“Tilletia leptochloae-uniflorae’ nom. prov.

Sori in the ovaries(?). Spores globose, subglobose, rarely ellipsoidal, 19-25 x 19-25
tm, medium to dark olivaceous-brown, provided with 2-3 um high, cylindrical warts
with flattened top, in surface view showing as darker, irregular groups, 5-8 per spore
diameter, each group composed of 3-10 punctiform elements, in optical median view
18-24 warts on the equatorial circumference. Sterile cells globose, ellipsoidal to irregular,
variable in size, 12-26 x 13.5-30 um, pale olivaceous-brown; wall 1.5-2.5 um thick,
smooth, content granular.

Key to the smut fungi of Leptochloa

Poss MOLULM: OVALICS trctsersecnrctte cereeetreg! teeters sRederearctecct eaaceren tte cette grea a etter ante cee ee 2
- Sori Clsewhtere sere ereonee cette cre amet tec ctar cree terrier tence ter te eee eee eee 5
DT Mert SDOLES TELICLLLALE tests: eter rem Seen etrt ee rest tee eae tree eeec ear Tilletia salzmannii
- Spores, Witholher Ornament cence te cetera etre cers eee et cee ee ere ee 3
3. 4), spores prominently echinulate, Sterile,cells absent.<....e-. Ustilago ornata
- Spores with blunt or,flattened warts. sterile cells present... cae cseessreceea eee 4
4. Spores 19-25 um long, with cylindrical warts........ “Tilletia leptochloae-uniflorae”
~ Spores 13-17.5 um long, with subconical warts... eee Tilletia leptochloae
5(1) .sorlsurroundinguppen internodes: 18., ai..c.atseehe. eee anes ate: ee
- SOti OLHenwise he. arene eco elt Ane Hk rend eta ot eeoeee eee Teaeee® SOP ge 8
6S pores.6-7 (g725) LIMON eres ee) sure anette, WE Oa rtae Tranzscheliella amplexa
- Sporesi7-l Orpnviiong saute ie ate takes. cee Tranzscheliella serena
7. Sori forming conspicuous galls in various parts of the host. Spores densely low

echinulate twirl Sk LEER LE eT ee Ustilago heterogena
- Sori in the whole inflorescence, long cylindrical. Spores apparently smooth to

VER VMINGLY: PUNCLALC Hr rsste eo cceeene Nts e Cee ee ee eee Ustilago thaxteri

The smut fungi of Chloris (Poaceae)

Chloris Sw., in the subfam. Chloridoideae, tribe Cynodonteae, subtribe Chloridinae, has
about 55 species in tropical and warm temperate regions of both hemispheres (Clayton
& Renvoize, 1986:236). On Chloris at least 13 smut fungi have been described. Of
these, Tolyposporium chloridis is a hyphomycete, Sphacelotheca chloridis is Sporisorium
andropogonis on Bothriochloa pertusa, Ustilago liebenbergii is a synonym of U. elegans,

and Sorosporium chloridicola is identical with Ustilago induta. The recognised nine
species, some of them doubtful, are:

1. “Entyloma” chloridis Thirumalachar & Pavgi, 1968(1969):251.
Type on Chloris barbata, India, Poona, at Pimpri, 8.X.1955, M.J. Thirumalachar 1253,
HCIO(?)
Sori in the leaves and leaf sheaths forming blackish, slightly raised, often coalescent,
0.5-5 mm long streaks along the veins. Spores agglutinated, single spores globose,
subglobose, ovoid or irregularly polyhedral, 10-14.3 um in diameter, dark olive-brown;
wall thick, smooth.
On Chloris barbata Sw.; S. Asia (India).

This is one of the dark-spored “Entyloma” species on Poaceae, which belongs either to the
genus Jamesdicksonia, Phragmotaenium or Eballistra, depending on spore germination
and/or molecular characters. No specimen was available for study. Description taken
from the original.

2. Tilletia chloridicola Ciferri, 1928:10.
Type on Chloris paraguaiensis (= C. inflata), Dominican Republic, Distrito Nacional,
Haina, IX.1925, R. Ciferri (type where’).

Sori in the flowers and ovaries, inflated and twisted. Spore mass chestnut-brown,
odourless. Spores globose, rarely ovoid, 12.5-15(-18) um, brown; wall thick, densely
covered with conical, pointed to subacuminate spines, 0.8-1 um high.

On Chloris inflata Link (C. paraguaiensis Steud.); West Indies (Dominican Republic).

No material was available for study. Description taken from the original. Based on
the short description, most probably it is not a Tilletia. It could be a Ustilago or a
Macalpinomyces species.

3. Ustilago chloridicola Hennings, 1898:267.
Lectotype on Chloris sp., USA, California, Mendocino Co., Potter Valley, IV.1894, A.
Purpus, (designated here) BPI 159608!; isotypes BPI 159609 & 196337.

Sori destroying the distal part of the culms including the inflorescence, 2-5 x 10-20(-30)
mm, dark brown, powdery, causing shredding of the infected tissues. Spores variable
in shape and size, globose, ovoid, long ellipsoidal, sometimes lacrymiform, (5.5-)6-9 x
6.5-11(-12) um, olivaceous-brown; wall even, c. 1 um thick, densely verrucose, several
warts fuse, giving the spore surface an irregular pattern, spore profile wavy.

On Chloris verticillata Nutt., Chloris sp.; N. America (USA).

4. Ustilago chloridis Vanky, C. Vanky & R.G. Shivas, in Vanky & Shivas, 2001:171.
Type on Chloris lobata, Australia, Queensland, 51 km S of Lakeland, 5.1I1.2000, C. & K.
Vanky, BRIP 27016; isotypes HUV 19177 and in Vanky, Ust. exs. no. 1084.

Sori in some ovaries of an inflorescence, lemon-shaped, 2-3 mm long. Spores subglobose
to ellipsoidal, 9.5-13 x (10-)11-13.5(-15) tm, slightly flattened (8-11 um wide); wall
uneven, 0.5-1 um thick, sparsely low verruculose, spore profile smooth to very finely
serrulate. !

On Chloris divaricata R. Br., C. lobata Lazarides, C. truncata R. Br.; Australia.

5. Ustilago deserticola Spegazzini, 1899:209.
Type on Chloris sp., Argentina, Salta Prov., near Amblaio, 1.1897, C. Spegazzini (type
where?).

Sori on the stems (internodes) and rhizomes, blackish-brown, narrow, subepidermal,
causing no deformation. Spores globose, subpolyhedrally irregular, often compressed,
5-7 um in diameter, blackish-brown; wall thick, smooth.

On Chloris sp.; S. America (Argentina). Known only from the type collection.

No material was available for study. Description taken from the original. I suspect that
this is not a smut fungus.

6. Ustilago elegans Griffiths, 1902:292.
Type on Chloris elegans (= C. virgata), USA, Arizona, Cochise, X.1900, D. Griffiths, BPI
160338}; isotypes in Griff., W. Amer. fgi. no. 309, HUV 19955!
Ustilago liebenbergii Zundel, 1943:165. — Type on Chloris virgata, South Africa, Transvaal,
Wolmaransstad Distr., Vlakfontein, VII.1932, L.C.C. Liebenberg, PREM 26412 &
24412; isotypes BPI 162512, HUV 15374! (syn. nov.).

Sori destroying the inflorescence, and also present within the upper 1-3 leaf sheaths
(probably in induced, young inflorescence), more or less hidden by leaves and leaf
sheaths, dark brown, powdery. Spores globose, subglobose to broadly ellipsoidal, 9.5-13
x 10-14.5 um, laterally compressed, 7-10.5 um wide, yellowish- to reddish-brown; wall
even, 0.5-1 um thick, moderately densely verrucose-echinulate, which just affects the
spore profile. Spore germination (Duran, 1987:231) results in phragmobasidia with 4-5
or more cells producing hyphae.

On Chloris submutica H. B. K., C. virgata Sw. (C. elegans H. B. K.); Africa (South Africa),

E. Asia (China), N. America (Mexico, USA).
According to Piepenbring (2003:165) probably also on Chloris beyrichiana Kunth (C.
radiata Sw.) in Bolivia but the sori are forming pustules on the leaves.

No difference in the sorus and spore morphology of Ustilago liebenbergii and U.

elegans could be found, hence they are considered to be synonyms.

7. Ustilago induta Sydow, 1939:199.
Type on Chloris breviseta, Sierra Leone, Njala, 12.X1.1930, EC. Deighton 311, IMI 43068!,
BPI 162017!
Sorosporium chloridicola Beeli, 1922:7 (not Ustilago chloridicola Henn., 1898). — Type on
Chloris polydactyla (L.) Sw. (= misnamed Chloris virgata, det. J. Bosser, BR), Congo,
Kinshasa, 1.VI.1916, H. Vanderyst, BR 1328!; isotype BPI 195122! (syn. nov.).

Sori in some ovaries of an inflorescence, ovoid, c. 1.5 x 2 mm, hardly evident and
only slightly protruding, first covered by a leather-brown peridium enclosing a dark
olivaceous-brown, powdery mass of spores. Spores globose, subglobose to ellipsoidal,
7.5-11 x 8-12 um, yellowish-brown; wall even, c. 1 um thick, sparsely verrucose, spore
profile smooth to finely wavy.
On Chloris breviseta Benth., C. virgata Sw.; C. & W. Africa (Congo, Sierra Leone).

Spore balls in Sorosporium chloridicola, reported by Beeli (1922:7), are the result of
insect work!

8. Ustilago ulei Hennings, 1895b:88.
Type on Chloris sp., Brazil, Goyaz Prov., Bom Frio, Vil. 1892, E. Ule 1955, HBG!; isotypes
BPI 168674, BPI 168677.

Sori forming striae on the leaves, 0.5-1 x 1-30 mm, grey, covered by the epidermis
which ruptures longitudinally and the dark brown, powdery mass of spores is scattered
leaving behind the perforated or shredded leaves. Spores globose, subglobose, ellipsoidal
or slightly irregular, 8-10.5 x 8-11 tm, laterally compressed, 5.5-8 um wide, yellowish-
brown; wall even, 0.5-1 um thick, finely, moderately densely punctate-verruculose, spore
profile smooth. Spore germination (Duran, 1987:256) results in hyphae or in 2-3-celled
basidia producing basidiospores.

On Chloris submutica H. B. K., C. virgata Sw., Chloris sp.; N. & S. America (Mexico,

Argentina, Brazil).

9. Ustilago valentula Sydow, 1937:24.
Type on Chloris acicularis (= Enteropogon acicularis), Australia, New South Wales,
between Warren and Collie, 1.1936, L.R. Fraser 194, MEL; isotypes BPI 169382, BRIP
8041, HUV 17962!, IMI 44467.
Ustilago enteropogonis Vanky, 2002a:378. — Type on Enteropogon ramosus, Australia,
New South Wales, Bedgerebong, “Tresta, 26.III.1982, J. Bollinger & I. McGowen, DAR
41433; isotype HUV 19540! (syn. by Vanky, 2005a:264).
Sori destroying the inflorescence, 4-8 x 15-20 mm, initially covered by a thin, greyish
peridium which flakes away disclosing the dark brown, powdery mass of spores. Spores
subglobose, ellipsoidal to slightly irregular, 9-13 x 10-14.5 um, yellowish-brown; wall
even, c. 1 um thick, densely, minutely verruculose-echinulate, spore profile finely
serrulate.
On Chloris bournei Rang. & Tadul., C. pycnothrix Trin., Enteropogon acicularis (Lindl.)
Lazarides (Chloris acicularis Lindl.), E. ramosus B.K. Simon; NE Africa (Ethiopia), Asia,
Australia.

Excluded species or not on Chloris

Tolyposporium chloridis is a hyphomycete
Tolyposporium chloridis Henn., in Engler, 1895c:49. — Tolyposporidium chloridis (Henn.)
Thirumalachar & Neergaard, 1977(1978):180. — Type on Chloris abyssinica Hochst.,
Africa, “Steppe am Papyrussumpf’, coll. Volkens 456.

According to Zundel, 1938:319, this is a hyphomycete.

Sphacelotheca chloridis is Sporisorium andropogonis
Sphacelotheca chloridis Mundkur, 1944:50. — Type on “Chloris barbata Sw” = misnamed

Bothriochloa pertusa (L.) A. Camus (teste K. Vanky), India, Mysore, Bangalore,
Karnataka, 20.VIII.1942, M.J. Thirumalachar, HCIO 10000; isotypes BPI 195098,
HUV 17273. It is Sporisorium andropogonis. (syn. by Vanky, 2004b:226).

On the label of the type specimen, the original name of Sphacelotheca bothriochloae

on Bothriochloa pertusa was crossed out and changed into Sphacelotheca chloridis on

Chloris barbata Sw. However, study of some remnants of an infected inflorescence in the

type collection revealed that the host is Bothriochloa pertusa, with a deep, circular pit on

the lower glume of the sessile spikelet.

Key to the smut fungi of Chloris
(U. = Ustilago)

Lo) See SOF On, thie; stems Ol eaves (OF IN @ Stl aerate ye eet er eens ce ee eae ee 2
- SOL i the Ovaries, 1lOWers OF INLIOTESCENCE writ: ch atic ete reenter en este 4
2. Spores embedded in the host tissue, agglutinated .........0.0..0.... “Entyloma” chloridis
- SPOLCS NOUS arte re ceaeetiarie coeds stertan saree Ue te enters esate rten sgt M cates ucstes de tae eee 3
Se POPOles )- [LONG SIOOUL ss as starter eee ae eemeet ee cer ea eatas U. deserticola
- Spores 8-llsimilongypumctate-verruCulOSeiatss Sag.2g.ktsee search tess eeroeee U. ulei
AP MAN SOLE TL COVALIES O05, cts 5 tacos tenet esc soap cae iaeede settee eee sae teen eee cers >

BOLLIM the InflOrescences water et Lee ae eee ee eects cere meeten te eee i
5. Spores 12.5-15(-18) um long, with conical spines................. “Tilletia” chloridicola
- Sporesismalleresparsely verticulose tr: san Whiner ct eho eee ee 6
62. SSpOTes Salou long eae Scan. Mee eal eee a meee 8 chee OM aM De cena ee U. induta
- spores:G10s) k14 13iS Gla imlonge anh. chee oa cet eet fe eee U. chloridis
7. “) Spores’65211(-12) um long} irregularly verrticosemaeceye U. chloridicola
~ Spores 10-145 inmlong, regularly ornamented BRGe aie att se erie cose. csns. 8
8.) we spores echinulatesspore’protile serrulate tye tee ee U. valentula

- Spores finely verruculose-echinulate, spore profile smooth or nearly so U. elegans

The smut fungi of Jardinea, Phacelurus and Rhytachne (Poaceae)

Jardinea Steud. (1 sp.), Phacelurus Grieseb. (9 spp.) and Rhytachne Desv. (12 spp.) belong
to the subfam. Andropogoneae, tribe Rottboelliinae. Actually, Jardinea is considered a
synonym of Phacelurus (Clayton and Renvoize, 1986:363). On members of these genera
five smut fungi are known. A sixth one is described below.

ike Franzpetrakia microstegti Thirum. & Pavgi, in Pavgi & Thirumalachar, 1957:2.
Type on Microstegium sp., India, Uttar Pradesh, Mussoorie Hills, 1X.1954, M.S. Pavgi
(type where?).
Sori destroying the whole inflorescence. The spores are mixed with long, slender, fungal
filaments.
For a detailed description and illustration see Guo, Vanky & Mordue, 1990:58-62, or
Vanky, 2002b:66-67.

On Microstegium sp. and Phacelurus latifolius (Steud.) Ohwi var. monostachyus Keng; S
& SE Asia (India, China).

2. Sporisorium rhytachnes (Syd.) Vanky, 2000:171.
Sphacelotheca rhytachnes Sydow, 1939:202. — Type on Rhytachne triaristata, Sierra Leone,
Mama Beach near Kent 3.XII.1936, EC. Deighton 1109, IMI 43050!; isotypes BPI
113630, BPI 95072, HUV 17496.

The sori destroying the whole racemes, columella present. The spores are finely to
prominently verruculose-echinulate. |
For a detailed description see Vanky, 2000:171.
On Rhytachne triaristata Stapf; W Africa (Sierra Leone). Known only from the type
locality.

3. Sporisorium rhytachnes-rottboellioidis Vanky, 2003:54.
Type on Rhytachne rottboellioides, Uganda, Masaka Distr., 13 km E Masaka, alt. 1140 m,
17.11.2002, C., T. & K. Vanky, HUV 19994; isotype in MHU, BPI, IMI, K.
Sori in all ovaries of an inflorescence, columella present. Spores finely, densely
punctate.
For a detailed description and illustration see Vanky, 2003:54-55 + fig. 41.
On Rhytachne rottboellioides Stapf; Africa (Uganda). Known only from the type
locality.

4. Tolyposporella rhytachnes Viennot-Bourgin, 1958:167.
Type on Rhytachne minor, Guinea (French), near Kindia, Foulaya, 1.1957, G. Viennot-
Bourgin, PC; isotype in HUV 15804!
Sori on the adaxial side of the rolled, tube-like leaves. Spores 9-25 um long, wall
multilayered, 2-8 um thick, smooth. For a detailed description see Vanky, 2000:172.
On Rhytachne minor Pilger; W Africa. Known only from the type locality.

Amongst specimens obtained in exchange from the late Prof. Ch. Zambettakis, there
is an unnamed smut fungus collected in Gabon, on Phacelurus gabonensis, which
represents a new species:

5. Ustilago gabonensis Vanky, sp. nov.
Typus in matrice Phacelurus gabonensis (Steud.) Clayton, Gabon, Moyen Ogooué, oppid.
Ndjolé, c. 100 km SW Libreville, 0°07’ S, 10°45’ E, 10.1.1972, leg. M.G. Gilles, HUV 20999!;
isotypus in BPI.

Sori in spiculis nonnullis sessilibus inflorescentiae eiusdem, elongate cylindrici, torti,
1-2 x 10-30 mm, plerumque 3 in eadem spicula, peridio pallide brunneo cooperti, quo
longitudinaliter in locis nonnullis rupto massam sporarum mediocriter atrobrunneam,
pulverescentem ostendentes. Columella nulla. Sporae singulae, globosae, subglobosae,
ovoideae, ellipsoidales, raro elongatae vel parum irregulares, 8-11 x 8-13(-14) um, pallide
flavidobrunneae; pariete aequali, 0,5-0,8 um crasso, verrucis vel spinis paulo sparse
distributis, latis, humilibus, imago obliqua sporarum undulata vel leniter, sparse serrulata.
Cellulae setriles absentes.

Sori (Fig. 19) in some sessile spikelets of an inflorescence, long cylindrical, twisted, 1-2
x 10-30 mm, usually three in each spikelet, covered by a pale brown peridium which

_ splits longitudinally in several places disclosing the medium dark brown, dusty mass of

spores. No columella. Spores (Figs. 22, 23) single, globose, subglobose, ovoid, ellipsoidal,
rarely elongate or slightly irregular, 8-11 x 8-13(-14) um, pale yellowish-brown; wall
even, 0.5-0.8 um thick, provided with rather sparsely situated, wide, low warts or spines,
spore profile wavy or finely, distantly serrulate. Sterile cells absent.
On Poaceae: Phacelurus gabonensis (Steud.) Clayton (Jardinea gabonensis Steud.;
Rhytachne gabonensis (Steud.) Hack.); Africa (Gabon). Known only from the type
collection.
At first sight, this smut appears to be a Sporisorium. However, because of the lack of
columella/ae, spore balls and sterile cells, it is placed in the genus Ustilago.

6. Ustilago jardineae (Zambett.) Vanky, comb. nov.
Basionym: Cintractia jardineae Zambettakis, Bull. Soc. Mycol. France 95:408, 1979(1980).
— Type on Jardinea gabonensis (= Phacelurus gabonensis), Congo, “Mission Congo
Belge”. No further data. Type BR 258 (lost).

Fig. 19. Sori of Ustilago gabonensis in some sessile spikelets of Phacelurus gabonensis (type). Habit,
and enlarged some infected and healthy spikelets.
Bars = 1 cm for habit, and 3 mm for the detail drawing.

Sori in ovaries, small, completely hidden by the glumes, ovoid or elongated, brown,
agglutinated. Spore mass powdery. Spores globose, blackish-brown, 15-18 tm in
diameter; wall 1.5-2 um thick, granular or punctate.

Phacelurus gabonensis (Steud.) Clayton (Jardinea gabonensis Steud.; Rhytachne
gabonensis (Steud.) Hack.); Africa (Congo). Known only from the type description.

No specimen was seen. The type (BR 258) is lost. It is not in BR or PC. Description
based on the original and on fig. 1. in Zambettakis, 1979(1980):395. The short and
incomplete original description does not allow a sure generic placement. It is certainly
not a Cintractia, which is restricted to host plants in the Cyperaceae. Because no
peridium, columella/ae, spore balls or sterile cells were mentioned by Zambettakis, it is
recombined into the genus Ustilago.

Key to the smut fungi of Jardinea, Phacelurus and Rhytachne

1. Sori on the leaves. Spore wall 2-8 um thick... Tolyposporella rhytachnes
- Soritersew here, spore walkthinner a e.cccseeetce ete tee ee ce ee eee eee nce eee 2
2. Spores intermixed with long, slender, fungal filaments. Franzpetrakia microstegii
- Spores NOt interinixed. WIL LUNG Al ainenits eet meme cena etter nel. 3
Dare oollcestrovine the wnole racetiese. saree) ee. cr- ee Sporisorium rhytachnes
- Sonmou destroying the whole ace Mesa. aan seme sme, ect eee cee ee nee 4
MIE ODORS: SEO HITIMONS Cage. ice eet ee a eee, Ustilago jardineae
- Spores: 7/5213 (614) (anilongteeemcrt. terete cn ener eee: eee eer nee eee ee 5
5. Sori in all ovaries. Columella present......... Sporisorium rhytachnes-rottboellioidis
~ Sori insome spikelets, Columellarabsentin erm cane te eee Ustilago gabonensis

Two synonyms

Pericladium flavesci is considered to be P. grewiae .

Prasad & Tyagi (1961:500) described Pericladium flavesci, based on minor differences
in sorus and spore germination characters compared with the common and polyphagous
P. grewiae. According to the original description, P flavesci has somewhat larger and
sparsely distributed sori, somewhat lower optimal temperature of spore germination,
longer basidia and more globose basidiospores than P grewiae. In my opinion, these
differences do not justify the recognition of a separate species. Consequently, I consider
P. flavesci a synonym of P. grewiae.

Pericladium grewiae Passerini, 1875:185.
Ustilago grewiae (Pass.) Hennings, 1900:(75). — Type on Grewia cf. mollis, Eritrea, near
Sciotel, Zedamba, VI.1870, O. Beccari.
Pericladium flavesci Prasad & Tyagi, 1961:500. — Type on Grewia flavescens, India,
Rajasthan, Bagdara, Udaipur, 6.X1.1958, J. Abraham., K.L. Kothari & R.N.S. Tyagi,
HCIO 27004; isotype HUV 15507! (syn. noyv.).
For description and illustration, including spore germination, see Vanky, 2002b:122-
b2 3:
On Tiliaceae: Grewia asiatica L., G. breviflora Benth., G. carpinifolia Juss., G. columnaris
Sm., G. flavescens Juss., G. microcarpa Schum., G. mollis Juss., G. orbiculata Rottl.,
G. retusifolia Kurz, G. venusta Fresen, G. villosa Willd., Grewia sp.; Africa, S. Asia,
Australia.

Sphacelotheca rhaphidis is Sporisorium tumefaciens

Sphacelotheca rhaphidis was described on Rhaphis aciculatus, which is a synonym
of Chrysopogon aciculatus. On C. aciculatus two smut fungi are known: Sporisorium
andropogonis-aciculati (Petch) Vanky, and S. tumefaciens. A comparison of the types
revealed that Sphacelotheca rhaphidis is a synonym of Sporisorium tumefaciens, on
Chrysopogon pallidus.

Sporisorium tumefaciens (McAlpine) Vanky, 1983:328.

Lectotype (designated by Vanky, 2005b:182) on “Stipa pubescens R. Br.’ = misnamed
Chrysopogon sp. (teste S.T. Blake, in Herbert & Langdon, 1941:2, confirmed), Australia,
Queensland, 40 miles S of Cloncurry, 10.V.1909, G.H. Robinson, VPRI!

Sphacelotheca rhaphidis L. Ling, 1949:128. — Type on Rhaphis aciculatus Retz. (=
Chrysopogon aciculatus (Retz.) Trin.), Philippine Islands, Luzon, Manila, Wack-Wack
Country Club, 10.IX.1945, C.T. Rogerson 662, BPI 113317!; isotype BPI 195059! (syn.
nov.).

For its description see Vanky, 2005b:182.
On Gramineae: Chrysopogon aciculatus (Retz.) Trin., C. caeruleus (Steud.) Watson, C.
fallax S.T. Blake, C. latifolius S.T. Blake, C. pallidus (R. Br.) Trin. ex Steud., Chrysopogon
sp.; S. Asia, Philippines, Australia.

Miscellaneous new species
A NEW USTILAGO ON PENTASCHISTIS (POACEAE)

Ustilago pentaschistidis Vanky, sp. nov.
Typus in matrice Pentaschistis pallida (Thunb.) Linder, South Africa, Western Cape Prov.,
Cederberg Mts., Driehoek, 32°26'21” S, 19°11°13” E, alt. 915 m, 12.X.2004, leg. R. Berndt
[within the “BIOTA Southern Africa Project (SO3)”], holotypus in PREM; isotypi in HUV
20880 et in Z+ZT.
Ustilago pentaschistidis distincta a specie Ustilago dregeana L.-R. & C. Tulasne (Ann.
Sci. Nat. Bot., Sér. 3, 7:83, 1847, typus in matrice Danthonia sp.) et a specie Ustilago
dregeanoides K. & C. Vanky (in Vanky, Mycotaxon 65:177, 1997b, typus in matrice
Merxmuellera stricta) imprimis teliosporis minoribus (4-5,5 sum longis), minus |
prominenter (leniter, humiliter tuberculatis) ornatis. Distincta etiam a specie Ustilago
sladenii Pole-Evans (Ann. Bolus Herb. 1:115, 1915, typus in matrice Ehrharta sp.)
imprimis teliosporis magis evidenter ornatis et plantis eius nutrientibus ad subfamiliam
alteram pertinentibus.
Sori (Fig. 20) in the whole inflorescence as naked, dark brown, powdery spore masses
on the surface of short inflorescence branches, 4-5 x 20-30 mm, partly enclosed by the
uppermost leaf sheath. Spores (Figs. 24, 25) globose, subglobose to broadly ellipsoidal,
4-5 x 4-5.5 um, olivaceous-brown; wall c. 0.5 um thick, slightly uneven, with two,
somewhat thinner polar areas, surface finely low-tuberculate, spore profile finely to
evidently wavy, more evidently at the polar areas.

On Poaceae: Pentaschistis pallida (Thunb.) Linder, South Africa. Known only from
the type collection.

Ustilago pentaschistidis differs from U. dregeana and U. dregeanoides especially by
smaller, less prominently ornamented spores. It differs from U. sladenii, on Ehrharta,
especially by larger, more evidently ornamented spores and also by host plants belonging
to different subfamilies.

20.

Fig. 20. Sori of Ustilago pentaschistidis in the inflorescence of Pentaschistis pallida (type). Habit.
To the left a healthy inflorscence. Bar = 1 cm.

Fig. 21. A sorus of Ustilago penniseti-purpurei in the ovary of Pennisetum purpureum (type).

Baa anime

A NEW USTILAGO ON PENNISETUM (POACEAE)

[revised the smut fungi of Pennisetum (Vanky, 2003:8-20) and recognised thirteen species.
Talso revised the smut fungi of other genera of the tribe Cenchrinae, such as Anthephora,
Cenchrus and Pseudochaetochloa (Vanky, 2002a:391-398) and recognised eight species.
Scrutinising herbarium specimens, obtained from the late Prof. Zambettakis, I found
an unnamed smut fungus on Pennisetum “benthamii’, which is distinct from all known
- smut fungi on Cenchrinae. It is described as:

Ustilago penniseti-purpurei Vanky, sp. nov.

Typus in matrice Pennisetum purpureum Schumach., Congo, c. 100 km S urbe Kinshasa
(Leopoldville), oppid. Kisantu, 5°08’ S, 15°09’ E, 8.V.1913, H. Vanderyst 376, BR; isotypus
in Herbario Ustil. Vanky, HUV 21039!

Sori in ovariis nonnullis inflorescentiae eiusdem, longe ellipsoidales, cum apice uno
acuto, cca. 1 x 2-4 mm, inter involucris floralibus prominentes, primo pericarpio sicut
peridio tenui, brunneo cooperti, quo mature irregulariter rupto massam sporarum
nigrescentibrunneam, semiagglutinatam usque pulveream ostendentes. Sporae globosae,
subgiobosae, ellipsoidales, saepe reniformes, 5-9 x 6,5-13,5 um, flavidobrunneae; pariete
inaequali, plerumque 0,5 um crasso, sed in medio lateris concavi sporarum reniformium
multo tenuiore, subtiliter moderate dense verruculoso-echinulato; imago obliqua sporae
levis, subtiliter undulata vel ad partes tenues subtiliter serrulata.

Sori (Fig. 21) in some ovaries of an inflorescence, long ellipsoidal with an acute tip, c
1 x 2-4 mm, showing between the spreading floral envelopes, at first covered by the
pericarp as a thin, brown peridium which ruptures irregularly at maturity disclosing
the blackish-brown, semiagglutinated to powdery mass of spores. Spores (Figs. 26, 27)
globose, subglobose, ellipsoidal, often kidney-shaped, 5-9 x 6.5-13.5 um, yellowish-
brown; wall uneven, mostly 0.5 um thick but on the middle of the concave side of
kidney-shaped spores much thinner, finely, moderately densely verruculose-echinulate,
spore profile smooth, finely wavy or, on the thin-walled parts, finely serrulate.

On Poaceae: Pennisetum purpureum Schumach. (P. benthamii Steud.); C. Africa (Congo).

Known only from the type collection.

A NEW DOASSANSIOPSIS ON NYMPHAEA (NYMPHAEACEAE)

On the 50 species of Nymphaea of the world, three smut fungi are known:
1. Rhamphospora nymphaeae D.D. Cunn. (type on N. stellata Willd., India), possessing
solitary, lemon-shaped, hyaline spores embedded in the leaf tissue; 2. Doassansiopsis
nymphaeae (type on N. stellata, India), forming conspicuous galls on the petioles, with
spore balls embedded in the host tissue; and 3. D. ticonis (type on N. blanda G.E.W.
Meyer, Costa Rica), producing flat leaf spots, containing spore balls.

A smut fungus was collected in Ethiopia on the leaves of Nymphaea Moder
producing thickened, moderately hypertrophied, wart-like or typically cup-shaped
leaf spots, containing persistent spore balls. These show the typical structure of
a Doassansiopsis, i.e., composed of a central mass of parenchymatous sterile cells
surrounded by a layer of oblong, usually radially arranged, firmly adhering spores. The
whole is covered by a thin cortical layer of more or less flattened, relatively small, empty
fungal cells (comp. Vanky, 2002b:9, fig. 3). It is described as:

Figs. 22, 23. Spores of Ustilago gabonensis on Phacelurus gabonensis, in LM and in SEM (type).
Figs. 24, 25. Spores of Ustilago pentaschistidis on Pentaschistis pallida, in LM and in SEM (type).

Figs. 26, 27. Spores of Ustilago penniseti-purpurei on Pennisetum purpureum, in LM and in SEM
(type). Bars = 10 um.

Doassansiopsis tomasii Vanky, sp. nov.

Typus in matrice Nymphaea nouchali Burm. f,, Ethiopia, Gojam Reg., 17 km S urbe

Bahar Dahr, haud procul Blue Nile Falls, 11°30’48.7” N, 37°29°31.6” E, alt. 1712 m.s.m.,

22.X.2004, leg. T. & K. Vanky. Holotypus in Herbario Ustil. Vanky, HUV 20840); isotypi in

BPI 863739; BRIP, S et in Vanky, Ust. exs. no. 1259.

Dassansiopsis tomasii ab utraque specie cognita generis Doassansiopsis matricis Nymphaeae

distincta: D. ticonis M. Piepenbring (Mycol. Res. 99:783, 1995) et D. nymphaeae (Syd. &

P. Syd.) Thirumalachar (Mycologia 39:604, 1947), basisnomine Doassansia nymphaeae H.

e& P. Sydow (Ann. Mycol. 10:406, 1912). A prima specie praecipue per maculas foliorum

hypertrophicas productas et glomerulos sporarum maiores irregularesque, a secunda soris

laminae foliorum non petiolorum et magnitudine glomerulorum sporarum distincta (cf.

descriptionem accuratiorem et clavem determinationis in sequentibus).
Sori (Fig. 28) on the leaves forming rounded, thickened, slightly hypertrophied, wart-
like or cup-shaped leaf spots, evident especially on fresh material, on the abaxial side,
from 1-2 mm to 5-6 mm in diameter, when dried wart-like. The spots are initially yellow,
later brown, with numerous, tightly packed, pale brown (beige) spore balls embedded
in the host tissue. In old sori, the necrotic host tissue is decomposed, the spore balls
liberated and the leaves appear perforated. Spore balls varying in shape and size,
globose, subglobose, ovoid, ellipsoidal, oblong or irregular, with one or several flattened
sides, 130-310 x 140-400 um, dark brown, subopaque, composed of a central mass of
parenchymatous, sterile fungal cells surrounded by a layer of spores and an external,
thin cortex of sterile cells. Spores (Fig. 31) variable in shape and size, mostly radially
elongated, subpolyhedral, sometimes subcuneiform with narrowing proximal or distal
part, rarely ellipsoidal, (6-)8-10.5 x (11-)13.5-21.5 um, pale yellowish-brown, arranged
in one layer, rarely two spores form the layer; wall thin, c. 0.3-0.4 um, smooth, content
homogenous. Central parenchymatous sterile cells (Fig. 31) extremely variable in shape
and size, irregularly polyhedral with flattened contact sides, rarely ovoid or ellipsoidal,
4-21.5 x 7-32 um, hyaline, empty; wall thin, 0.3-0.4 um, smooth. Cortical sterile cells
(Fig. 31) variable in form and size, irregular, radially more or less flattened, tangentially
elongated, with flattened contact sides and flat, convex or hemiglobose free surface, 4-8
x 5-12 um, subhyaline, wall 0.3-0.4 um thick, smooth.

On Nymphaeaceae: Nymphaea nouchali Burm. f. (N. caerulea Savigny; N. stellata Willd.);

NE Africa. Known only from the type collection in Ethiopia, not far from the Blue Nile

Falls.
Piepenbring (1995:784) describing the new species D. ticonis, compared it with the type
of D. nymphaeae and wrote: “The corresponding measurements for D. ticonis would not
provide sufficient evidence to define a new species because the size of spores and its cells
tends to be rather variable in species of Doassansiopsis. However, the characteristics of
the infected part of the host and the lack of gall growth are considered distinct enough
to treat the Costa Rican collection as a new species”. This statement refers also to the
Ethiopian collection, a statement to which maybe geographical distribution, host plant
spectrum, and some morphological differences of the spore balls and their components
of the three Doassansiopsis species of Nymphaea could also be added (comp. the key
below).

Etymology: This fungus is named after my son, Tomas Vanky (42), physician, but an

ardent and the best collector of smut fungi in the world, who found and collected so

many known and unknown smuts (see HUV no. 1-21120 and the labels of Vanky, Ust.

exs. no. 1-1300). He also found this new species.

Fig. 28. Sori of Doassansiopsis tomasii on
Nymphaea nouchali (type) as rounded,
thickened, slightly hypertrophied, wart-like
leaf spots. Habit, and a sectioned flower.

Bar = 1 cm.

Key to the smut fungi of Nymphaeaceae
PEO UL Alem O1LES1G-50) [LONG verre ce rere Doassansiopsis euryalis
- CODEN ITP HUcd POLES. SOU Lele rte tree Mer MMC tr IE cern ne recar cts 2
Dee ES DOLeS SOliLary, [CMON SNAP eC ster ceccer se ee errs: Rhamphospora nymphaeae
- SPOles in spOlcipalls MOU lcINON=clap eC ier ace tt eee tetera en ay 3
3. Sorias flat leaf spots, not producing hypertrophy. Spore balls globose or subglobose,
120-250 umitong spores 12-164tm long. race eee Doassansiopsis ticonis
- Sori producing hypertrophy. Spore balls irregular, larger. Spores longerv............... dq
Sori as conspicuous swellings on the petioles. Spore balls 150-285 um long. Spores
12 ORIN LOL ee eee cee eee re tee et eer eee Doassansiopsis nymphaeae

Sori as thickened, wart-like or cup-shaped leaf spots. Spore balls 140-400 um long.
SPORES Ladle (LT MOLO! sea especies ieress59 te sstratensc geese Doassansiopsis tomasii

A NEW USTANCIOSPORIUM ON RHYNCHOSPORA (CYPERACEAE)
Of the 25 known species of Ustanciosporium, 17 are found on Rhynchospora. A
distinct species was collected recently in the USA:

Ustanciosporium virginianum Vanky, sp. nov.
Typus in matrice Rhynchospora capitellata (Michx.) Vahl (det. T:E Wieboldt, VPI),
USA, Virginia, Giles Co., Appalachian Mts., Stony Creek Valley, via no. 635, locus dictus
“Interior”, 37°24’53.0” N, 80°34°51.2” W, alt. 753 m.s.m, 25. VIII.2004, leg. C. et K. Vanky.
Holotypus in Herbario Ustil. Vanky, HUV 20782; isotypi in Vanky, Ust. exs. no. 1251.

Sori in omnibus floribus inflorescentiae aliquantum congestae, massa nigra, conglutinata
usque granuloso-pulverea glomerulorum sporarum atque sporarum completi, omnio
glumis maxime externis occulti. Peridium et stroma sterile absentes. Glomeruli sporarum
globosi, ovoidei, ellipsoidales, elongati vel irregulares, 25-50 x 25-80 um, atro-rufobrunnei
usque opaci, e paucis vel pluries decem sporis, pressu facile separabilibus compositi. Sporae
parum complanatae, in visu laterali ellipticae, 7-9,5 um latae, sine appendicibus hyalinis,
in visu plano subcirculares, ovatae, ellipticae usque plerumque irregulares vel angulares,
9-13,5 x 9,5-15(-16) um, rufobrunneae; pariete inaequali, 0,5-1(-1,5) um crasso, leniter,
dense foveolato; imago obliqua sporae levis.
Sori (Fig. 29) in all spikelets of a somewhat congested inflorescence, completely hidden
by the outermost glumes, filled with a black, granular-powdery mass of spore balls and
spores. Peridium and sterile stroma lacking. Spore balls (Figs. 32, 34) globose, ovoid,
ellipsoidal, elongated or irregular, 25-50 x 25-80 um, dark reddish-brown to opaque,
composed of a few to tens of spores which separate easily by pressure. Spores (Figs. 33,
34) laterally slightly compressed, in side view ellipsoidal, 7-9.5 um, hyaline appendage
lacking, in face view subcircular, ovoid, elliptic to usually irregular and angular, 9-13.5
X 9.5-15(-16) tum, reddish-brown; wall uneven, 0.5-1(-1.5) um thick, finely, densely
foveolate, spore profile smooth.
On Cyperaceae: Rhynchospora capitellata, N. America (USA). Known only from the type
collection.
Ustanciosporium virginianum belongs to a group of smut fungi with many unsolved
problems. The high frequency of “mixed” collections of diseased Rhynchospora, in
which several ,,species™ or ,,varieties® of Ustanciosporium are present concomitantly is
surprising. The reason for this phenomenon is not clear. It caused numerous taxonomic
and nomenclatorial problems and contradictions in the literature (comp. Ling, 1950,
Nannfeldt, in Lindeberg, 1959:156).

The combined study of morphological and molecular characters of the genus
Cintractia by Piepenbring, Begerow & Oberwinkler (1999), and Piepenbring (2000),
resulted in the recognition of several new genera and also in a better knowledge and
delimitation of numerous species. Similar investigations should be continued with as
many as possible types and other specimens within the Ustanciosporium montagnei
complex. These often differ only very little morphologically from each other. Do they
represent several ,,small” species on the way to speciation, or one (or a few) species with
high morphological variability due to hybridization, genetic variability, recombinations,
segregation? A similar, unexplained case was observed by me (Vanky, 2004a:112) in a
specimen of Farysia ugandana Zundel (= F. butleri (Syd. & P. Syd.) Syd. & P. Syd.) in
which a part of one sorus contains much darker, somewhat agglutinated, almost smooth
to finely punctate spores instead of the typical olive-brown, dusty, finely, distinctly
verruculose spores of the species.

Fig. 29. Sori of Ustanciosporium virginianum in all
spikelets of Rhynchospora capitellata (type). Habit, and
enlarged a longitudinally sectioned spiklet. Bars = 1 cm
for habit, and 2 mm for the detail drawing.

Fig. 30. Sori of Microbotryum afromontanum in the
capsules of Cerastium afromontanum (type). Habit, and
enlarged a longitudinally sectioned capsule. Bars = 5 mm
for habit, and 3 mm for the detail drawing.

A NEW MICROBOTRYUM ON CERASTIUM (CARYOPYLLACEAE)

Microbotryum afromontanum Vanky, sp. nov.
Typus in matrice Cerastium afromontanum T:C.E. Fr. & Weimark, Ethiopia, Gondar
Reg., 62 km NE pag. Debart, Simien Mountains, 13°15'29.1“ N, 38°12'58.1“ E, alt. 4060
m.s.m., 25.X.2004, leg. T: & K. Vanky. Holotypus in Herbario Ustil. Vanky, HUV 20888;
isotypi in BPI 863704, S et in Vanky, Ust. exs. no. 1265.
Sori ovula destruentes, capsulas massa sporarum purpurascentibrunnea, primo
agglutinata serius pulverea implentes. Infectio systemica, capsulas omnes plantae eiusdem
inficiens. Sporae globosae, subglobosae usque late ellipsoidales, 11-14,5 x 12-16 um,
pallide flavidobrunneae, pallide violaceo tinctae; pariete subtiliter, dense, nonnunquam
incomplete reticulato, (5-)6-9 maculis in diametro sporae, muri earum 0,8-1,5 ym alti,
acuti, subacuti vel obtusi, 21-30 in circumferentia aequatoriali.
Sori (Fig. 30) destroying the ovules filling the capsules with a purplish-brown, at first
agglutinated, later powdery spore mass. Infection systemic, all capsules of a plant being
infected. Spores (Figs. 35, 36) globose, subglobose to broadly ellipsoidal, 11-14.5 x
12-16 um, light yellowish-brown with a pale violet tint; wall finely, densely, sometimes
incompletely reticulate, (5-)6-9 meshes per spore diameter, muri 0.8-1.5 um high, acute,
subacute or blunt, 21-30 on the equatorial circumference.
On Caryophyllaceae (subfam. Alsinoideae): Cerastium afromontanum T.C.E. Fr. &
Weimark, NE. Africa (Ethiopia). Known only from the type collection.
Microbotryum afromontanum differs from M. duriaeanum (Tul. & C. Tul.) Vanky (type
on Cerastium glomeratum Thuill., Algeria) especially in spores having more and smaller
meshes and lower muri. M. duriaeanum (on Cerastium brachypetalum Pers., Vanky, Ust.
exs. no. 112) has 4-7 meshes per spore diameter, muri 1-2.5 um high, acute or subacute,
16-22 on the equatorial circumference.

A NEW SPORISORIUM SPECIES ON ECHINOCHLOA (POACEAE)

Ingold (1996) demonstrated that five collections of smut fungi, identified as Ustilago
trichophora on Echinochloa spp., originating from HUV, show two different types of
spore germination. Since then, I intended to find out the cause of this phenomenon.
In my efforts to identify a specimen recently collected in Ethiopia on E. colona, |
investigated all 63 collections of U. trichophora in HUV. The result is that besides U.
trichophora, there is an apparently very similar but distinct species belonging to the
genus Sporisorium which is described as:

Sporisorium ingoldii Vanky, sp. nov.
Typus in matrice Echinochloa colona (L.) Link, India, Uttar Pradesh, Varanasi, Banaras
Hindu University Campus, 25°20‘ N, 83°00% E, alt. cca. 100 m.s.m., 4.X.1992, leg. C. &
K. Vanky. Holotypus in Herbario Ustil. Vanky, HUV 15764; isotypi in Vanky, Ust. exs. no.
948 (ut Ustilago trichophora). Paratypi in matrice E. colona, India, Madhya Pradesh, 21

Fig. 31. Part of a spore ball with spores (sp), sterile cells (sc) and cortex (c) of Doassansiopsis tomasii
on Nymphaea nouchalii, in LM (type). |

Figs. 32, 33, 34. Spore balls and spores of Ustanciosporium virginianum on Rhynchospora capitellata
in LM and in SEM (type).

Figs. 35, 36. Spores of Microbotryum afromontanum on Cerastium afromontanum, in LM and in
SEM (type). Bars = 10 um.

km NW urbe Jabalpur, 15.X.1992, N.D. Sharma, R.S. Singh & K. Vanky, HUV 15587.
E. colona, Ethiopia, Gondar Reg., supra Blue Nile Falls, 11°30°48“ N, 37°29°30“ E, alt.
1710 m.s.m., 22.X.2004, leg. T: & K. Vanky, HUV 20936; isoparatypi in Vanky, Ust. exs.
no. 1270.

Sporisorium ingoldii distinctum a specie manifeste simili Caeoma trichophorum Link
(in Linné's Species Plantarum, Ed. 4, 6(2):3, 1825, = Ustilago trichophora (Link) Korn.)
imprimis characteribus soralibus et typo germinationis sporarum. In specie Sporisorium
ingoldii plerumque spiculi omnes eiusdem inflorescentiae affecti, peridium in maturitate
cito ruptum, columella brevis, crassa praesens, et saepe etiam catervae cellularum sterilium
praesentes. In specie Ustilago trichophora spiculae singulae vel catervae earum affectae,
peridium satis persistens, columella et cellulae steriles absentes. Praeterea sori speciei
Sporisorium ingoldii spiculis restricti, sed illi speciei Ustilago trichophora saepe etiam in
culmis evoluti. Distinctiones in germinatione sporarum a C.T. Ingold (1996:418-420, fig.
1-7) descriptae et illustratae.

Sori (Fig. 37) usually in all spikelets of an inflorescence, globoid or rarely bilobed, 1-2 mm
in diameter, partly hidden by floral envelopes, first covered by a thick, hispid peridium
which ruptures irregularly at maturity disclosing the dark brown, semiagglutinated to
powdery mass of spores and sterile cells surrounding a thick, short, simple columella
with longitudinal furrows. Spores (Figs. 40, 41) single when mature, globose, subglobose,
ovoid to broadly ellipsoidal, 8-10.5 x 9-12 tm, yellowish-brown; wall even, c. 0.5 um
thick, sparsely low echinulate, spore profile wavy to finely, distantly low serrulate.
Sterile cells few or lacking, when present in small, irregular groups, single cells globoid,
ellipsoidal to irregular, with one or several flattened sides, 4.5-9 x 5.5-12 um, hyaline;
wall c. 0.5 um thick, smooth. Spore germination (Ingold, 1996) results in a long, slender,
4-celled basidium measuring 1.5-2 x 40-60 um, laterally and terminally giving rise to
ovoid or cylindrical basidiospores on short sterigmata.

On Echinochloa colona (L.) Link; Africa (Ethiopia, S. Africa, Zimbabwe), S. Asia (India,
Pakistan). Probably more common but overlooked or identified as Ustilago trichophora.
Sporisorium ingoldii is apparently similar to Ustilago trichophora. The most evident
difference lies in the sorus characters and in the spore germination. In both species
the sori are covered by a hispid peridium. However, in S. ingoldii usually all spikelets
of an inflorescence are affected (systemic infection?), the peridium ruptures early at
maturity, there is a short, stout columella and often also groups of sterile cells, whereas
in U. trichophora only single spikelets or groups of spikelets are affected, the peridium is
rather persistent, a columella is lacking (rarely, irregular host tissue remnants may give
the appearance of a columella) and no sterile cells are present. In addition, in S. ingoldii
the sori are restricted to the spikelets only whereas in U. trichophora they can be present
also on the stems and leaves. The spores in both species look very similar but in U.
trichophora they are slightly smaller (6-11 x 7-12 um). Differences in spore germination
are described and illustrated by Ingold (1996:418-420, figs. 1-7). It seems, that S. ingoldii
is restricted to Echinochloa colona, whereas U. trichophora infects many Echinochloa

species, including E. colona.
Etymology: This species is dedicated to Professor C. Terence Ingold, at the occasion of his
100" birthday (3 July 2005), a many-sided, most outstanding contemporary mycologist,
scientist, teacher and a warm-hearted, inspiring human being and friend. I am happy for
the privilege of the over 20 years of correspondence and co-operation with him.

Fig. 37. Sori of Sporisorium ingoldii
in all spikelets of Echinochloa colona
(type). Habit, and enlarged some sori
in diverse developmental stages. Bars =
1 cm for habit, and 2 mm for the detail
drawings.

A NEW USTILAGO ON SETARIA (POACEAE)

Ustilago trichogena Vanky, sp. nov.

Typus in matrice Setaria setosa var. leiantha Hack., Bolivia, Dept. Tarija, Tarija, 21°33’ S,

64°45’ W, 6.11.1902, leg. R.E. Fries 271, S; isotypus in HUV 5214!

Ustilago trichogena a Caeoma trichophorum Link, in Linnés Species Plantarum, Ed.

4, 6(2):3, 1825 [= U. trichophora (Link) Korn., typus in matrice Panicum colonum L.,

Egypt], distincta soris acutis, sporis irregularibus longioribusque, 5,5-8(-9) x 6,5-16 um, et

superficie sporarum levi vel valde leniter, parce granulosa inter verrucas humiles vel spinas

in SEM conspicuas.
Sori (Fig. 38) in some flowers of an inflorescence, transforming the ovaries and filaments
into fusiform or ovoid bodies with acute tip, 1-2 x 2-3 mm, covered by a thick, brown,
hairy peridium, protruding between the floral envelopes, of which the glumes are intact,
the other ones are often more or less hairy. At maturity the peridium ruptures irregularly
disclosing the dark brown, semiagglutinate to powdery mass of spores. Spores (Figs. 42,
43) rarely subglobose, usually slightly irregular, ovoid, ellipsoidal, often considerably
elongated, sometimes even slightly bent, 5.5-8(-9) x 6.5-16 um, yellowish-brown; wall
even, c. 0.5 um thick, sparsely, finely verrucose-echinulate, spore profile smooth to finely
wavy; in SEM, between the low warts or spines the surface is smooth or very finely,
sparsely granular. Sterile cells absent.

On Setaria setosa var. leiantha; S. America (Bolivia). Known only from the type

collection.
Ustilago trichogena is close to U. trichophora, type on Panicum colonum L. (= Echinochloa
colona (L.) Link), Egypt. In both species the sori are hispid. However, in U. trichophora
the sori are more globose, and often appear also on the stems, the spores are more
regular, rounded, measuring 6-11 x 7-12 tm, and the surface between the spines is
sparsely verruculose as seen in SEM.

Etymology: trichogena from Greece thrix = hair, and —genes = producing, referring to the

hairy soral membrane, produced by the fungus.

A SECOND SPECIES OF PILOCINTRACTIA ON FIMBRISTYLIS

The genus Pilocintractia Vanky (2004d:172) was erected for Cintractia fimbristylidicola
Pavgi & Mundk. (type on Fimbristylis complanata Link, India), based on molecular
biological data and the peculiar soral structure. A smut fungus, collected by Dr. N.D.
Sharma (Jabalpur, India), and another one, obtained in exchange from HCIO, under
the name of Cintractia indica Pavgi & Mundk., nom. herb., on ,,Fimbristylis aestivalis“
(Retz.) Vahl (= misnamed F. miliacea), have similar soral structure but larger spores.
They both represent the same species and are described as:

Pilocintractia adrianae Vanky, sp. nov.

Typus in matrice Fimbristylis miliacea (L.) Vahl (det. K. Vanky), India, Madhya Pradesh,
cca. 115 km W urbe Jabalpur, pag. Bohani, X.1977, leg. N.D. Sharma, HUV 20947]; isotypi
in BPI et HCIO. Paratypus in matrice Fimbristylis miliacea (det. K. Vanky, conf. K.A. Lye,
NLH), India, Punjab, Amritsar, 31°35’ N, 74°56’ E, 12.X.1907, leg. A. Hafiz Khan, HUV
15463!; isoparatypus in HCIO 1437.

Sori corpora atrobrunnea, globoidea, ovoidea, compacta, dura, diametro 1-1,5 mm circa
nuces nonnullas spiculorum aliquorum eiusdem inflorescentiae formantes. Peridium

Fig. 38. Sori of Ustilago trichogena in some
flowers of Setaria setosa (type). Habit and
enlarged two spikelets with sori and two
healthy spikelets. Bars = 1 cm for habit,
and 2 mm for the detail drawings.

eorum deest, superficie non pulverei. Sori maturi in unum continentes a planta nutrienti
decidentes. Sporae complanatae, a latere ellipticae, 8-10,5 um latae, sine appendicibus
hyalinis, in aspectu plano circulares, subcirculares, ellipticae usque parum irregulares,
11-14,5 x 11.5-16(-17) um, rubrobrunneae; pariete aequali, cca. 0,5 um crasso, conspicue
levi usque valde subtiliter, dense punctato-verruculoso. Sporae in marsupiis cupulatis
formatae. Inter sporis filamenta fungalia, hyalina, sterilia, cum muris gelatinosis praesentes,
sporas maturas conglutinantia. Germinatio sporarum non cognita.
Sori (Fig. 39) forming dark brown, globoid, ovoid, compact, hard bodies around some
nuts in several spikelets of an inflorescence, 1-1.5 mm in diameter. Peridium lacking,
surface not powdery. Mature sori fall off the plants in one piece. Spores (Figs. 44, 45)
flattened, in side view elliptic, 8-10.5 um wide, no hyaline appendages, in plane view
circular, subcircular, elliptic to slightly irregular, 11-14.5 x 11.5-16(-17) um, reddish-
brown; wall even, c. 0.5 um thick, apparently smooth to very finely, densely punctate-
verruculose. The spores are formed in cup-shaped pockets. Among the spores hyaline,
sterile, fungal filaments with gelatinised wall are present, gluing the spores together.
Spore germination unknown.
On Cyperaceae: Fimbristylis miliacea; S. Asia (India). Known only from the type
collections.
Etymology: This species is named in the memory of the young, talented, Colombian
biologist, Adriana Mercedes Gill Correa, married in Germany, collector of numerous
interesting, rare and also new neotropical smut fungi (comp. Piepenbring, 2002b,
2003), whose lost fight against a malignant tumour that prevented her making a great
mycological career.

Key to the Pilocintractia species

- Spores 9-12(-13) um long, finely granular-verruculose............. P. fimbristylidicola
- Spores 11.5-16(-17) um long, apparently smooth to finely punctate... ee
TIE MAR ARN chee 1 Ronit Sans aL Ran ies. Srhee wy ARR... Seb ne eat oa P. adrianae

New combinations

A further member of the genus Heterodoassansia (Doassansiaceae)

Heterodoassansia Vanky (1993:28) differs from the genus Doassansia Cornu
(1883:283) in the heterogeneity of the cortical sterile cells of the spore balls (see below).
It has five known species. Recently, smutted leaves of Hygrophila auriculata were
collected in Ethiopia, with spore balls embedded in the host tissue. Study of thin, hand-
cut slices of the spore balls revealed that they represent the same species which was
known only from India, under the name of Doassansia hygrophilae. It turned out also,
that this species belongs to the genus Heterodoassansia:

Heterodoassansia hygrophilae (Thirum.) Vanky, comb. nov.

Basionym: Doassansia hygrophilae ‘Thirumalachar, Lloydia 9:29, 1946. — Type on
Hygrophila sp. (= H. cf. auriculata, teste K. Vanky), India, Mysore, Nandi Hills,
5.X1.1944, M.J. Thirumalachar, HCIO 10692; isotypes BPI 178386, 178388, 195045,

IMI, HUV 15470!
Sorion leaves forming initially yellow, later brown, circular spots, 2-10 mm in diameter or
larger by confluence, with permanent spore balls embedded in the host tissue as minute,
dark brown, raised, mainly hypophyllous dots. Later the leaves may be perforated. Spore

Fig. 39. Sori of Pilocintractia adrianae around some nuts of Fimbristylis miliacea (type). Habit and
enlarged a spikelet with two sori. Bars = 1 cm for habit, and 1 mm for the detail drawing.

balls globose, subglobose, ovoid to slightly irregular, 100-170 x 110-200 um, beige-
brown, composed of a central mass of loosely aggregated spores surrounded by a firm
cortex of two different kinds of sterile cells. Spores subglobose, ellipsoidal to slightly
irregular, 7-12 x 9-16 um, subhyaline, easily separating by pressure; wall even, thin (c.
0.5 um), smooth. Cortex composed of an inner layer of radially oblong, tightly adhering,
relatively large, irregularly subpolyangular, empty cells measuring 6-18 x 7-25 um, pale
yellowish-brown; wall even, c. 0.5 ttm thick, ornamented on its inner surface (towards
the empty lumen) by moderately densely situated, thin, 0.5-1.5 um high spines. These
cells are arranged in one layer, which in some places is formed by two smaller cells. The
outer layer of the cortex is the last-formed component of the spore balls. It differentiates
from tangentially elongated, thin-walled, septate, plasmatic fungal filaments. When
mature, this thin covering layer is formed of small, irregularly polyangular, often radially
flattened, 5-12 um long, pale yellow, empty cells with c. 0.4 um thick wall, smooth on the
inner and outer surface. Spore germination (Thirumalachar, 1946) results in holobasidia
bearing an apical whorl of 5-7, fusiform, slightly asymmetrical basidiospores measuring
1-1.2 x 14-15 um. These conjugate two by two forming binucleate infection hyphae.
On the hyphae, on well-developed sterigmata, short, slightly bent ballistospores can be
produced.
On Acanthaceae: Hygrophila auriculata (Schumach.) Heine (H. spinosa T. Anders.;
Asteracantha longifolia (L.) Nees); Africa (Ethiopia), Asia (India).

Some Sporisorium species

Andropterum Stapf is a unispecific genus in the subfam. Andropogoneae, tribe
Ischaeminae, with the type A. variegatum Stapf (= A. stolzii (Pilger) C.E. Hubb.), in
Central Africa (Clayton & Renvoize, 1986:348). Scrutinising herbarium specimens
obtained from the late Prof. Zambettakis, I found two sori of an unnamed smut fungus,
originating from BR. It turned out to be the isotype of Sphacelotheca andropteri, which
belongs to the genus Sporisorium.

Sporisorium andropteri (Zambett.) Vanky, comb. nov.

Basionym: Sphacelotheca andropteri Zambettakis, Bull. Soc. Mycol. France 95:410,
1979(1980). — Type on Andropterum stolzii, Congo, S of Boudouinville, Mission St.
Martin, Valley of Cumons, leg. Boudewyn 51, BR 2!

Sori in sessile and pedicelled spikelets, cylindrical, 0.8-1 x 3-5 mm, partly hidden by
the floral envelopes, covered by a thick, brown peridium which ruptures irregularly
disclosing the blackish-brown, first agglutinated later dusty mass of spores and groups
of sterile cells surrounding a simple, stout, narrowing central columella. Spores single
when mature, globose, subglobose, ovoid or broadly ellipsoidal, 4.5-5.5 x 4.5-6.5 um,
yellowish-brown; wall uneven, c. 0.5 um thick with a thinner part on one side, in LM
apparently smooth to very finely punctate, in SEM moderately densely low verrucose.
Sterile cells in irregular groups or chains, rarely solitary, single cells subglobose, ellipsoidal

Figs. 40, 41. Spores and sterile cells of Sporisorium ingoldii on Echinochloa colona, in LM and in
SEM (type).

Figs. 42, 43. Spores of Ustilago trichogena on Setaria setosa, in LM and in SEM (type).

Figs. 44, 45. Spores and gelatinised fungal filaments of Pilocintractia adrianae on Fimbristylis
miliacea, in LM and in SEM (type). Bars = 10 um.

to usually irregular, with one or several flattened sides, 8-14 um long, subhyaline to pale
yellowish-brown; wall 0.8-1.5 tm thick, smooth.

On Poaceae: Andropterum stolzii (Pilger) C.E. Hubb.; Africa (Congo). Known only from

the type collection.
Revising the smut fungi of Ischaemum (Vanky, 2004a:94-102), I recognised 11 species.
A further species, Sorosporium semisagittatum, was also given with its original
description, because no material of it was available for study (the type probably being
lost). Identifying smut fungi of Ischaemum indicum, collected in India, Madhya Pradesh,
Kundam, 11.X.1992, leg. N.D. Sharma, C. & K. Vanky (HUV 21078), and Maharashtra
State, near Khandala, 25.X.1992, leg. C. & K. Vanky (HUV 21077), it turned out that
these specimens represent S. semisagittatum, which belongs to the genus Sporisorium.
The second collection is also distributed in Vanky, Ust. exs. no. 1290.

Sporisorium semisagittatum (Thirum. & Pavgi) Vanky, comb. nov.
Basionym: Sorosporium semisagittatum Thirum. & Pavgi, Sydowia 20:22, 1967(1968).
— Type on Ischaemum semisagittatum, India, Maharashtra State, Poona, Khandala,
14.X1.1954, M.J. Thirumalachar 1235 (type where?).

Sori in some spikelets of an inflorescence, ellipsoidal or short cylindrical, 0.8-1.5 x
3-5 mm, showing between the spreading floral envelopes, initially covered by a thick,
pale brown peridium which ruptures irregularly from its apex disclosing the blackish-
brown, first agglutinated later dusty mass of spore balls, spores and groups of sterile cells
surrounding a stout, narrowing central columella, often with shortly bi- or trifurcate tip
or with short lateral branches. Spore balls subglobose, ellipsoidal, oblong or irregular, of
varying size, 30-90 x 35-120 um, dark reddish-brown to opaque, composed of tens to
hundreds of spores which separate easily by pressure. Spores globose, subglobose, ovoid
ellipsoidal, oblong or rounded subpolyhedrally irregular, 7-9 x 8-11(-12) um, yellowish-
brown; wall slightly uneven, 0.5-0.8 um thick, densely verrucose-echinulate, spore
profile smooth, finely wavy to finely serrulate. Sterile cells rather few, usually in rounded,
compact groups of (3-)5-10(-152), single cells irregular, with one or several flattened
sides, 5-11 um long, subhyaline to pale yellowish-brown; wall c. 0.5 um thick, smooth.
On Poaceae: Ischaemum indicum (Houtt.) Merr. (I. ciliare Retz.), I. semisagittatum
Roxb.; S. Asia (India).

Three additional synonyms

Entyloma lavrovianum is a synonym of E. hieracii

Entyloma lavrovianum Schwarzman (1960:297) was described from Kazakhstan on
several collections of two Hieracium species (no type designated). Two syntypes, one
on H. ganeschinii Zahn, another on H. korshinskyi Zahn, both from Alma-Ata Region,
Zailijskij Alatau, Great Alma-Ata Gorge, 19.VIII.1958, C. Schwarzman, AA, HUV
12112! & HUV 12113!, were compared with the lectotype of Entyloma hieracii Syd. & P.
Syd. ex Cif., on Hieracium murorum L., Germany, HUV 1174! No differences in spore
morphology (shape, size, wall thickness) could be evidentiated, excepting a somewhat
darker colour of the spores of E. lavrovianum, namely pale yellow to very pale yellowish-
brown. The spores of the type of E. hieracii are subhyaline to pale yellow. Therefore, Iam
considering the two names synonyms.

Leucocintractia leucodermoides is considered to be L. leucoderma
Leucocintractia leucodermoides M. Piepenbr. & Begerow, was described in
Piepenbring (2000:315), based on some differences in spore measurements, spore wall
thickness and colour of the spores as compared with the similar L. Jeucoderma (Berk.)
M. Piepenbr. A comparison of the types could reveal only minor differences, less than
was given in the original description. For the length of the spores of L. leucoderma |
obtained 14.5-21 um (instead of 17-19(-21) um), and for the spore wall thickness 1.5-3
um. For L. leucodermoides these were 13-20(-21) um (instead of (14-)15-18(-19 um),
and 1.5-2.5 um, respectively. The difference of the spore ornamentation between these
two species, seen in SEM, was also minimal. Consequently, I am considering these two
species to represent only variation within the same species, L. leucoderma. (syn. nov.).

Tilletia cynodontis is a synonym of T. montemartinii

Tilletia montemartinii Canonaco (1936:35) was described on Cynodon glabratus
Steud. (= C. dactylon (L.) Pers.) from Erythrea. It was forgotten and did not appear in
recent literature. I described T: cynodontis Vanky (2001:294) on Cynodon plectostachyus
(K. Schum.) Stapf from Ethiopia. No specimen of T: montemertinii was available for
study but based on the description, I consider the two names to by synonyms. For
description and illustration (as T: cynodontis) see Vanky, 2001:294, fig. 26, and figs. 24,
25, p. 291.

Acknowledgements

I am grateful to S. Téth (Géd6ll6, Hungary) for preparing the Latin diagnoses, to E.H.C. McKenzie
(Auckland, New Zealand), and R. Berndt (Ziirich, Switzerland) for reading the manuscript and
serving as pre-submission reviewers. Many thanks to N.D. Sharma (Jabalpur, India) for smut
fungus specimens, to K.A. Lye (NLH, Norway), H. Scholz (B, Germany) and T.E Wieboldt (VPI,
USA) for identifying host plants. Thanks are also due to the Directors and Curators of the Herbaria
BPI, BR, BRIP, HCIO, IMI, PREM and S for loans and/or exchange of specimens.

Literature Cited

Atkinson GF. 1897. Some fungi from Alabama. Cornell Univ. Sci. Bull. 3:1-50.

Bauer R, Begerow D, Nagler A, Oberwinkler FE 2001. The Georgefischeriales: a phylogenetic
hypothesis. Mycol. Res. 105:416-424.

Beeli M. 1922. Notes mycologiques. Bull. Jard. Bot. Etat 8:1-22.

Brefeld O. 1883. Botanische Untersuchungen tiber Hefenpilze. 5. Die Brandpilze I (Ustilagineen).
Leipzig, Verlag v. A. Felix, VI + 220 pp. + Pls. I-XIII.

Brefeld O. 1895. Untersuchungen aus dem Gesammtgebiete der Mykologie. XII. Hemibasidii.
Brandpilze III. Miinster i. W., Commissions-Verlag v. H. Schéningh. IV + 99-236 pp. + Pls.
VI-XIL.

Bubak EF. 1912. Houby Ceské. Dil II. Snéti (Hemibasidii). Arch. Pfir. Vyzk. Cech. 15(3):1-84.

Canonaco A. 1937. Contributo alla flora micologica dell'Africa Orientale Italiana. Boll. Stud.
Inform. Reale Giardino Colon. 14:33-37 + Pl.

Ciferri R.1928. Quarta contribuzione allo studio degli Ustilaginales. Ann. Mycol. 26:1-68 + Pl.

Ciferri R, Herter WG. 1932. Ustilaginales Uruguayenses; Itinera Herteriana. Bot. Arch. 34:527-
540.

Clayton WD, Renvoize SA. 1986. Genera graminum. Grasses of the world. Kew Bulletin Additional
Series XIII. London, UK, 389 pp.

Clinton GP. 1902. North American Ustilagineae. J. Mycol. 8:128-156.

Clinton GP. 1904. North American Ustilagineae. Proc. Boston Soc. Nat. Hist. 31:329-529.

Cornu M. 1883. Sur quelques Ustilaginées nouvelles ou peu connues. Ann. Sci. Nat. Bot., Sér. 6,
15:269-296.

Cunnington J, Vanky K, Shivas RG. 2005. Lundquistia is a synonym of Sporisorium
(Ustilaginomycetes). Mycol. Balcan. 2:95-99.

Dietel P. 1897. Hemibasidii (Ustilagineae und Tilletiineae). In Engler & Prantl, Die Natiirlichen

_ Pflanzenfamilien. I(1)**:2-24.

Doidge EM. 1950. The South African fungi and lichens to the end of 1945. Bothalia 5:1-1045.
(Ustilaginales pp. 377-393).

Duran R. 1970. Hosts and distribution records of Mexican smut fungi. Mycologia 62:1094-1105.

Duran R. 1972. Aspects of teliospore germination in North American smut fungi. IJ. Canad. J. Bot.
50:2569-2573 + Pls. I-IV.

Duran R. 1987. Ustilaginales of Mexico. Taxonomy, symptomatology, spore germination, and
basidial cytology. Washington State University, Pullman, USA, 331 pp.

Ellis JB, Galloway BT. 1890. New species of fungi. J. Mycol. 6:31-33.

Fischer GW. 1953. Manual of the North American smut fungi. New York, Ronald Press Co.

Griffiths DG. 1902. Concerning some West American fungi. Bull. Torrey Bot. Club 29:290-301.

Guo L. 1990. The genera Sorosporium and Sporisorium in China. Mycosystema 3:67-88.

Guo L, Vanky K, Mordue JE. 1990. The genus Franzpetrakia (Ustilaginales). Mycosystema 3:57-66.

Hennings P. 1893. Fungi africani, II. Bot. Jahrb. Syst. 17:1-42.

Hennings P. 1895a. Neue und interessante Pilze aus dem Konigl. botanischen Museum in Berlin.
II. Hedwigia 34:10-13.

Hennings P. 1895b. Fungi goyazenses. Hedwigia 34:88-116.

Hennings P. 1895c. Ustilagineae. Brandpilze. In Engler, A. (ed.). Die Pflanzenwelt Ost-Afrikas und
der Nachbargebiete. Teil C. Berlin, pp. 48-49.

Hennings P. 1896a. Ustilaginaceen. In Pazschke O., II. Verzeichniss brasilianischer von E. Ule
gesammelter Pilze. Hedwigia 35:50-51.

Hennings P. 1896b. Beitrage zur Pilzflora Sidamerikas I. Myxomycetes, Phycomycetes, Ustilagineae
und Uredineae. Hedwigia 35:207-262.

Hennings P. 1897. Beitrage zur Pilzflora Sidamerikas I. Hedwigia 36:190-246.

Hennings P. 1898. Fungi americani-boreales. Hedwigia 37:267-276.

Hennings P. 1900. Die Gattung Pericladium Passer. Hedwigia, Beibl. 39:(75)-(76).

Hennings P. 1904. Fungi amazonici I. Hedwigia 43:154-186.

Herbert DA, Langdon REN. 1941. Records of Queensland fungi, HI. Univ. Queensland Dept. Biol.
Paps 231-6:

Hirschhorn E. 1941. Las especies de Sorosporium de la flora Argentina. Revista Mus. La Plata, N.S.,
Secc. Bot. 3:335-354 + Pls. I-IV.

Hirschhorn E. 1986. Las Ustilaginales de la flora Argentina. La Plata, CIC, 530 pp.

Holway EWD. 1899. Mexican fungi. II. Bot. Gaz. 28:273-274.

Ingold CT. 1996. Different patterns of teliospore germination in Ustilago trichophora. Mycol. Res.
100:418-420.

Jackson HS. 1908. Sorosporium ellisii Winter, a composite species. Bull. Torrey Bot. Club 35:147-
149.

Jennings HS. 1890. Some parasitic fungi of Texas. Texas Agric. Exp. Sta. Bull. 9:23-29.

Kochman J. 1936. Grzyby Glowniowe Polski. Ustilaginales Poloniae. Planta Polonica. 4:1-161.

Lindeberg B. 1959. Ustilaginales of Sweden (exclusive of the Cintractias on Caricoideae). Acta Univ.
Upsal., Symb. Bot. Upsal. 16(2):1-175.

Ling L. 1949. Taxonomic notes on Asiatic smuts. I. Sydowia 3:123-134.

Ling L. 1950. Studies in the genus Cintractia. I. Cintractia montagnei and related species. Mycologia
42:503-513.

Ling L. 1951.Taxonomic notes on Asiatic smuts. II. Sydowia 5:40-48.

Ling L. 1953a. Taxonomic notes on the Ustilaginales. I. Lloydia 16:180-192.

Ling L. 1953b. Taxonomic notes on the Ustilaginales. III. Sydowia 7:151-157.

Magnus P. 1900. J. Bornmiiller, Iter Syriacum 1897. Fungi. Weiterer Beitrag zur Kenntnis der Pilze
des Orients. Verh. K. K. Zool.-Bot. Ges. Wien 50:432-449 + Pls. II-III.

Maire R. 1917. Champignons nord-africains nouveaux ou peu connus. Bull. Soc. Hist. Nat. Afrique
N. 8:134-200.

Maire R, Werner RG. 1937. Fungi Maroccani. Mém. Soc. Sci. Nat. Maroc. 45:1-147.

Massey AB, Zundel GL. 1942. Sorghastrum, host of an undescribed smut. Phytopathology 32:544-
546.

Mundkur BB. 1944. Some rare and new smuts from India. Indian J. Agric. Sci. 14:49-52.

Opiz PM. 1823-25. Naturalientausch. No. 1-10. Prag. Sechstes Verzeichniss 1924:37-52.

Passerini G. 1875. Funghi raccolti in Abissinia dal Signor O. Beccari, esaminati dal Prof. G.
Passerini. Nuovo Giorn. Bot. Ital. 7:180-192.

Pavgi MS, Thirumalachar MJ. 1957. Franzpetrakia, a new genus of the Ustilaginales. Sydowia, Beih.
1:1-3 + Pl. 1.

Piepenbring M. 1995. Taxonomic studies on Ustilaginales from Costa Rica. Mycol. Res. 99:783-
788.

Piepenbring M. 1996. Smut fungi (Ustilaginales and Tilletiales) in Costa Rica. Beih. Nova Hedwigia
L1321e155:

Piepenbring M. 1999. New and poorly known smut fungi in Cuba. Mycol. Res. 103:459-467.

Piepenbring M. 2000. The species of Cintractia s. |. (Ustilaginales, Basidiomycota). Nova Hedwigia
70:289-372.

Piepenbring M. 2002a. Diversity, taxonomy, and ecology of plant parasitic smut fungi in Bolivia.
Ecologia en Bolivia 37:49-58.

Piepenbring M. 2002b. Annotated checklist and key for smut fungi in Colombia. Caldasia 24:103-
Hi Re

Piepenbring M. 2003. Smut fungi (Ustilaginomycetes p.p. and Microbotryales, Basidiomycota).
Flora Neotropica. Monograph 86. The New York Botanical Garden Press, New York.

Piepenbring M, Begerow D, Oberwinkler E 1999. Molecular sequence data assess the value
of morphological characteristics for a phylogenetic classification of species of Cintractia.
Mycologia 91:485-498.

Pole-Evans IB. 1915. Three fungi collected on the Percy Sladen Memorial Expeditions of 1910-11
and 1912-13. Ann. Bolus Herb. 1:115.

Prasad N, Tyagi RNS. 1961. A new species of Pericladium causing stem galls on Grewia flavescens
Juss. J. Indian Bot. Soc. 40:497-501.

Scholz H, Scholz I. 1988a. Die Brandpilze Deutschlands (Ustilaginales). Englera 8:1-691.

Scholz H, Scholz I. 1988b. Taxonomische Erkenntnisse bei der Erarbeitung einer Brandpilzflora
von Deutschland (Ustilaginales). Nova Hedwigia 47:69-79.

Scholz H, Scholz I. 2000. Die Brandpilze Deutschlands (Ustilaginales), Nachtrag. Verh. Bot. Vereins
Berlin Brandenburg 133:343-398.

Scholz H, Scholz I. 2004. Die Brandpilze Deutschlands, 2. Nachtrag. Verh. Bot. Vereins Berlin
Brandenburg 137:441-487.

Schwarzman SR. 1960. Golovnevye griby. (Smut fungi; in Russian). Flora sporovych rastenij
Kazachstana 2. Alma Ata.

Spegazzini C. 1899. Fungi argentini novi vel critici. Anales Mus. Nac. Buenos Aires, Ser. 2, 6:81-367
+2 Pls.

Sydow H. 1924. Notizen iiber Ustilagineen. Ann. Mycol. 22:277-291.

Sydow H. 1937. Neue oder bemerkenswerte australische Micromyceten. I. Ann. Mycol. 35:22-49.

Sydow H. 1939. Novae fungorum species. XXVIII. Ann. Mycol. 37:197-253.

Sydow H, Sydow P. 1912. Novae fungorum species. VIII. Ann. Mycol. 10:405-410.

Sydow H, Sydow P, Butler EJ. 1912. Fungi Indiae orientalis. Pars IV. Ann. Mycol. 10:243-280.

Thirumalachar MJ. 1946. Nuclear cycle and life history ofa new species of Doassansia (Ustilaginales).
Lloydia 9:24-30.

Thirumalachar MJ. 1947. Species of the genera Doassansia, Doassansiopsis, and Burrillia in India.
Mycologia 39:602-611.

Thirumalachar MJ, Neergaard, P. 1977(1978). Studies on the genus Tolyposporium. Tolyposporidium
gen. nov. Friesia 11:177-192.

Thirumalachar MJ, Pavgi MS. 1967(1968). Notes on some Indian Ustilagineae. IX. Sydowia 20: 21-
27 T

Thirumalachar MJ, Pavgi MS. 1968(1969). Notes on some Indian Ustilagineae. X. Sydowia 22:250-
253 + Pls. XV-XVI.

Tracy SM, Earle FS. 1895. New species of parasitic fungi. Bull. Torrey Bot. Club 22:174-179.

Tulasne L-R, Tulasne C. 1847. Mémoire sur les Ustilaginées comparées aux Urédinées. Ann. Sci.
Nat. Bot., Sér. 3, 7:12-127 + Pls. 2-7.

Vanky K. 1983. Ten new species of Ustilaginales. Mycotaxon 18:319-336.

Vanky K. 1985. Carpathian Ustilaginales. Acta Univ. Upsal., Symb. Bot. Upsal. 24(2):1-309.

Vanky K. 1990. Taxonomical studies on Ustilaginales. VI. Mycotaxon 38:267-278.

Vanky K. 1993. Taxonomical studies on Ustilaginales. X. Mycotaxon 48:27-44.

Vanky K. 1996. Taxonomical studies on Ustilaginales. XIV. Mycotaxon 59:89-113.

Vanky K. 1997a.Taxonomical studies on Ustilaginales. XVI. Mycotaxon 65:133-158.

Vanky K. 1997b. Taxonomical studies on Ustilaginales. XVII. Mycotaxon 65:159-182.

Vanky K. 2000. Taxonomical studies on Ustilaginales. XX. Mycotaxon 74:161-215.

Vanky K. 2001. Taxonomical studies on Ustilaginales. XXI. Mycotaxon 78:265-326.

Vanky K. 2002a. Taxonomical studies on Ustilaginales. XXII. Mycotaxon 81:367-430.

Vanky K. 2002b. Illustrated Genera of Smut Fungi. 2°. Ed. APS Press, 238 pp.

Vanky K. 2003. Taxonomical studies on Ustilaginales. XXII. Mycotaxon 85:1-65.

Vanky K. 2004a. Taxonomic studies on Ustilaginomycetes - 24. Mycotaxon 89:55-118.

Vanky K. 2004b. The smut fungi (Ustilaginomycetes) of Bothriochloa, Capillipedium and
Dichanthium (Poaceae). Fungal Diversity 15:221-246.

Vanky K. 2004c. New smut fungi (Ustilaginomycetes) from Mexico, and the genus Lundquistia.
Fungal Diversity 17:159-190.

Vanky K. 2004d. Pilocintractia gen. nov. (Ustilaginomycetes). Mycol. Balcan. 1:169-174.

Vanky K. 2005a. Taxonomic studies on Ustilaginomycetes - 25. Mycotaxon 91:217-272.

Vanky K. 2005b. The smut fungi (Ustilaginomycetes) of Chrysopogon (Poaceae). Fungal Diversity
18:177-187.

Vanky K, Deml G, Oberwinkler F. 1988. The smut fungi of Hyparrhenia hirta (Gramineae). J.
Phytopathology 121:181-191.

Vanky K, Shivas RG. 2001. New smut fungi (Ustilaginomycetes) from Australia. Fungal Diversity
7:145-174. note). Rev. Pathol. Vég. Entomol. Agric. France 37:167-178.

Vanky K, Shivas RG. 2005. (1655) Proposal to conserve the name of Ustilago scitaminea against
Ustilago amadelpha (Fungi, Ustilaginomycetes, Ustilaginaceae). Taxon 54:180.

Viennot-Bourgin G. 1958. Ustilaginales nouvelles de Guinée francaise. (Deuxiéme note). Rev.
Pathol. Vég. Entomol. Agric. France 37:167-178.

Walker J, Shivas RG. 1998. Two species of Sporisorium on Chionachne in tropical Australia, the first
Australian record of Ustilago brunkii and its transfer to Jamesdicksonia. Mycol. Res. 102:1203-
1214.

Winter G. 1883a. Fungi nonnulli novi. Hedwigia 22:1-3.

Winter G. 1883b. New North American fungi. Bull. Torrey Bot. Club 10:7.

Zambettakis C. 1979(1980). Recherches sur les Ustilaginales. (Supplément sur les espéces africaines).
Bull. Soc. Mycol. France 95:393-443.

Zundel GL. 1930. Monographic studies on the Ustilaginales attacking Andropogon. Mycologia
22:\29"198:

Zundel GL. 1931. Notes on new species of Ustilaginales. Mycologia 23:296-299.

Zundel GL. 1933. New and rare North and South American Ustilaginales. Mycologia 25:349-355.

Zundel GL. 1938. The Ustilaginales of South Africa. Bothalia 3:283-330.

Zundel GL. 1939. Studies on the Ustilaginales of the world. Mycologia 31:572-589.

Zundel GL. 1943. Notes on the Ustilaginales of the world. III. Mycologia 35:164-184.

Zundel GL. 1951. Notes on the Ustilaginales of the world. V. Mycologia 43:267-270.

Zundel GL. 1953. The Ustilaginales of the World. Pennsylvania State Coll. School Agric. Dept. Bot.
Contrib. 176:XI + 1-410.

aunt Ne yi

eine stil

ive ih ol PCR OD sateen’ ATigd, Jomo ai weet a Maa:
; il oh whine A Scietivemre aoe
nL ects OLS Wert arvagnigg ind -ebtastevongalie'y) ge) tabypintead gD a
i ad abel >in Sea abi sh alban rrere ta PRED, geod MnO? “fl
Wr re gsloe i, 27 "Where eke Shereb lee: ah erty waty Inne laset dag ents Heit penton é.
a a i puoronic i ets Map atbeg ht ‘K xcpomhnanenct ul AME ade oh ie OV AONE ‘Ds eetide idly
y eee BOS 1. 1 psbA ratudbvete Dnnhaiivaatatnh MHF hay Win iti paints agony nalleewiad.”
2 ene es pds B Soee yy, ioy2 ‘Velde ne rit sar ting ENG. Agi. hoy ei, Cher. eo
Pan “athens slay MH; M6. Basten igtt hi agent tg nor A Rae 7
Ty Galle eh eg NOt dul 28 wore) Ave iyops! cteeaieeatt A dlineys welt tant pois wit?
” sajna Racha Pry ae vial ge * i shanti and wip ws Ma adlgeadl dp pon Pe itaesrtoibs,

P ut sig dbo ih ea Os yy Me EEE EVER sb army! degen ote e dint i w
Hy een. dvebcnegntnr amet Javeboind by dite co Miele catewgneth ATRN i defy! » el
Se pak aati SCRE ATE, Ci) BER Cees ay
|e) lineata age BS. reyilgs ia Nu sshetdain planes 't Li onsk ae ean Vai thy Sak esbaawse 4
tua Bt yy te wegihooe, ep lis risgpbanirey rivur Late fine Ader] bres wl LAE 0 AD Ap) BE
yf whveuteglariae Mh Pawel be eg beet Weapitibacan ua iethsiia iityfitigs ito Ps je it mbiatity
Me . (Sitar Nga Mire iP sige lowng., bho a Si piss reulital) 8 { sve) 2 wiht? GEM AV? bbe,
oe a ONG aaa Pn) sy egal Ne faniursi es Yahontaphiilegn acti sabe MOO Ab ads
. WK eR, kone aacied xing sitabed mess rade oR iy ell sete PST ‘picts erro
Aro te ee i: ke dinghiiqurs os Hite 4 fe aig a pect Hliww olde vse y mrad cxly fee? eo Danek:
TE Al NGPA, HRA dork din suet lof ippamlieg: Mynx aduay SBTC: s hee > Ta lent
Ne oH ef thw TRS, Cans Bilt ie Tap df ian ACTA Chiles aria Wel, Seal hy ee v5 9 Ba Le ag
Pa , My] me wae gh " Ve i sr eect rom as Pe i . He -
{ hw, oY Ladera P giat Pap 6 Oa sh. NV ire al : a
Ro? Piade Ki HAD Varnyratnaicas, Walled iver ciate Ay L. WE ron aa 508 i te sie)
Rae ye (ike re mice) : ohn hi aan gt ables roa 7 he Ly a Ms
a3 Win) BS, Tennent hind pRadiee lod Sagan, KL, Mrcataeny get es. Pica sca
or Lae Vidal te, 200G) Taaninnerns cat Boge 1 atl Pa iagy penis KE, NV yy, mage iP: aes ; Ti aN 7 “ty
| io iy "A teen Ky ZEKE EL ar in et tra dary Cont “cer ipl! Au Myer Gs ci \ Agi 0. cas ms of
5 at Vaniry i ee Mee aye writ Ciptvg dat!) vi Pan s Be: AVS atm oh! pe e pies)
Siu ia Wadi A thes, ee ataly-al ware vis wit, iin fi ‘y whit Gi sk m9 sche At ; Ye aa
=F . ona :

; Heh iy, Vaeiny “ id AT weit Ae, hot As at Stet wy es *) 24. ‘Apa aane mB a¥, &, + i

ith i, eh Ky Ki; ase “pee deel: Fist < Chas Lagivwvenye: hans Oe malier: grain, 4] wii meat
MMi Lihcnalbaaie (Paar painigns Eikterviny entavedi hr ets kee
roi Bl Gee hist up nat tir itty ipoanyveset 24 i phe ars a i ki r Hye | Lavi estes
“i + Pavale iiboreoliy Js ery Mair i, f 7 nee rors Say
BP sia deohen. day Fide day hits iho pea etn, (uliingiwtint bath el (hajcad nee is, 2 a

bic pnd usiaace wach hi esti hie kt RRA BEN i: ua

MY COTA XON

Volume 95, pp. 67-69 January-March 2006

Kalmusia amphiloga comb. nov. on Bambusa

OvE E. ERIKSSON

ove.eriksson@emg.umu.se
Department of Ecology and Environmental Science, Umea University
SE 90187 Umea, Sweden

Abstract—Leptosphaeria amphiloga is transferred to the genus Kalmusia. It differs
from K. scabrispora, another bambusicolous species, in smaller ascomata, asci and
ascospores.

Key words—bambusicolous, pyrenomycete, morphology

Introduction

Tanaka et al. (2005: 110) recently transferred Leptosphaeria scabrispora Teng to the genus
Kalmusia Niessl. That species occurs on Phyllostachys and is certainly closely related to
another bambusicolous species, Leptosphaeria amphiloga, which is transferred here to
Kalmusia.

Kalmusia amphiloga (Petr.) O. E. Erikss., comb. nov. Fig. lab
Basionym: Leptosphaeria amphiloga Petr., in Sydow & Petrak, Ann. Mycol. 29: 202
(1931):

The presence of this fungus on old bamboo culms is indicated only by the epidermis
being raised by the ascomata over small scattered areas, c. 10-40 x 10 mm, up to c.
150 um high. There are several densely aggregated ascomata within each elevated area,
which may have several, narrow, longitudinal cracks, but the ascomata are not visible,
only the minute, ascomal pores may be visible.

Pseudostroma subepidermal and visible only if the epidermis is removed, forming a thin,
dark brown layer in small, scattered, circular areas on the wood; hyphae intermingled
with the uppermost cell layer of the wood, and not distinctly visible as discrete hyphae,
irregularly dark reddish brown, turning greenish brown with NaClO or KOH.

Ascomata subepidermal, several densely aggregated in one layer on each pseudostroma
(Fig. 1a), flattened subglobose or of more irregular shape from mutual pressure, c. 200-
300 um across; wall c. 10-12 um thick, pale brown to hyaline.

Hamathecium of numerous, parallel hyphae (pseudoparaphyses?) between and above
asci, and here with few branches and anastomoses; cells hyaline, rather thick-walled,
most of them c. 25-35 um long and c. 2 um wide, with most of the protoplasm (1.5-3
tm) near the septa, slightly constricted at some septa; in the periphery hyphae with
more anastomoses and shorter cells.

Asci c. 85-100 x 14-17 um, clavate, bitunicate; ectotunica thin, endotunica thin (also in
asci with broken ectotunica), with a small ocular chamber, but no ring structures; with 8
spores, the two lowermost overlapping uniseriate, the others biseriate.

Ascospores (Fig. 1b) 26-31 x 8-9 um, fusiform, lower hemispore often with more
rounded end, inequilateral, (2-)3-5-septate, very seldom with a longitudinal septum in
one of the segments, pale brown, with dark brown, coarse verrucae, and a hyaline sheath
(width could not be measured safely, as the material is old and the ascospores do not
readily leave the asci). |

Anamorph not seen.
Habitat: old culms of Bambusa sp.
Known distribution: Asia (Philippines).

Material studied: Philippines, Luzon, Pampanga Prov., Stotsenberg, on Bambusa sp.,
iii. 1923, leg. Mary Strong Clemens, n. 1632 (W 11891, holotype).

Discussion

Ascomata of Leptosphaeria species have walls with scleroplectenchymatous cells
(Holm 1957). Leptosphaeria amphiloga differs in that respect from typical members
of the genus. It resembles very much another bambusicolous species, Leptosphaeria
scabrispora, which recently was transferred to Kalmusia by Tanaka et al. (2005: 110), and
L. amphiloga is now placed in the same genus. Kalmusia scabrispora (Teng) Tanaka et al.
and K. amphiloga both have ascomata that are densely aggregated under the epidermis
in elevated areas of bark on bamboo stems. The ascomata, asci and ascospores of the
former species are larger. In K. scabrispora, the ascomata measure 250-400 um, the
asci 124-153(-160) x (15.5-) 17-21 um, and the ascospores (29-)31-40.5 x (7-)8-10 um
(Tanaka et al., l.c.), whereas in K. amphiloga, the ascomata measure c. 200-300 um, the
asci c. 85-100 x 14-17 um, and the ascospores c. 26-31 x 8-9 um.

Kalmusia is currently accommodated in the Montagnulaceae (Eriksson 2006: 7), but
there are no sequences in GenBank from any member of the genus, and its position is
uncertain.

Acknowledgements
I am grateful to the Curator of W for the loan of the type material of Leptosphaeria amphiloga, to
Dr Jingzhu Pearl Yue (San Francisco) for preparing a drawing of a bamboo twig with immersed

ascomata of the species, and to the reviewers Prof. L. Holm and Prof. N. Lundqvist (Uppsala) for
examining this paper.

Literature Cited
Eriksson O.E. (ed.). 2006. Outline of the Ascomycota — 2006. Myconet 12: 1-82.
Holm L. 1957. Etudes taxonomiques sur les Pléosporacées. - Symbolae Botanicae Upsalienses
14(3); 1-188.
Sydow H. & Petrak F 1931. Micromycetes philippinenses. Series secunda. Ann. Mycol. 29: 145-
7 bef

Tanaka K, Harada Y, Barr ME 2005. Bambusicolous fungi in Japan (3): a new combination,
Kalmusia scabrispora. Mycoscience 46: 110-113.

Bee
a

Boo SRS:
ae oe,
Phe
Sa he RS RRs oie

Naess
sour

ose

Fig. 1 a-b. Kalmusia amphiloga. a. Bark with bulges, each containing several ascomata (del. J.-Z.
Yue). b. ascospores. Scale: a. 1 mm, b. 10 pm. - Material: a-b. W11891.

—

MYCOTAXON

Volume 95, pp. 71-79 January-March 2006

A new species and new records of
Rhytismatales from Taiwan

CHENG-LIN Hout ROLAND KIRSCHNER* CHEE-JEN CHEN?

houchenglincn@yahoo.com
‘College of Life Science, Capital Normal University
Beijing 100037, China

kirschner@em.uni-frankfurt.de
*Botanisches Institut, Johann Wolfgang Goethe- Universitat
Frankfurt am Main, 60054 Frankfurt/M., Germany

C5200999@mail.stut.edu.tw
*Department of Biotechnology, Southern Taiwan University of Technology
1 Nan-Tai street, Yung-kang City, Tainan County, Taiwan 71043

Abstract—Of nine names of the Rhytismatales reported for Taiwan, only five,
Coccomyces foliicola, Lophodermium mangiferae, L. pinastri, Rhytisma placenta, and
Vladracula annuliformis, are retained. The other four are either invalid or incorrect.
Recently, additional specimens were collected and identified. They include a new
species, Coccomyces taiwanensis on fallen twigs of an unknown angiosperm host,
and three species reported for the first time for Taiwan, Coccomyces multangularis
on Machilus thunbergii, Lophodermium conigenum on Pinus sp. and Lophodermium
petrakii on Cunninghamia lanceolata.

Key words—Ascomycota, Rhytismataceae, taxonomy

Introduction

Until now, nine names of the Rhytismatales (Ascomycota) have been reported for
Taiwan. Some of them, however, are invalid or incorrect. Lophodermium rottboelliae
Sawada (‘rottobaelliae’), Rhytisma ilicis Sawada, and R. rhododendri-oldhamii Sawada
are invalidly published since Sawada did not provide Latin diagnoses for them (Hou
2004, Sawada 1943, 1944, 1959), and Coccomyces mussaendae Sawada is a synonym of
Biostictis tjibodensis (Racib.) Sherwood (Ostropales) (Sherwood 1980).

Therefore, there are only five correctly applied names of the Rhytismatales in
Taiwan, i.e. C. foliicola (Dennis & Spooner) Sherwood, L. mangiferae Koord., L. pinastri
(Schrad.) Chevall., R. placenta Berk. & Broome, and Vladracula annuliformis (Syd. et
al.) BE Cannon et al. (Sawada 1959, Sivanesan & Hsieh 1989, Li & Hsieh 1991, Chen &
Hsieh 1994, Wu & Wang 2000). The present study, which is based on specimens recently
collected by the second and third authors from Taiwan, includes one new species and
three species previously unknown from Taiwan.

* Author for correspondence

Materials and methods

Sections of different thickness of ascomata were made by hand using a razor blade.
Microscopic preparations were made in water, Melzer reagent, 5% KOH, or 0.1%
(w/v) cotton blue in lactic acid. For observation of ascomatal outlines in vertical
section, sections were mounted in lactic acid or cotton blue with pretreatment in water.
Gelatinous sheaths surrounding ascospores and paraphyses were observed in water or
cotton blue in lactic acid. Ascospore contents are drawn based on observations in water.
Measurements were made using material mounted in 5% KOH or Melzer’s reagent and
from 20 ascospores and asci for each specimen.

Taxonomy

Coccomyces multangularis Y.R. Lin & Z.Z. Li Mycosystema 20: 1, 2001
FIGURES 1-5

Holotype. On Litsea coreana var. sinensis (Allen) Yang & P. H. Huang, China, Anhui,
Huangshan, Zuishi, 12 VIII 1995, Y. R. Lin et al. L1621a (AAUF 67729a).

Ascomata developing on both sides of fallen leaves, in small, bleached or pale brown
lesions, angular, 4-6-sided, occasionally triangular, round when young, (500-)600-
1100 um diam., black, shiny on the upper side of the leaf, and less shiny on the
lower side of the leaf, strongly raising above the surface of the host at maturity, with
obvious, preformed lines of dehiscence, lips absent, opening by 4-6 teeth. In median
vertical section, ascomata intraepidermal at ascomatal edges, subepidermal to intra-
hypodermal near the middle part of covering stroma, and intraepidermal to cuticular
near the opening, 220-320 um deep, covering stroma poorly developed, 20-35 um thick,
consisting of textura angularis and hyphae with thick-walled, dark brown fungal cells.
Epidermal and remained hypodermal cells in covering stroma filled with dark brown
fungal cells of different size. Periphyses short cylindrical, hyaline, thin-walled, 3-5 x
1-2 um. Basal stroma medium developed, flat, composed of two layers of dark brown,
thick-walled angular cells, 10-13 um thick. Excipulum present, 20-30 um wide, arising
from the marginal paraphyses. Excipular elements similar to paraphyses. Subhymenium
consisting of textura intricata, 15-20 um thick, with many crystals of different shape
and size. Paraphyses 100-120 x 1.5-2 um, filiform, aseptate, not branched, swollen up to
4-5 um diam. at the apex. Asci ripening sequentially, 80-110 x 4-5 um, cylindrical, thin-
walled, J—, without circumapical thickening at the apex, 8-spored. Ascospores filiform,
40-65 x 0.8 um, rounded at the apex and slightly tapering towards the base, hyaline,
aseptate, multiguttulate, with a thin gelatinous sheath.

Structures resembling conidiomata of Rhytismatales in pale areas near ascomata, pale
brown to concolorous with the host tissue, round, 180-240 um diam., opening by an
ostiole. In vertical section, conidiomata epidermal. Conidiogenous cells and conidia not
seen.

Specimen examined: TAIWAN, Taipei, Yangmingshan, alt. ca. 900 m, on fallen leaves of
Machilus thunbergii Sieb. & Zucc. (Lauraceae), 27 VIII 2004, Roland Kirschner (TNM).

Known distribution: Anhui (Lin et al. 2001) and Taiwan.

Known Host species: Litsea coreana var. sinensis, Machilus thunbergii. (Lin et al. 2001).

> * oo
Pant and os
Ssitise Sora ie

DS acy ih
wes

Figs. 1-5. Coccomyces multangularis on fallen leaves of Machilus thunbergii. 1. A leaf bearing
ascomata. 2. Ascomata as seen under a dissecting microscope. 3. Ascoma in vertical section.
4. Detail of an ascoma in vertical section. 5. Paraphyses, a mature ascus with ascospores, an ascus
after the liberation of the ascospores, and liberated ascospores with gelatinous sheaths.

Notes: The morphological features, ecology and host of the specimen are very similar to
the type specimen of Coccomyces multangularis described by Lin et al. (2001). Depth of
ascomata inserting the host of C. multangularis is similar to that of C. mucronatus Korf
& W. Y. Zhuang on fallen leaves of Fagaceae (Korf & Zhuang 1985). C. mucronatus is
easily distinguished from C. multangularis by its mucronate tip of the paraphyses.

Coccomyces taiwanensis C.L. Hou, R. Kirschner & Chee J. Chen, sp. nov.
FIGURES 6-11

Ascomata (1200-)1500 x 2500 um, nigra, elliptica, intraepidermalia; paraphyses filiformes;
asci (150-) 180-220 x 8-10 um, clavati; ascosporae 100-150 x 1-1.5 um, filiformes.

Etymology: referring to the place where the specimen was collected.

HOLOTYPE: On twigs of unknown angiosperm host, TArwan, Yilan, Taipingshan, alt.
ca. 1500 m, 24 V 2000, R. Kirschner & Chee. J. Chen 662 (TNM).

Ascomata developing on fallen twigs, not associated with bleached areas. Ascomata
irregularly rounded or slightly triangular, occasionally elliptical, (1200-)1500 x 2500 um
diam., black, strongly raising above the surface of the host at maturity, without preformed
lines of dehiscence, lips absent, opening by irregular splits. In median vertical section,
ascomata deep in host tissue, 300-450 um deep, covering stroma up to 75-120 um thick
near the centre of the ascomata (not including host tissue), slightly thinner towards the
edges, extending to the basal stroma, consisting of an outer layer of host tissue and an
inner layer of black textura angularis and short hyphae.

Periphysoids absent. Basal stroma flat, 30-50 um thick, composed of an outer layer of
dark brown short hyphae or textura angularis and an inner layer of pale brown to hyaline
short hyphae. Excipulum well developed, 80-120 um wide, arising from the marginal
paraphyses. Excipular elements branching two times near the apices. Subhymenium
consisting of textura intricate, 10-15 um thick. Paraphyses 200-250 x 1 um, filiform,
unbranched, simple, slightly hooked at the apex. Asci ripening sequentially, (150-)180-
220 x 8-10 um, long cylindrical-clavate, with a conspicuous stalk, thin-walled, J-,
without circumapical thickening, 8-spored. Ascospores fasciculate, 100-150 x 1-1.5 um,
filiform, tapering at the both ends, hyaline, aseptate, gelatinous sheaths not seen.

Conidiomata and zone lines not observed.
Known distribution: Only from the type locality.
Habitat: C. taiwanensis was collected from twigs in litter.

Notes: Microscopical investigations of wood anatomy of the substrate of C. taiwanensis
revealed the presence of pitted vessels, indicating that the host belongs to angiosperm.
Coccomyces taiwanensis is ecologically and macroscopically similar to some Coccomyces
species on bark, such as C. boydii A. L. Sm. on Myrica gale L., C. juniperi (P. Karst.)
P. Karst. on Juniperus spp., and C. strobi J. Reid & Cain on Pinus spp. (Sherwood 1980).
However, C. taiwanensis has a very well developed excipulum and excipular elements
branching two times near the apices, while C. boydii, C. juniperi, and C. strobi do not
have an excipulum (Sherwood 1980). In addition, shape and size of ascospores as well
as lacking of gelatinous sheaths surrounding the ascospores of the new taxon are quite
different from those of the species mentioned above (Sherwood 1980). The shape of the

=
“es
=
_—

10um

Figs. 6-11. Coccomyces taiwanensis on twigs of unknown angiosperm host. 6. A twig bearing
ascomata. 7. Ascomata as seen under a dissecting microscope. 8. Ascoma in vertical section.
9. Detail of an ascoma in vertical section. 10. Detail of the top of excipular elements. 11. Paraphyses,
a young ascus, a mature ascus with ascospores, an ascus after the liberation of the ascospores, and

liberated ascospores.

released ascospores of C. taiwanensis is reminiscent of the species of Lophodermium
unciniae and L. brunneolum (Johnston 1994) where the ascospore has a slight bend
along its length. For the new taxon, however, no a small gelatinous appendage at the
point where the ascospore is bent is observed.

Lophodermium conigenum (Brunaud) Hilitzer, Véd. Spisy ¢sl. Akad. zeméd. 3: 76,
129:
Lophodermium pinastri forma conigena Brunaud, 1888; Lophodermina conigena (Brunaud)
Tehon, 1935. Neotype. On Pinus sylvestris L., Scotland, Glentanar, Aberdeenshire, 5 IX
1975, C. S. Millar s. n. IMI 231805.
For description and figures of L. conigenum see Minter (1981, 1985).
Specimen examined: TAIWAN, Nantou, Huisunlinchang, ca. 800 m, on fallen needles of
Pinus sp., 11 VIII 2004, R. Kirschner & C. J. Chen 2015 (TNM).

Known distribution: Europe, North America, Asia, Australia, Africa (Minter 1981).
Host species: Pinus sp. (Pinaceae). For further host species see Minter (1981).

Habitat: L. conigenum was collected from needles that were still attached to twigs or
fallen on the ground.

Notes: Lophodermium conigenum is morphologically similar to L. australe Dearn., and
Minter (1985) considered that they might be conspecific. The specimen we checked
matches the description of L. conigenum by Minter (1981) except that the dimensions of
the ascomata and ascospores are somewhat smaller. Our collection differs from Minter’s
concept of L. australe by its wider ascomata which partly insert epidermal cells of host.

The nucleotide sequences of the internal transcribed spacer (ITS) show that
specimens identified as both these species are genetically very similar (Ortiz-Garcia et
al. 2003). However, unpublished ITS sequence data of the first author shows that there
may be several genetically distinct but morphologically very similar L. conigenum-like
species. DNA sequences were not obtained for the Taiwanese specimen.

Lophodermium petrakii Durrieu, Sydowia Beih. 1: 355, 1957. FIGURES 12-19
Type. On Cunninghamia lanceolata (Lamb.) Hook., France, Arboretum Henri Gaussen

du Laboratoire forestier de Toulouse, 4 Jouéou prés Luchon, IX 1955, Herbier du
Laboratoire Botanique Appliquée, Toulouse (TLA 1822).

Ascomata on both sides of needles, scattered, sometimes two ascomata confluent. In
surface view ascomata dark brown, shiny, perimeter line inconspicuous or absent,
elliptical, 700-1100 x 420-580 um, slightly raising above the surface of the substrate,
opening by a single longitudinal split. Lips inconspicuous. In median vertical section
ascomata subcuticular, 220-280 um deep. Covering stroma up to 40-65 um thick near
the centre of the ascomata, thinner towards the edges, not extending to or slightly to
the basal stroma, consisting of an outer layer of host cuticle, a layer of textura angularis
but textura epidermoidea with thick-walled, dark brown cells near the inner part of the
covering layer. A triangular space between the covering stroma and the basal stroma
filled with thin-walled, hyaline cells. Lip cells sparse, disappearing at maturity. Basal
stroma poorly developed or absent, the epidermal cells underneath basal stroma tinted.
Subhymenium 8-15 um thick, composed of textura intricata. Paraphyses 120-150 x

Ui TAT high
IN ANY
Foo MOR KSTOEO

18 aa MH /

6° WA 6— PAS p ws: S
Fo Wadcmqaqoncaonen;
50 ym

~—-
.
.

mee om eee we =
emer ane ee
_-—-.e2

Cia tow aad a anes) os,

on
,
he
Q
’
re
u
*
a
‘
a
a
Of
ua
bd |
23
.
’

te OS ae ens we oe ees

~—*
mee lee ee
SONA I oe

see eimai
. “See eee

em a me ene,
-

Figs. 12-19. Lophodermium petrakii on Cunninghamia lanceolata. 12, 13. Needles bearing ascomata.
14. Ascomata as seen under a dissecting microscope. 15. Ascoma in vertical section. 16. Detail of an
ascoma in vertical section. 17. Paraphyses, mature asci with ascospores, and liberated ascospores
_ with gelatinous sheaths. 18. Conidioma in vertical section. 19. Conidiogenous cells and conidia.

2-3 um, filiform, septate, not branched, slightly swollen at the apex, the paraphyses
covered by gelatinous sheaths. Asci ripening sequentially, (60-)80-140 x 10-13 um,
cylindrical, thin-walled, sometimes rostrate at the apex at maturity, J-, without
circumapical thickening. Ascospores 50-75 x 1.5-2 um, filiform, slightly tapering near
the base, hyaline, aseptate, with a 1-2 um thick gelatinous sheath.

Conidiomata on both sides of needles. In surface view conidiomata 100-250 tum diam.,
elliptical or slightly irregular, concolorous with the substrate or slightly brown, dark
brown when old, opening by one to several ostioles. In vertical section conidiomata
subcuticular, 23-35 um deep, upper layer composed of host cuticle and undistinguishable
fungal tissue. Basal layer poorly developed. Conidiogenous cells 8-15 x 1-2 um,
cylindrical, tapering towards the tip. Conidia 4-7 x 0.8-1 um, bacilliform, hyaline.

Zone lines present, frequent, black.
Specimen examined: TAIWAN, alt. ca. 400 m, 20 III 2001, R. Kirschner (s. n.) (AAUP),

TAIWAN, Nantou, Huisunlinchang, ca. 800 m, 12 VIII 2004, R. Kirschner & C. J. Chen
2053 (TNM).

Host species: Cunninghamia lanceolata (Lamb.) Hook. (Taxodiaceae).

Known distribution: Europe (Durrieu 1957), Anhui, Jiangxi, Sichuan, Guizhou,
Jiangsu, Hunan, Fujian, Guangxi, Shandong, Henan, Shanxi (Hou 2000, Lin et al. 1993),
Taiwan.

Habitat: L. petrakii was collected from needles that were still attached to living and dead
twig and shoot.

Notes: Lophodermium petrakii was often incorrectly described as L. pinastri or L.
uncinatum Darker in China (Hou 2000, Teng 1996). However, L. pinastri only occurs
on Pinus spp. (Minter 1981) and L. uncinatum is only known on Abies spp. in North
America. They are morphologically quite different from L. petrakii.

Acknowledgements

We are grateful to Dr. W.Y. Zhuang and Dr. P.R Johnston for critically reading the manuscript,
to T. Trampe for assisting in the wood anatomy of the substrate of C. taiwanensis, and to Dr. Y.
Z. Wang for providing literature on ascomycetes from Taiwan. The study was supported by the
National Science Council (NSC 93-2745-B-218-001-URD) of Taiwan, Deutscher Akademischer
Austauschdienst of Germany (DAAD), and the National Natural Science Foundation of China
(NSFC).

Literature Cited

Chen CY, Hsieh WH. 1994. Some new ascomycetous fungi for Taiwan. Trans. Mycol. Soc. R. O.
C. 9: 39-54.

Durrieu G. 1957. Deux Hypodermataceae nouvelles sur conifers. Sydowia Beih. 1: 355-358.

Hou CL. 2000. The pathogenic fungi of Rhytismataceae on Chinese fir. Forest Pest and Disease. 19:
3-5. (in Chinese)

Hou CL. 2004. Rhytismatales (Ascomycota) in China-Ecology, Morphology, and Systematics
[Dissertation]. Frankfurt am Main: J. W. Goethe-Universitat Frankfurt, 2004. 279 pp.

Korf RP, Zhuang, WY. 1985. Some new species and new records of discomycetes in China.
Mycotaxon 22: 483-514.

Johnston PR. 1994. Ascospore sheaths of some Coccomyces, Hypoderma, and Lophodermium
species (Rhytismataceae). Mycotaxon 52: 221-239.

_ LiLT, Hsieh WH. 1991. Two new species and 13 new records of ascomycetes from Taiwan. Trans.
mycol. Soc. R. O. C. 6: 57-71.

Lin YR, Tang YP, Liu HY. 1993. Some members of the Rhytismataceae on conifers in the southern
part of China. Acta Mycol. Sin. 12: 93-98. (in Chinese)

Lin YR, Li ZZ, Xu ZS, Wang JR, Yu SM. 2001. Studies on the genus Coccomyces from China IV.
Mycosystema 20: 1-7. (in Chinese)

Minter DW 1981. Lophodermium on pines. Mycol. Pap. 147: 1-54.

Minter DW. 1985. Some members of the Rhytismataceae (Ascomycetes) on conifer needles from
Central and North America. Pp. 71-106. In Peterson, G. W. Recent research on conifer needles
diseases conference proceedings. Gen. Techn. Rep., WO-50, U. S. Forest Serv.

Ortiz-Garcia S, Gernandt DS, Stone JK, Johnston PR, Chapela IH, Salas-Lizana R, Alvarez-Buylla
ER. 2003. Phylogenetics of Lophodermium from pines. Mycologia 95: 846-859.

Sawada K. 1943. Descriptive catalogue of the Formosan fungi. Part VIII. Rep. Dept. Agric. Gov.
Res. Inst. Formosa 85: 1-130, in: Anonymous. 1999. List of the Fungi in Taiwan. Council of
Agriculture, Executive Yuan, Taipei, 289 pp.

Sawada K. 1944. Descriptive Catalogue of Formosan Fungi. Part X. Rep. Dept. Agric. Gov. Res. Inst.
Formosa 87: 1-97, in: Anonymous. 1999. List of the Fungi in Taiwan. Council of Agriculture,
Executive Yuan, Taipei, 289 pp.

Sawada K. 1959. Descriptive Catalogue of Taiwan (Formosan) Fungi. XI. College of Agriculture,
National Taiwan University, Taipei, Taiwan: 1-268 + plates I-XII.

Sherwood MA. 1980. Taxonomic studies in Phacidiales: the genus Coccomyces (Rhytismataceae).
Occ. Pap. Farlow Herb. Crypt. Bot. 15: 1-120.

Sivanesan A, Hsieh WH. 1989. New species and records of ascomycetes from Taiwan. Mycol. Res.
932340 S51:

Teng SC. 1996. Fungi of China. Mycotaxon, Ltd., Ithaca, N.Y. 586 pp.

Wu ML, Wang YZ. 2000. Mycological resources of saprophytic ascomycetes in Fushan Forest.
Fung. Sci. 15: 1-14.

MYCOTAXON

Volume 95, pp. 81-90 January-March 2006

Macromycetes of Pinacate and Great Altar Desert
biosphere reserve, Sonora, Mexico

MARTIN ESQUEDA’, MARTHA CORONADO?, ALFONSO SANCHEZ’,
EVANGELINA PEREZ-SILVA}? & TEOFILO HERRERA?

*esqueda@cascabel.ciad.mx
‘Centro de Investigacion en Alimentacion y Desarrollo
A.C. Apartado Postal 1735, Hermosillo 83000, Sonora. México

?Centro de Estudios Superiores del Estado de Sonora
Apartado Postal 11, Admon. 11, Hermosillo 83000, Sonora. México

Laboratorio de Micologia, Instituto de Biologia, UNAM
Apartado Postal 70-233, Coyoacan 04510, México D.F. México

Abstract—Macromycetes associated with four different vegetation types in the
Pinacate and Great Altar Desert biosphere reserve were studied over a one-year
period. Twenty-seven taxa representing the Phallales and Agaricales were determined.
Families represented include the Geastraceae (4), Agaricaceae (5), Phelloriniaceae (1),
Lycoperdaceae (4), Schizophyllaceae (1), and Tulostomataceae (12). Of these, Montagnea
arenaria and Podaxis pistillaris, which produced the highest number of collections, were
the most widely distributed; species belonging to the Geastraceae and Lycoperdaceae
showed a more restricted distribution. The most species-rich genus was Tulostoma with
12 taxa. Geastrum berkeleyi, G. schmidelii and Tulostoma mohavei are new records for
México. Chorology and phenology of all species are outlined, and SEM micrographs of
basidiospores representing six species are provided.

Key words—Gasteromycetes, taxonomy, chorology, phenology, SEM

Introduction

Mexico ranks among the first three places in the world as far as biological wealth is
concerned, with over 12% of the world’s biota. In general, its topography and geographical
location on the boundaries of confluence of the neo-arctic and neo-tropical zones
explain the large variety of ecosystems and resultant biological diversity. The Pinacate
and Great Altar Desert biosphere reserve, which is located 31°30’-32°30° N and 113°00’-
114°30° W, comprises an area of 714,556.5 ha. The core area includes two discontinuous
regions: the Sierra del Rosario in the reserve's northwestern edge (with 41,392.5 ha) and
the Sierra E] Pinacate in the reserve center and eastern portion (with 228,112.75 ha). The
buffer zone comprises 445,051.25 ha.

Over 50% of Sonora’s area, 185,431 km’, corresponds to the Sonoran Desert, from
which the remainder covers a portion of Baja California Sur in Mexico and Arizona and

California in the United States. This region is considered a tropical-subtropical desert
with bi-modal rain patterns. Its climate, physiography, edaphology, and hydrography
favor the establishment of a large diversity of species (Shreve & Wiggins 1975). The
Sonoran Desert has four subdivisions, each of which has very particular features: the
central gulf coast, the Sonoran plains, the Arizona high plateau, and the lower Colorado
river valley.

The biological diversity thus far catalogued for the biosphere reserve is represented
by the following species: 41 mammals, 184 birds, 43 reptiles, 4 amphibians, 2 native fresh
water fish, 560 vascular plants, and 11 fungi, including six Myxomycetes—Didymium
dubium Rostaf., Badhamia melanospora Speg., Fuligo intermedia 'T. Macbr., Physarum
notabile 'T. Macbr., P. robustum (Lister) Nann.-Bremek. and P. straminipes Lister (Moreno
et al. 2004)—and five Gasteromycetes—Battarreoides diguetii (Pérez-Silva et al. 1994),
Dictyocephalos attenuatus (Peck) Long & Plunkett (Esqueda et al. 1998), Tulostoma
cretaceum, T. fimbriatum, and T. leiosporum (Esqueda et al. 2004).

Our study expanded what is known about macromycetes diversity in the Pinacate
and Great Altar Desert Biosphere Reserve. We report below on the 27 species recorded
during our survey, of which 23 are new to the reserve and three are new to the Mexican
mycobiota.

Materials and methods

The survey was conducted at Pinacate and Great Altar Desert biosphere reserve.
Four types of vegetation were sampled seasonally from fall 2003 to summer 2004:
microphyllous desert scrub, sandy desert vegetation, mezquital, and sarcocaule scrub.
The 10 sites studied were geo-referenced with a Magellan GPS ProMark X (Magellan
System Corp., San Dimas, CA) (Table 1).

The sites have a dry type climate of the very dry, semi-warm sub-type, which is bi-
modal: November to April and May to October with temperatures of 6 to 21°C and 18
to 36°C, and rainfalls from 0 to 100 mm and 50 to 100 mm, respectively. The areas are
located within the Sonoran plain, Altar Desert sub-province, Sonoran mountain range
(sierra) and plain. Topographically, the sites correspond to sierra (Los Tanques), sandy
zones (Ejidos of Punta Penasco, Los Nortefios, Sierra Blanca and Cerro Lava), sierras
and small hills (Papalote), and badlands (Ejido of San Juanico; Celaya, El Colorado and
El Elegante Craters).

Taxonomic classification follows Kirk et al. (2001). Specimens were collected and
conserved following conventional mycological techniques. Spores of most of the species
were observed under a Jeol, JSM-5200 scanning electron microscope (SEM). Samples
were studied after a treatment in a Polaron E-2000 equipment for 60 seconds at 1.2 Kv
and 20 mA in an argon atmosphere until a 500 A gold cover was obtained. Specimens
are kept in the macromycetes collection of the Centro de Estudios Superiores del Estado
de Sonora (CESUES) with some duplicates at the National Herbarium (MEXU).

This work was presented at the “Fungal Biodiversity Symposium’, realized on March
4", 2005 to commemorate the 60" anniversary as researcher of the Emeritus Professor
Dr. Teofilo Herrera at the Institute of Biology, UNAM.

Table 1. Sampling localities in Pinacate and Great Altar Desert biosphere reserve

Localities N WwW Altitude Vegetation
Municipality of Sonoyta
I. Sierra Los Tanques 31°46°12” 113°00°48” 371m MDS
II. Ejido Punta Pefiasco 31°45°41” 321557" 154m SDV
III. Papalote 31°55°44” 113°01°40” 307 m M
IV. Crater Celaya SIGSON 7 = Pi3°27 20" 277 m oo
V. Crater El Colorado 31°55’04” 113°18'44” 201m So
Municipality of San Luis Rio Colorado
VI. Cerro Lava 32°03'02” 113°33 33% 2297 SDV
Municipality of Puerto Pefiasco
VII. Crater El Elegante 31°51'34” 113°22 53>) 252m SS
VIII. San Juanico 51°50 Ol 1320135 198 m SS
IX. Ejido Los Nortenios 31°39;367 Lisel9 376 132m SDV
X. Sierra Blanca 310314325 113225 237 60 m SDV

Vegetation types: Microphyllous Desert Scrub (MDS); Sandy Desert Vegetation (SDV); Mezquital (M);
Sarcocaule Scrub (SS).

Results and discussion

Phallales: Geastraceae— The family is characterized by gastrocarps with peridia that split
into stellate rays, unbranched capillitia, and warty spores. Four taxa were determined
within Geastrum, three of them found in the mezquital: G. berkeleyi, G. kotlabae and
G. schmidelii (Table 2). Geastrum berkeleyi, which is close to G. campestre Morgan, G.
kotlabae, and G. pseudolimbatum Hollés, was diagnosed based on the following features:
a conical, plicate peristome, a coarse endoperidium, a short stalk and a non-hygroscopic
exoperidium. Spores measure 5—6 um diam.; SEM micrographs indicate that the epispore
is composed of columnar processes with truncated apices that are about 0.7 um high and
occasionally confluent (Fig. 1). G. berkeleyi is a first record for Mexico.

Macroscopically, Geastrum kotlabae is similar to G. campestre and G. pouzarii V.J.
Stanék, but differs by having a sessile spore sac in contrast to the stalked endoperidial sac
in the other two species. In Mexico, it is known to grow in arid areas of Baja California,
Tlaxcala and Sonora (Guzman & Herrera 1969, Esqueda et al. 2003, Calonge et al. 2004).
G. kotlabae was the only species collected throughout the year (Table 2). Within the
Sonoran Desert, G. minimum has been found to grow in microphyllous desert scrub,
tropical thorn forest, spiny scrubland and tropical deciduous forest (Pérez-Silva et
al. 1999, Esqueda et al. 2003). In this specific study, it was collected from sarcocaule
scrubland in spring.

The gastrocarp of Geastrum schmidelii resembles that of G. pectinatum Pers. but is
smaller and has a short-stalked endoperidial sac covered by a thin powdery layer (this

‘eyep Ay[eIO] 1OJ [ IQRI, 22g “VIOIGOIAUT UBdIXaY IY} JOF SPIOIAI MAN x “(JOIUIM) F (uUMNY) ¢ {(JauTUINS) Z ‘(suTIdg) | :UOseag
ee eee ee ee ee Se SS Se SSS SS eee ee

4 OC ‘ye 19 Jaslory (I “AU) vavwsdd vywapvy
ZOIENS
C “7: Te
TA TBM “A'{ (‘Bads) mj4ayonjs vUoIsqy
avaovpsadoohT
uljnowsd
u ‘pus [asta1y (‘[[ed) VUva[NI4aYy vIUILO]]AYq
IvIIVIUIAO[JIYd
I er Cel ve Vt I aGal| Vv Vo Ge Von VET ‘Iq ("T) suoyysid sixvpog
a Ve Cc I SCI v1 VOC 4 We Clee Fee Cal aoe I3]JPZ (COC) Visvuaso vauspjuoW
WS "H'V 29 Jasuls
: : (SUILIID 2 Ieays) wno1u0Z11v winyodjdopugq
€ aasseyy (‘AW *D) saupqdjou wnydydosojyo
€ € 7%, IIJIZ (SAND “WW 28 Ae) sisuaxa] DINSUOT

IDIIVILADSY ‘SAJVILADSY

VE ‘PENIA Mapiwmyrs WN«4svad ,

I UIIMYIS WNW WN44SvaL)
VETT 6 yaueys [A aquyjoy winsjsvayy

v gasseyy 14ajay19q WNAISvIY ,

avaIvAJsvay ‘sajv]JVYd

x XI IIIA IIA IA A AI Ill II I

SS COS SdIDddS

SHLLITVOOT

IATOSOL s1aydso1q JJasoq IeyV JeolH pue oyedeuld 94} ul satdads s9}o9AUIOIOU jo UOTINGLYSTC “7 age,

IIIA

IIA

“eyep AjTEIO] 1OF [ IPqUT, 29g “eIOTQOOAUT UBITXIY] 9} IOJ Sp10III MAN , “(JOIUTM) F ‘(UUININY) € <(aauruns) 7 ‘(sutids) | :uoseag

8 —— SS ——— 8 —— OO

SALLITVOOT

V aot

Z Bu07T wnjtydosax viuojsojny,
Z pdAory wnavusdd vuojsojny,
SIT[A 2 2YOOD wnsago vwuojsojny,

WSIIM “A'[ (Jed) Wnuvu viu0jsojNy,

Z pAoyy saavyou vuojsojny, ,
v ‘II “AY winsodsota vuojsojny,
BU0T WNyDosINJOAUI DULOJSO]N],

‘Ly wnyoiquy vui0jsojny,

SUOT WnasvjJad9 DULOJSO]N],

fe SYM “S'A SUDIIGID VIUOJSO]NI,

VoL ‘qualyy wnjv.sa9v] VUOJsOZ1YIS

eIOIIOY ‘Y,
2g WIDE “Y (TRH 2 ‘Wed) Wansip saproasuvyjog
IDIIVIDULOJSO]N],

‘Iq aunwwuogs wnydydoz1ys¢
avaovydydoziyrs
UUND “5D vsoINsad vpasiIsiq

a SOTTOH (2esseyl 29 2YOOD) xtuyjopody vpasi9siq

SHIOddS

papnjruos ((UoLNgLYsIp aJaIAWOsIVU ad.sasay) Z 219UI,

crystalline pruina is occasionally absent). Spores measure from 4.5 to 5.5 um; SEM
microphotos reveal an epispore formed of warts and columnar processes that are about
0.5 um high and occasionally coalescent (Fig. 2). In Northwestern Europe, it grows in
association with scrubland vegetation in open areas on well-drained sandy, slightly
alkaline and calcareous soils (Sunhede 1989). These features are similar to those of the
site, where it was collected in mesquite tree vegetation in the Sonoran reserve (Table 2).
It is recorded for the first time in Mexico.

Agaricales: Agaricaceae—This family comprises 51 genera and 918 species. It is
characterized by basidiomes with velar structures and spores of variable color but never
rusty-brown or cinnamon-brown (Kirk et al. 2001). Five taxa were determined for
Agaricaceae, with Montagnea arenaria and Podaxis pistillaris outstanding as they were
present in all sites and found throughout the year at several sites. Both have smooth,
thick-walled pigmented spores. These characteristics help to explain its wide distribution
throughout the reserve under extreme conditions, as they are commonly found in areas
with no vegetation at all. Apparently these fungi, together with species that belong to the
Tulostoma obesum complex, are the best adapted in this ecological reserve. They have
been registered for several xeric regions of Sonora (Aparicio-Navarro et al. 1994, Pérez-
Silva et al. 1994, Esqueda et al. 1998).

Longula texensis, Chlorophyllum molybdites and Endoptychum arizonicum had a
more restricted distribution. Longula texensis, which is similar to Gyrophragmium
dunalii (Fr.) Zeller, is considered uncommon in Mexico (Ochoa 1993). Recently Geml
et al. (2004), based on the sequence of internal transcription spacers (ITS) and largest
partial sub-unit of ribosomal ADN, confirmed that these species are valid since they
evolved from different Agaricus taxa. Chlorophyllum molybdites is widely distributed
throughout Mexico and can cause gastrointestinal distress (Pérez-Silva 2004). It was
restricted to areas of mezquital at the end of the rainy season during fall. Although
Endoptychum arizonicum has been frequently collected in arid areas of Sonora (Esqueda
et al. 1990, 1998), distribution in the reserve was restricted to two sites with sandy desert
vegetation. This secotioid fungus with smooth and thick-walled spores is well-adapted
to xeric environments.

Agaricales: Phelloriniaceae—Diagnostic characters of this family include stipitate
gastrocarps and basidia that persist in bundles in the mature gleba. Although Phellorinia
herculeana is widely distributed throughout the world’s arid regions, it is uncommon.
In fact, this is the third record for Sonora: P herculeana was previously cited for the
microphyllous desert scrub (Aparicio-Navarro et al. 1994) and in spiny scrubland
(Esqueda et al. 1998). Recordings for Mexico are scarce: San Luis Potosi, Sinaloa
(Guzman & Herrera 1969), Nuevo Leén and Tamaulipas (Urista et al. 1985). It was the
only species observed growing in the microphyllous desert scrub, solitary during winter
in the Pinacate (Table 2).

Agaricales: Lycoperdaceae—Family features include epigeous gasterocarps with
apical openings, hyphae lacking clamp connections, and powdery gleba. The four
representatives of the Lycoperdaceae that were determined had a restricted distribution
and fruited during summer (Table 2). Abstoma stuckertii was found in association with

Figs. 1-6. SEM micrographs of basidiospores. Fig. 1. Geastrum berkeleyi (CESUES 5111). Fig. 2.
Geastrum schmidelii (CESUES 5108). Fig. 3. Abstoma stuckertii (CESUES 5232). Fig. 4. Disciseda
hyalothrix (CESUES 5208). Fig. 5. Disciseda verrucosa (CESUES 5226). Fig. 6. Tulostoma mohavei
(CESUES 5209). Scale bar = 1 um.

mezquital. The size and ornamentation of spores (Fig. 3) allow it to be easily identified.
It is known to the United States, Argentina, and Australia (Suarez & Wright 1990).

Disciseda hyalothrix was only collected in microphyllous desert scrub. Gastrocarps of
Disciseda taxa are similar and can be recognized by their distinctive spore ornamentation.
D. hyalothrix is characterized by an epispore forming columnar processes that have
flattened and confluent tips (Fig. 4). In Mexico, it has been recorded for xeric regions
in Chihuahua (Laferriere & Gilbertson 1992), Sonora (Esqueda et al. 1995a) and Baja
California (Ochoa et al. 2000).

The known distribution of Disciseda verrucosa on the American continent is
restricted to Sonora, Mexico, where it is associated with microphyllous desert scrub
(Aparicio-Navarro et al. 1994), spiny scrubland, and the low deciduous forest (Pérez-
Silva et al. 2000). Spore ornamentation is very characteristic under SEM with an epispore
composed of small warts and obtuse finger-like processes (Fig. 5). In the reserve, it was
seen in mezquital during summer and winter.

Calvatia pygmaea is a xerophilous bovistoid species that belongs to Calvatia Section
Lanopila (Fr.) Kreisel and is the only taxon in this group that has smooth spores under
both LM and SEM. Worldwide, it is only known from Argentina and Bolivia (Fries
1909) and Baja California Sur, Mexico (Ochoa et al. 1998). It was restricted to sandy
desert vegetation with gastrocarps collected in all seasons except autumn in the reserve
(Table 2).

Agaricales: Tulostomaceae—Family characters include stipitate gasterocarps having
long stalks with globose heads, peridia with apical pores, and pleurosporous basidia.
Battarreoides diguetii has been previously registered for several sites in the Sonoran
Desert (Pérez-Silva et al. 1994, Esqueda et al. 1995b). In the Pinacate, it was observed
to grow in sarcocaule scrubland and sandy desert vegetation in summer and winter,
respectively.

Schizostoma laceratum is only known to grow in Northwestern Mexico in Baja
California (Moreno et al. 1995) and Sonora (Esqueda et al. 1995b). It showed a wide
distribution within the reserve, growing in all types of vegetation, bearing gastrocarps
mainly during spring (Table 2).

Different species of Tulostoma showed a restricted distribution: T! albicans, T.
mohavei and T. pygmaeum were all found in microphyllous desert scrubland, and T!
involucratum was found in sarcocaule scrubland (Table 2). In contrast, T. leiosporum
and T. obesum, characterized by their subsmooth (rugose) and smooth spores under
SEM, respectively, which have a thick and pigmented wall, had a wider distribution.
Tulostoma fimbriatum was collected throughout the year, except for winter, while
growing in mezquital. Tulostoma mohavei is similar to T: obesum, its difference being the
ferruginous ochre colored gleba and the dark ferruginous to chocolate colored gleba,
respectively. This is the first report for Mexico of T: mohavei, which previously had been
cited in North America only from Arizona and California in the United States. The
distribution of Tulostoma pygmaeum in Mexico was only known to Veracruz, Oaxaca
(Wright 1987) and Baja California (Moreno et al. 1995). This is the first record for the
Sonoran mycota.

Agaricales: Schizophyllaceae—This family comprises 5 genera and 43 taxa characterized
by pleurotoid basidiomes with split-lamellate hymenophores (Kirk et al. 2001).
Schizophyllum commune is widely distributed throughout Mexico from arid to template
zones, occasionally in cold areas (Olivo & Herrera 1994). In the Pinacate, it was collected
throughout the year only in mesquite tree vegetation (Table 2).

Acknowledgments
The authors thank SEMARNAT-CONACYT (Grant 2002-C01-0409) and DGAPA (Grant IN206901

(México). Our gratitude is to M.B. Mendoza-Garfias (UNAM) for her assistance with SEM. We are
grateful to Prof. H. Kreisel and Prof. FD. Calonge for the critical revision of the manuscript.

Literature Cited

Aparicio-Navarro A, Quijada A, Quintero T, Burquez A. 1994. Nuevos Gasteromicetos para la
micobiota de Sonora, México. Ecoldgica 3: 11-14.

Calonge FD, Guzman G, Ramirez E 2004. Observaciones sobre los Gasteromycetes de México
depositados en los herbarios XAL y XALU. Boletin de la Sociedad Micoldgica de Madrid 28:
337-371;

Esqueda M, Quintero T, Pérez-Silva E, Aparicio A. 1990. Nuevos registros de Gasteromycetes de
Sonora. México. Revista Mexicana de Micologia 6: 91-104.

Esqueda M, Pérez-Silva E, Herrera T. 1995a. New records of Gasteromycetes for Mexico. Documents
Mycologiques 98-100: 151-160.

Esqueda M, Pérez-Silva E, Villegas RE, Araujo V. 1995b. Macromicetos de zonas urbanas, II:
Hermosillo, Sonora, México. Revista Mexicana de Micologia 11: 123-132.

Esqueda M, Pérez-Silva E, Herrera T, Moreno G. 1998. Adiciones al conocimiento de los
Gasteromicetos de Sonora, México. Revista Mexicana de Micologia 14: 41-52.

Esqueda M, Herrera T, Pérez-Silva E, Sanchez A. 2003. Distribution of Geastrum species from some
priority regions for conservation of biodiversity of Sonora, Mexico. Mycotaxon 87: 445-456.

Esqueda M, Moreno G, Pérez-Silva E, Sanchez A, Altés A. 2004. The genus Tulostoma in Sonora,
Mexico. Mycotaxon 90: 409-422.

Fries RE. 1909. Uber einige Gasteromyceten aus Bolivia and Argentinien. Arkiv for Botanik 8:
1-34.

Geml J, Geiser DM, Royse DJ. 2004. Molecular evolution of Agaricus species based on ITS and LSU
rDNA sequences. Mycological Progress 3: 157-176.

Guzman G, Herrera T. 1969. Macromicetos de las zonas aridas de México, II. Gasteromicetos.
Anales del Instituto de Biologia de la Universidad Nacional Auténoma de México, Serie
Botanica 40: 1-92.

Kirk PM, Cannon PE, David JC, Stalpers JA. 2001. Ainsworth and Bisby’s dictionary of the fungi.
9" ed. CAB International, Wallingford-Oxon.

Laferriere JE, Gilbertson RL. 1992. Fungi of Nabogame, Chihuahua, Mexico. Mycotaxon 44: 73-
87.

Moreno G, Altés A, Ochoa C, Wright JE. 1995. Contribution to the study of the Tulostomataceae in
Baja California, Mexico. I. Mycologia 87: 96-120.

Moreno G, Illana C, Esqueda M, Castillo A, Pérez-Silva E. 2004. Notes on Myxomycetes from
Mexico II. Boletin de la Sociedad Micoldgica de Madrid 28: 55-63.

Ochoa C. 1993. Contribucién al estudio taxondmico, ecoldgico y corolédgico de la clase
Gasteromycetes sensu lato en Baja California, México. Doctoral Thesis. Universidad de Alcala,
Alcala de Henares.

Ochoa C, Moreno G, Altés A, Kreisel H. 1998. Calvatia pygmaea (Gasteromycetes) in the deserts of
Baja California Sur (Mexico). Cryptogamie Mycologie 19: 131-137.

Ochoa C, Moreno G, Altés A, Aguilar-Rodriguez JL. 2000. Gasteromycetes de Sierra Juarez, Baja
California, México. I. Boletin de la Sociedad Micoldgica de Madrid 25: 157-166.

Olivo F, Herrera T. 1994. Las especies de Schizophyllum en México, su distribucién ecoldgica e
importancia etnomicoldgica. Revista Mexicana de Micologia 10: 21-32.

Pérez-Silva, E. 2004. Intoxicacién por hongos. 305-329, in OB Martinez (ed.), Intoxicaciones.
México, McGraw-Hill-Interamericana.

Pérez-Silva E, Esqueda M, Herrera T. 1994. Contribucién al conocimiento de los Gasteromicetos de
Sonora. Revista Mexicana de Micologia 10: 77-101.

Pérez-Silva E, Herrera T, Esqueda M. 1999. Species of Geastrum (Basidiomycotina: Geastraceae)
from Mexico. Revista Mexicana de Micologia 15: 89-104.

Pérez-Silva E, Esqueda M, Herrera T, Moreno G, Altés A. 2000. Disciseda verrucosa (Gasteromycetes)
in Mexico. Mycotaxon 76: 337--341.

Shreve F, Wiggins IL. 1975. Vegetation and flora of the Sonoran Desert. Stanford University Press,
Stanford.

Suarez V, Wright JE. 1990. South American Gasteromycetes IV. The genus Abstoma. International
Journal of Cryptogamic Botany 1: 372-383.

Sunhede S. 1989. Geastraceae (Basidiomycotina). Morphology, ecology, and systematics with
special emphasis on the North European species. Synopsis Fungorum 1. Fungiflora. Gronlands
Grafiske A/S, Oslo.

Urista E, Garcia J, Castillo J. 1985. Algunas especies de Gasteromicetos del Norte de México. Revista
Mexicana de Micologia 1: 471-523.

Wright JE. 1987. The genus Tulostoma (Gasteromycetes). A world monograph. J. Cramer, Berlin-
Stuttgart.

MYCOTAXON

Volume 95, pp. 91-96 January-March 2006

A new species and a new record of
Lycoperdaceae from India

DiPIKA BiIsHT’, J.R. SHARMA', HANNS KREISEL? & KANAD Das*

‘Botanical Survey of India
192, Kaulagarh Road, Dehradun 248195, India

*Zur Schwedenschanze 4, D-17498 Potthagen, Germany

*daskanad@yahoo.co.in
*Mycology Group, Agharkar Research Institute
G.G. Agarkar Road, Pune 411004, India

Abstract—A new species, Lycoperdon ovalicaudatum and a new record, Calvatia
longicauda, are described and illustrated in detail from Western Himalaya, India.

Key words—macrofungi, Gasteromycetes, Lycoperdales, taxonomy

Introduction

During the macrofungal investigation in Western Himalaya, authors collected
some interesting specimens belonging to Lycoperdon Tourn.:Pers. and Calvatia Fr.
Macroscopic and microscopic studies followed by literature survey revealed them as
an undescribed species proposed herein as Lycoperdon ovalicaudatum, and Calvatia
longicauda reported for the first time from India. The genus Lycoperdon is characterized
by having basidiomata with more or less distinct pseudostipe, opening by apical pore
and branched, rarely septate, capillitial hyphae. Out of ca 50 species known from the
world over (Kirk et al. 2001), only a few have pedicellate spores. The genus Calvatia
characterized by irregular dehiscence of peridium and regularly septate capillitium,
comprises ca 36 species world wide (Kreisel 1994). Preliminary surveys have revealed
rich representation of these genera in the Himalayan forests (Ahmad 1941, Gupta et al.
1974, Khare 1976, Thind & Thind 1982).

Materials and Methods

The present communication is based on the surveys undertaken to different localities
of Uttaranchal during June-October in 2004 and 2005. Morphological characters
were noted from the fresh specimens in the field. Microscopic anatomical details were
studied from the dried material mounted in 5% KOH, lactophenol-cotton blue and
lactic acid. Line drawings were prepared with the aid of camera lucida attachment at
original magnification of 1500x for basidiospores, 500x for peridial structures and
500x or 1000x for capillitial hyphae. A total of 25 basidiospores were measured from

the holotype. Colour terminology follows Kelly & Judd (1955). Herbarium name used
follow Holmgren et al. (1990). Kr. refers to the personal herbarium of H. Kreisel.

Description of the species

Lycoperdon ovalicaudatum D. Bisht, J.R. Sharma & Kreisel, sp. nov.

Pig? 4
Etymology: The name refers to the ovate, pedicellate spores of this taxon. |
Basidiomata pyriformia-turbinata, 18-22 mm lata, 20-24 mm alta. Pseudostipes
praesens. Exoperidium griseofuscum, spinosum, spinae densae in parte superiori,
sparsae in parte inferiori. Endoperidium pallide flavum, brunneum. Gleba griseofusca,
pulverulenta. Pseudocolumella indistincta. Subgleba loculata. Basidiosporae ovales, 5.4-
5.7 x 3.7-3.9um, glabrae, guttulatae, pedicelli hyalini, recti, ad 22um longi. Capillitium
4-6um latum, fuscogriseum, crassitunicatum, non septatum, glabrum, ramosum, parietes
non perforatae. Paracapillitium 3-4um latum, hyalinum, septatum, tenuitunicatum.
Exoperidium 500um crassum. Endoperidium 60um crassum, hyphis 2um crassis, non
septatis. Holotypus: INDIA, Uttaranchal, Nainital, Sheetla, August 23 , 2004, leg. D. Bisht,
DB514 (HOLOTYPUS, BSD; ISOTYPUS, Kr.).

Basidiomata scattered or gregarious, pyriform to turbinate, 18-22 mm broad, 20-24 mm
high. Rhizomorphs poorly branched. Pseudostipe present. Exoperidium dark greyish
brown, spinose, spines up to 0.5 mm, dense, prominent on the upper part, scattered,
blunt on pseudostipe. Endoperidium light yellowish brown, rough, opens by apical
aperture. Gleba greyish brown, pulverulent at maturity. Pseudocolumella indistinct.
Subgleba chambered, one- quarter of basidiomata in length, tapering towards base.

Basidiospores ovate, 5.4-5.7 x 3.7-3.9 um, Q=1.5, smooth , guttulate, pedicellate,
pedicels hyaline, long , curved, up to 22 um in length. Capillitium greyish brown,
4—6 um wide, smooth, aseptate, branched, thick-walled, wall more than 1pm thick, not
pitted. Paracapillitium hyaline, 3-4 um wide, smooth, septate, unbranched, thin-walled.
Exoperidium pseudoparenchymatous, up to 500 um thick, cells subglobose-oval, 20-40
x 14-32 um in diameter, thin-walled. Endoperidium hyphal, up to 60 um thick, hyphae
narrow, up to 2 um wide, aseptate, unbranched, thin-walled.

COLLECTIONS EXAMINED—-INDIA, Uttaranchal, NAINITAL, Sheetla, on soil, August 23, 2004,
leg. D. Bisht, DB514 (BSD).

Comments—Lycoperdon ovalicaudatum can be distinguished by comparatively smaller
basidiomata, prominent spiny warts on the upper part, chambered subgleba and ovate,
smooth, pedicellate spores. The shape and surface of basidiospores are unique which
make this species distinct. The present taxon is close to L. mundkurii S. Ahmad but the
latter has comparatively larger basidiomata with spines on exoperidium forming a dark
central patch at the apical part. Further, L. mundkurii has verruculose spores with longer
(30 um) pedicels and much branched and wider (up to 10 um wide) capillitial hyphae.
L. asperum (Lév.) Speg. which also appears closer to the present taxon morphologically,
has globose-subglobose spores and rudimentary subgleba (Bottomley 1948, Dissing &
Lange 1962, Kreisel & Hausknecht 2002).

Fig. 1. Lycoperdon ovalicaudatum (from holotype): a. Basidiomata b. Basidiospores c. Capillitium
d. Paracapillitium e. Exoperidium f. Endoperidium. Bars: a = 10 mm; b-f = 10 um.

Calvatia longicauda (Henn.) Lloyd, Mycol. Writ. 2 (Letter 21): 3. 1908

=Lycoperdon longicaudum Henn., Botan. Jahrb. Syst. 23: 556. 1897
Fig. 2

Basidiomata scattered on leaf litter, turbinate-agaricoid, 4-8 cm broad, up to 7 cm high,
distinctly lobed, irregular, flattened head with a long pseudostipe, fragile-brittle after
drying. Rhizomorphs whitish, fine, profusely branched. Pseudostipe curved, up to 5 cm
in length, tapering towards base. Exoperidium dark brown, verrucose with prominent
verrucae on upper portion, shed off at maturity. Endoperidium light orange yellow,
rough, peeling off in irregular flakes at maturity. Gleba medium yellow brown at centre,
dark yellow brown beneath peridium, very persistent. Pseudocolumella indistinct.
Subgleba dark yellowish brown, chambered.

Basidiospores globose-subglobose, 3.3-4.0 x 3.3-3.9 wm, verruculose, guttulate,
apedicellate. Capillitium olivaceous yellow, up to 4 um wide, lumen hyaline, septate,
dichotomously branched, tapering towards ends, pitted, wall up to lum thick.
Paracapillitium absent. Exoperidium pseudoparenchymatous, up to 625 um thick, cells
10-25 x 7-15 um, cylindrical, arranged in irregular chains on upper part, gradually
subglobose, compact on lower part. Endoperidium hyphal, up to 125 um thick, hyphae
2-4.5 um wide, septate, branched, thin-walled.
COLLECTIONS EXAMINED—INDIA, Uttaranchal, DEHRADUN, Forest Research Institute
campus (700 m), on soil, June 26, 2004, leg. D. Bisht & K. Das, DB1005 (BSD); ibid.
Botanical Survey of India campus (700 m), on soil, October 8, 2005, leg. D. Bisht, DB605
(BSD).

Comments—The agaricoid basidiomata, ruptured peridium after drying and persistent
gleba are the main determining features of this species. Calvatia gardneri (Berk.) Lloyd
can be confused with this species in the field, but the earlier one lacks the persistent
gleba and agaricoid basidiomata (Dring & Rayner 1967). C. craniiformis (Schwein.)
Fr. resembles the present species in the manner of rupturing the peridium and in size
and shape of basidiospores but differs in having wider (up to 7.7 um) capillitial hyphae
(Zeller & Smith 1964). Unlike C. longicauda, C. candida (Rostk.) Hollés has pulverulent
gleba and pseudoparenchymatous exoperidium with cells not arranged in chains (Thind
& Thind 1982).

Acknowledgements

The authors are thankful to the Director, Botanical Survey of India, Kolkata and Joint Director,
Northern Circle, Dehradun for providing facilities during the present study. Prof. ED. Calonge
(Real Jardin Botanico, Madrid, Spain) and Prof. Gabriel Moreno (University of Alcala de Henares,
Spain) are duly acknowledged for critically reviewing the manuscript. Financial assistance to one
of the authors (DB) is provided by Botanical Survey of India.

Literature Cited

Ahmad S. 1941. Higher Fungi of the Panjab Plains III. The Gasteromycetes. Jour. Ind. Bot. Soc.
20: 1335-143.
Bottomley AM.1948. Gasteromycetes of South Africa. Bothalia 4: 473-810.

lum

. Capillitium d. Exoperid

10 um.

iospores C

- a. Basidiomata b. Basidi

Fig. 2. Calvatia longicauda

a = 10 mm; b-e =

e. Endoperidium. Bars

Dissing H, Lange M. 1962. Gasteromycetes of Congo. Bull. Jard. Bot. Etat 32(4): 325-416.

Dring DM, Rayner RW. 1967. Some Gasteromycetes from Eastern Africa. J. E. Afr. Nat. Hist. Soc.
26 no 2(114): 5-46.

Gupta KK, Agarwal RK, Kumar S, Seth PK. 1974. Gasteromycetes of Himachal Pradesh. Ind.
Phytopath. 27(1): 45-48.

Holmgren PK, Holmgren NH, Barnett LC. 1990. Index Herbariorum. Part 1: Herbaria of the
world, 86" ed. Brox: New York Botanical Garden.

Khare KB. 1976. Some Gasteromycetes from Uttar Pradesh. Ind. Phytopath. 29: 34-38.

Kirk PM, Canon PF, David IC, Stalpers JA. 2001. Ainsworth & Bisby’s Dictionary of the Fungi. 9"
edition, CAB International, Wallinford, 655pp.

Kreisel H. 1994. Studies in the Calvatia complex (Basidiomycetes) 2. Feddes Repertorium
105(5-6): 369-376.

Kreisel H, Hausknecht A. 2002. The gasteral Basidiomycetes of Mascarenes and Seychelles. Osterr.
Z. Pilzk. 11: 191-211.

Thind KS, Thind IPS. 1982. The Gasteromycetes of the Himalayas II. Jour. Ind. Bot. Soc. 61:
19-32.

Zeller SM, Smith AH. 1964. The Genus Calvatia in North America. Lloydia 27(3): 148-186.

MYCOTAXON

Volume 95, pp. 97-112 January-March 2006

Notes on the type, synonyms,
and other specimens of the balansioid fungus,
Nigrocornus scleroticus

MALCOLM J. RYLEY*

malcolm.ryley@dpi.qld.gov.au
Department of Primary Industries and Fisheries
PO Box 102, Toowoomba Qld, 4350 Australia

Abstract—The type, and other specimens of the balansioid fungus, Nigrocornus
scleroticus, its synonyms, and similar fungi studied during extensive research on the
taxonomy and biology of the fungus, are described. Two hypocrealean fungi found
parasitising the ascostromata of N. scleroticus are also discussed.

Key words—Balansia sclerotica, Ephelis, Nectriella, Bionectria

Introduction

Ryley (2003) erected the genus Nigrocornus Ryley & Langdon, with Nigrocornus
scleroticus as the type and only species, to accommodate a balansioid fungus formerly
known as Balansia sclerotica. Both the teleomorph and anamorph of this fungus differ
significantly from all other members of the tribe Balansieae. The teleomorph consists
of perithecia immersed in a black, corniform, papillate stroma, composed of hyphae
and the protophyll of the axillary bud, at the nodes of tillers of its grass hosts. The
dimensions of the ascostromata vary considerably from host to host. The cylindrical,
unitunicate asci within the perithecia have a hemispherical cap perforated by a fine
pore, and contain eight filiform, 7-septate ascospores. Upon discharge from the asci,
the ascospores produce short germtubes from each cell, and break into two 3-septate
part-spores. The anamorphic conidia develop holoblastically on short, indeterminate
conidiophores which are on an effuse hyphal layer covering the abaxial surfaces of the
upper leaves on tillers bearing the teleomorph. Both the morphology and ontogeny of
the anamorphic conidia of N. scleroticus are identical to those described for Ephelis Fr.,
which is the anamorph of the balansioid genera, Balansia Speg., Dothichloé G.F. Atk.,
and Myriogenospora G.F. Atk., and one of the two anamorphs of Atkinsonella Diehl
(White, 1997; Hodge, 2003). Nigrocornus scleroticus, whose Ephelis fructification and
sexual state are spatially separated, differs from all other described balansioid fungi. The
anamorph(s) and teleomorphs of these fungi develop in succession on the same stroma
(White, 1997).

*Formerly of the Department of Botany, University of Queensland, St. Lucia Qld 4072, Australia

Ryley (2003) has described, in detail, the development and morphology of N. scleroticus,
host symptomatology, the fungus’ relationships with other balansioid genera, and has
formally erected the new genus. In this paper I provide information on specimens of
the synonyms and other collections of N. scleroticus. In addition, the features of two
hyperparasitic hypocrealean fungi, found on some ascostromata of N. scleroticus, are
described and their identity is discussed.

Examination of herbarium specimens

All herbarium specimens were examined in a similar manner. The dimensions, shape
and other aspects of the morphology of papillate ascostromata were ascertained, and
where possible a single ascostroma was removed from the host and soaked for 24 hours
in lactophenol. Sections 1-2 mm thick were taken from the ascostroma, and perithecia
teased from the stromatic hyphae. Data were gathered on the morphology of perithecia,
asci and ascospores. The uppermost leaves of the specimens, where present, were
examined for the presence of effuse conidial fructifications. When such a fructification
was found, a portion was mounted in lactophenol-trypan blue for 2 hours before
examination.

The type specimen of N. scleroticus

Epichloé sclerotica Pat., J. Bot. (Morot) 4: 65 (1890)
Synonyms: Ophiodothis sclerotica (Pat.) Henn., Ann. Naturhist. Mus. Wien 15: 2 (1900).
Balansia sclerotica (Pat.) Héhn., Sitzungsber. Kaiserl. Akad. Wiss., Math.-
Naturwiss. K1., Abt. 1, 120: 449 (1911).
Parepichloé sclerotica (Pat.) J.F. White & P.V. Reddy, Mycologia 90: 231 (1998).
Nigrocornus scleroticus (Pat.) Ryley, Clavicipitalean Fungi: Evolutionary Biology,
Chemistry, Biocontrol, and Cultural Impacts. pp. 267-268 (2003).
SPECIMEN EXAMINED-VIETNAM (as TONKIN). On ?Cymbopogon sp.: EAC-BIN 11.X1.1887
Balansa FH (NEOTYPE). Fig 1A.

Nigrocornus scleroticus is based on Epichloé sclerotica, which was described by Patouillard
(1890) from a specimen collected in Tonkin, now Vietnam. The holotype of E. sclerotica
could not be obtained from any herbarium, so the specimen listed above was designated
as the neotype (see Ryley, 2003 for details). A complete description of Patouillard’s
original specimen is given by Ryley (2003). My observations on the teleomorph were
almost identical with those of Patouillard (1890) except in some minor details. While
Patouillard (1890), Hennings (1900), and Héhnel (1911) did not describe an anamorph
for this species, Ryley (2003) found it to be present on the adaxial surfaces of the upper
leaves of the neotype, and although in poor condition, to agree well with observations of
the anamorph on fresh material of the fungus.

The type specimens of the synonyms and possible synonyms
of N. scleroticus

1. Hypocrella axillaris Cooke, Grevillea 20: 4 (1891)

Synonyms: Hypocrea axillaris (Cooke) Massee, J. Bot. 34: 152 (1896).
Balansia axillaris (Cooke) Petch, Ann. Roy. Bot. Gard. (Peradeniya) 6: 171
(1916).

SPECIMENS EXAMINED-AUSTRALIA. QUEENSLAND. On Gramineae: BRISBANE FM Bailey
K ex Herb. FM Bailey 897898. On Eragrostis pubescens (R.Br.) Steud. (as Eragrostis stricta
Cke.): WALSH R T Barclay-Millar VPRI437 ex. Qld Herb. (as Eragrostis stricta), 111.1891 T
Barclay-Millar DAR69754 ex Herb. FM Bailey 897 & 898 (here designated LECTOTYPE).
NORTHERN TERRITORY. On Chrysopogon violascens Trin. (not a valid name; no known
synonym): 20.IV.1916 GF Hill VPRI438.

Hypocrella axillaris was described by Cooke (1892) on grasses from Brisbane, Queensland,
Australia, which had been collected by EM. Bailey. The following description was
provided by Cooke (1892): “Stroma obturbinate or obclavate, seated in the upper axils
(5 mm long, 2-3 broad), black, opaque, minutely granular with the ostiola; substance
white. Perithecia very minute, immersed in the periphery. Asci cylindrical, 120 um
long. Sporidia filiform, at length multiseptate (about 100 u long), hyaline. On grasses,
Brisbane (EM. Bailey 897, 898)”. Massee (1896) transferred the fungus to Hypocrea and
considered that it was identical with Hypocrea (Hypocrella) bambusae Berk. & Broome.
Some years later, Petch (1916) provided evidence by which the species axillaris and
bambusae could be separated, and transferred both to Balansia. Petch (1916) added the
following information on the morphology of the fungus — the stroma was adnate to the
leaf (of the lateral shoot), the perithecia were flask-shaped, 0.15 mm deep and 0.15 mm
diameter, and the asci were about 180 um x 5 um.

My examination of the specimens labelled EM. Bailey 897 and 898 from several
herbaria (K, DAR) has shown that the characteristics of that fungus published by Cooke
(1892) and Petch (1916) were accurate, although the asci were closer to Petch’s (1916)
dimensions. On all specimens, a white flaky deposit was present on the adaxial surfaces
of the uppermost leaves, but no acicular conidia were found. Some differences were
observed in the stromata from material in the two specimens from Kew. In specimen
number 897 the protophyll of the axillary bud at each node is attached to the stroma,
whereas in number 898 the protophyll is not adnate to the stroma.

There is some evidence that Cooke’ material was collected from at least two grass species.
Firstly, Cooke (1892) described H. axillaris on “grasses”. Secondly, large spines up to 1 mm
long are present around the margin of the leaf blade on the host material in specimen 898,
ex K. The spines are absent from leaf blades of the material in specimen 897 from that
herbarium. The material in both specimens consists of only vegetative portions of the host,
so the identity of the grasses cannot be ascertained with any certainty. One of the specimens
in DAR69754 consists of two short sections of culm held on a piece of card by a paper strap
with the annotation “897 & 898”. On each culm there is a single ascostroma, and a thin,
dried, effuse hyphal sheet on the abaxial surfaces of the upper leaves. The long spines found
in the Kew specimen 898 are absent from the leaves on both sections of culm, and the
protophyll is adnate with stromal tissue on both ascostromata.

One of the hosts of this fungus is probably Eragrostis pubescens (R.Br.) Steud. (syn.
Eragrostis stricta F.M. Bailey), because (i) Bailey (1913) listed it as the host of Hypocrea
axillaris, (ii) in VPRI437, E. stricta is listed as the host of Hypocrea (Hypocrella) axillaris
on a mounting board displaying a short length of a single culm with several ascostromata
and the annotation “898” (iii) the annotation “Hypocrea (Hypocrella) axillaris on a grass
_ (Eragrostis stricta) Walsh R, T.B. Millar” is on a specimen packet containing short sections
of stem each with a single ascostroma in DAR69754 and (iv) Eragrostis stricta was described

100

by Bailey (1891) from material collected at Walsh River, north-eastern Queensland. Palmer
et al., (2005) listed E. stricta as a synonym of E. pubescens. The locality on VPRI437 and
DAR69754 is also given as Walsh River.

Taking these facts into consideration, it is likely that VPRI437, DAR69754, and the two
specimens originally from EM. Bailey's herbarium (897, 898) and now deposited at Kew,
were collected at the same time near Walsh River in north-eastern Queensland by Barclay-
Millar and examined by Bailey in Brisbane. One of the grasses is E. pubescens, but the
other is unknown. Because the type specimen(s) of B. axillaris contains ascostromata on
two different species of grasses, one of them must be designated as the lectotype. Cooke
listed the specimens EM. Bailey 897 and 898 as the specimens he examined to typify the
fungus, and neither Massee (1896) nor Petch (1916) designated a type specimen. Specimen
DAR69754 is here designated as the lectotype because it is most representative of Cookes
original description.

The fungus called B. axillaris is very similar to N. scleroticus. The ascospores are somewhat
shorter than those of the type of N. scleroticus, but in material which may possibly have been
collected while immature, the significance of disparities in dimensions is probably less than
the mere figures might suggest.

2. Epichloé oplismeni Henn., Bot. Jahrb. Syst. 22: 76 (1895)
Synonyms: Ophiodothis oplismeni (Henn.) Henn., Ann. Naturhist. Mus. Wien 15: 2 (1900).
Parepichloé oplismeni (Henn.) J.E White & P.V.Reddy, Mycologia 90: 231 (1998).

SPECIMEN EXAMINED-CAMEROON (as KAMEROUN). On Oplismenus sp.: VICTORIA
25.I11.1894 Preuss B ex Preuss No.1153 (HOLOTYPE).

In his description of Epichloé oplismeni, Hennings (1895a) noted that the stromata were
curved, black, 3-4 mm long and 1 mm wide. ‘The asci were 180-220 x 5-5.5 um, and
the ascospores were 90-110 x 0.3-0.5 um, aseptate and hyaline. Examination of the type
specimen revealed that the ascospores are 7-septate, and 180-220 x 3-5 um. During
preparation of the teleomorph for microscopic examination the ascospores easily
fragmented into 3-septate part-ascospores, as do those of N. scleroticus. No conidia
were found on the upper leaves of the specimen, but hyphal sheets, similar to those
found on many specimens of N. scleroticus, were present. The lack of conidia on the type
specimen of O. oplismeni may be due to the weathered state of the specimen at the time
of collection. I consider that O. oplismeni is a synonym of N. scleroticus.

3. Epichloé schumanniana Henn., Pflanzenw. Ost-Afrikas, C: 32 (1895)
Synonyms: Ophiodothis schumanniana (Henn.) Henn., Ann. Naturhist. Mus. Wien 15: 2 (1900).
Balansiopsis schumanniana (Henn.) Hohn., Sitzungsber. Kaiserl. Akad. Wiss., Math.-
Naturwiss. K]., Abt. 1, 119: 61 (1910).

SPECIMENS EXAMINED-CONGO (as BELGIAN CONGO). On Schizachyrium brevifolium
(Sw.) Nees: Holst B ex. Holst n. 3110 (HOLOTYPE) [No host name or locality was given on
the type specimen packet, but in his original description Hennings (1895a) called the host
Schizachyrium brevifolium, and gave the locality as East Africa]. On Andropogon sp.: .1913 T
Enlleb B. On Andropogon sp.: Warnorki B.

Hennings (1895b) described the fungus as having curved stromata, 3-5 x 1 mm, asci 150-
210 x 2-4 um with an obtuse to rotund apex, and filiform, multiguttulate ascospores, 120-

101

180 x 0.5-1.0 um. Hohnel (1910) considered that O. schumanniana should be transferred
to Balansiopsis Hohn., an opinion based on the similarity of the development of the
ascostromata of Epichloé schumanniana with that of Balansiopsis gaduae (Rehm.) Hohn.,
the type species of Balansiopsis. An important taxonomic criterion of the fungi assigned
to Balansiopsis was the lack of an anamorph. However, that genus is no longer valid
because Ephelis anamorphs have been described for all the fungi placed in Balansiopsis
(White, 1997). My examination of the type specimen showed that Hennings’ (1895b)
description of the ascostromata and asci was accurate. The ascospores are 7-septate and
120-180 um long. Conidia, 14-21 um long and identical in all other respects with those
of the type specimen of N. scleroticus, were found on the upper leaves of this specimen.
Both the ascal and conidial states found on the type specimen of B. schumanniana are
very similar to the corresponding states on N. scleroticus, so it can be considered to be
conspecific with the latter. White & Reddy (1998) considered that Epichloé sclerotica
(sic) and Epichloé schumanniana were identical, based on ascostroma morphology and
ITS1 sequences.

4. Epichloé volkensii Henn., Pflanzenw. Ost-Afrikas, C: 32 (1895)

Synonyms: Ophiodothis volkensti (Henn.) Sacc., Bull. Soc. Roy. Bot. Belg. 38: 161 (1899).
Balansia volkensii (Henn.) E.Castell. & Cif., Prod. Mycofl. Afr. Or. p. 20 (1937).
Parepichloé volkensii (Henn.) J.E White & P.V.Reddy, Mycologia 90: 231 (1998).

SPECIMENS EXAMINED-AFRICA. On Andropogon sp.: KILO? G Volkens B (HOLOTYPE).
CENTRAL AFRICA? On Anthephora sp.: pyuR IX.1867 G Schweisfurth? B. CENTRAL
AFRICAN REPUBLIC (as FRENCH CONGO). On grasses: KOUTI REGION (NEAR NDELE)
15.X1.1891 J Dybowski F6844 ex Patouillard Herb. 597 (as Hyalodothis clavus).

Hennings (1895b) reported that the host of Epichloé volkensii was Andropogon
exothecus Hack. On the packet containing the type specimen, and in the description
of Ophiodothis volkensii (Bresadola & Saccardo, 1899), the host is given as Andropogon
sp. In his paper, Hennings provided the following description: “Stromatibus vaginas
ramulorum ambientibus subcylindraceis, curvatis, corniformibus, semini cornuto
similibus, duris, atris, rugulosis, minute papillatis, usque ad 1 cm longis, 2 mm crassis,
apicibus plerumque elongatis: peritheciis subglobosis; ascis cylindraceis, 8-sporis;
sporidiis filiformibus. auf Andropogon exothecus - Volk.n.988”. Castellani & Ciferri
(1937) transferred the fungus to Balansia, but provided no reasons for their action.
Roger (1953) reported that the perithecia of B. volkensii measured 225-375 x 90-135
um and that “Les asques cylindriques, octospores, diffluent tot et contiennent des spores
filiformes tres allongées (90-150 um) et fortement guttulées. He gave no indication of
the specimen he examined, so the validity of his report is questionable.

My examination of the type material confirmed much of Hennings’ (1895b) data.
Transverse sections of a stroma revealed that it has a structure similar to that of
ascostromata of N. scleroticus. Immersed in the stroma are locules 360-390 x 120-
150 um which were empty of asci. No asci or ascospores were found in the type
material, a situation which was undoubtedly influenced by the weathered nature of the
ascostromata. The type specimen of B. volkensii lacks the upper portions of the tillers
where an anamorph might possibly have developed on the unfolding leaves. Due to
the inability to determine the morphology of both the anamorph and teleomorph of E.
volkensii, it is here considered to be a tentative synonym of N. scleroticus.

102

Figure 1. Nigrocornus scleroticus. A Portion of neotype with ascostromata (FH) (bar = 5 mm); B
Papillate surface of ascostroma on Sarga leiocladum (BRIP13402) (bar = 1 mm); C-E Ascostromata
on C Sarga leiocladum (BRIP13402) (bar = 5 mm), D Triodia epactia (BRIP27802) (bar = 10mm),
and E Entolasia stricta (BRIP13389) (bar = 5 mm); F Ephelis anamorph on leaves of Digitaria
biformis (IMI123627) (bar = 5 mm)

103

5. Ophiodothis vorax var. paspali Henn., Bot. Jahrb. Syst. 28: 274 (1901)

Probable synonym: Balansia vorax var. paspali (Henn.) Tesdoro (?)

SPECIMEN EXAMINED-JAPAN. SuRUGA PROVINCE. On Paspalum scrobiculatum L. (as
Paspalum filiculare Nees on specimen packet): 18.X.1921 K Hara L W ex Sydow fungi exotici
exsiccati No. 520.

Ophiodothis Sacc., type species O. vorax (Berk. & M.A. Curtis) Sacc., was based on
Dothidea vorax Berk. & M.A.Curtis (Berkeley & Curtis, 1883). Ophiodothis vorax var.
paspali was described by Hennings (1901) on Paspalum filiculare Nees from Japan with
the following characteristics: Stromata in the axils of the culms, corniform, black, about
2 cm long, 2 mm wide; asci cylindrical, apex rotund, 8-spored, 90-120 x 5-6 um; spores
filiform, multiguttulate, 0.6-0.7 um wide. Although the name Balansia vorax var. paspali
(Henn.) Tesdoro is listed in Index Fungorum (www.indexfungorum.org/Names/Names.
asp), no reference to a formal description could be found. A specimen labelled Ophiodothis
vorax var. paspali was examined, but the type specimen was unobtainable from any of the
many herbaria to which requests were directed. My examination of the available specimen
revealed that the stromata are 12-20 x 1.5-2.0 mm, the asci 168-220 x 4-6 um, and the
ascospores filiform, 144-180 x 1.0-1.5 um and 7-septate. However, no conidia typical of N.
scleroticus were found on the upper leaves of the specimens. On ascal characters alone, this
fungus closely resembles N. scleroticus.

6. Ophiodothis arundinellae Henn., Bot. Jahrb. Syst. 37: 162 (1906)

SPECIMEN EXAMINED-JAPAN. On Arundinella anomala Steud.: UMAJIMURA .X.1904
Yoshinaga S (HOLOTYPE).

Hennings (1906) described O. arundinellae with the following characteristics: Stroma
in the leaf axils, corniform, cylindrical, obtuse, black ca. 5 x 2 mm, verrucose-rugulose;
perithecia densely crowded, ovoid to ellipsoidal; asci cylindrical, apex rounded-
capitate, 8-spored, 120-150 x 4-6 um; spores arranged in a parallel manner, filiform,
multiguttulate or septate, hyaline, 1.5-2 um wide. Hab. on culms of Arundinella anomola
(sic; = anamola).

The type specimen of this fungus consists of a short section of tiller on which there are
two black, curved ascostromata, 4-5 x 1.5-2.0 mm. The morphology of the ascus and of
the ascospores could not be ascertained due to the weathered nature of the ascostromata.
The specimen did not include any leaves from upper parts of tillers where an anamorph
might possibly be found. The characteristics of the sexual state of O. arundinellae as
described by Hennings (1906) are similar in most respects to those of N. scleroticus.
Unfortunately, no information on the dimensions and septation of the ascospores or
on the characteristics of a possible anamorph could be obtained, so this fungus can be
considered to be a tentative synonym of N. scleroticus.

7. Ophiodothis paspali Henn., Bot. Jahrb. Syst. 37: 162 (1906) (nomen nudum)

SPECIMEN EXAMINED-JAPAN. On Paspalum thunbergii Kunth ex. Steud.: TOKYO BOTANICAL
GARDENS TOKYO 6.1X.1899 Kusano S.

Despite an extensive literature search, no formal description of this fungus was found.
O. paspali appears here because it was mentioned in a short discussion at the end of the

104

formal description of Ophiodothis arundinellae: “Die Art steht der O. paspali P. Henn.
nahe, ist aber durch die kiirzeren, von den Blattscheiden umschlossenen Stromaten,
die langeren Asken und die viel breiteren Sporen genugsam verschieden” (Hennings,
1906).

A specimen bearing this name was obtained from an herbarium (S). The ascostromata
are black, curved, and 7-12 x 1.5-2.0 mm, but the morphology of the asci and ascospores
could not be determined due to the weathered nature of the stromata. Conidia identical
to those of N. scleroticus were found on the upper leaves of this specimen. The name
Ophiodothis paspali Henn. can be considered a nomen nudum under Article 34 of the
International Code of Botanical Nomenclature. The specimen may be an authentic
collection of the fungus described by Hennings (1901) as Ophiodothis vorax var.

paspali.

8. Balansia cynodontis Syd., Ann. mycol. 33: 234 (1935)
Synonym: Parepichloé cynodontis (Syd.) J.F. White & P.V. Reddy, Mycologia 90: 231 (1998).

SPECIMENS EXAMINED-SOUTH AFRICA. On Cynodon dactylon (L.) Pers.:

HARTEBEESTPORT DAM 25.V.1928 AM Bottomley PREM23473 (HOLOTYPE);

BUFFELSPOORT .III.1938 EM Doidge & Turner BPI ex Sydow Fungi exotici exsiccati

No. 996.
Balansia cynodontis was described on a South African specimen of Cynodon dactylon
by Sydow (1935). The following summary of the characteristics of this fungus has been
derived from Sydow’s data: ascostromata straight or curved, 5.0-10.0 x 0.5-0.75 mm,
papillate part covering outer surface is of variable extent; perithecia oblong lageniform,
175-200 x 70-90 um; asci 110-130 x 5.5-6.0 um containing eight filiform spores about
1 um in diameter.

My examination of the type material revealed that on most ascostromata there are
several papillate portions separated from each other by non-papillate areas. A similar
condition is found on some ascostromata of N. scleroticus on Paspalidium criniforme
S.T. Blake collected in southern Queensland. The asci are 135-170 x 5-6 um and have a
hemisperical apical thickening, 3 x 3 um, perforated by a fine pore. Only a few ascospores
could be measured due to the weathered nature of most of the ascostromata, but the
ascospores observed were 120-160 um long and 7-septate. Hyaline, acicular, aseptate
conidia 10-23 um long were found on the adaxial surfaces of the uppermost leaves on
infected tillers.

The teleomorph and anamorph of B. cynodontis are very similar to those of N. scleroticus
in the following characteristics: ascostroma shape, perithecium morphology, ascus
morphology, ascospore septation, and conidium morphology. The non-papillate areas
on the ascostromata of the holotype may be due to differential maturation, because
the entire surfaces of mature ascostromata of a recent collection of N. scleroticus from
Zimbabwe (BRIP39212) were papillate. However the upper and lower limits of the
ranges of both ascus length and ascospore length for B. cynodontis are less than the
corresponding values for N. scleroticus. These differences may be due to the immature
nature of the specimen or to genetic differences between the fungi. I consider that this
taxon is conspecific with N. scleroticus, but examination of fresh material collected from
Cynodon dactylon is warranted.

105

9. Balansia trachypogonis Doidge, Bothalia 4: 854 (1948)
SPECIMENS EXAMINED-SOUTH AFRICA. On Trachypogon plumosus Nees: KAALFONTEIN
9.111.1916 IB Pole-Evans PREM9543b (HOLOTYPE), 2.II.1916 IB Pole-Evans PREM9435
(PARATYPE), 9.I]I.1916 IB Pole-Evans PREM28581 (PARATYPE), 27.III.1917 IB Pole-Evans
PREM10082 (PARATYPE); JOHANNESBURG DISTRICT, III.1931, AM Bottomley PREM26607
(PARATYPE).

The characteristics of Balansia trachypogonis as described by Doidge (1948) are
summarised as follows: ascostromata straight-curved, 1-3 cm x 2-3 mm, perithecia
300-480 x 70-120 um; asci 150-200 x 5 um; ascospores hyaline, filiform, multiseptate,
almost equalling the ascus in length, 1.25-2.5 um wide. My examination of the holotype
and paratypes of B. trachypogonis confirmed the data given by Doidge (1948) as well as
revealing previously undescribed characteristics. The apical thickening of asci of this
fungus is not hemispherical as in N. scleroticus, but is in the form of a slight thickening
of the ascus wall. As a consequence, the apical pore is much wider than on asci of N.
scleroticus. The ascospores are 144-180 um long, 1.0-1.5 um wide, and 7-septate. On the
upper, unfolding leaves, there are conidia, 13-23 um long and 1.0-1.5 um wide. Both the
anamorph and teleomorph of B. trachypogonis are very similar to those of N. scleroticus.
The ascostromata of B. trachypogonis are longer than those of the type specimen of N.
scleroticus, that difference probably being influenced by the host. Although the ranges of
ascospore length and conidium length of the former fungus lie within the corresponding
ranges of N. scleroticus, the characteristics of the apical thickening of the asci closely
resemble that described for Myriogenospora (Luttrell & Bacon, 1977; Bischoff & White,
2003). However, B. trachypogonis cannot be transferred to Myriogenospora because the
stromata of the species in that genus develop in the rolled or folded leaves of grasses
(Luttrell & Bacon, 1977; Bischoff & White, 2003). On this basis, B. trachypogonis is
considered to be a tentative synonym of N. scleroticus, whose taxonomic status may
change after examination of additional specimens.

10. Balansia sclerotica var. deformans Govindu & Thirum., Mycopathol. Mycol. Appl.
20: 300 (1963)

Govindu & Thirumalachar (1963) erected Balansia sclerotica var. deformans based solely
on differences in symptomatology between B. sclerotica-infected hosts; on Cymbopogon
caesius culms bearing ascostromata were shorter than healthy culms, while infected
culms on other hosts were longer than normal. Such diversity in symptomatology
between hosts infected by N. scleroticus is discussed in length by Ryley (2003). Although
the type specimen of this taxon was not examined, the variety deformans is here
considered to be synonymous with N. scleroticus.

11. Balansia madagascariensis Vienn.-Bourg., Ann. Inst. Natl. Agron., Sér. 3, 2: 25
(1964)
SPECIMEN EXAMINED-MADAGASCAR. On Paecilostachys sp.: RANOMAFANA .1.1964 J
Bosser P (HOLOTYPE).
The stromata on the type specimen are straight, black, 2.5-4.0 x 1.0 mm, surrounding
the axillary buds on the culms. Asci (as measured by me) are 144-180 x 3-6 um, but

106

Viennot-Bourgin (1964) described the asci as being 60-90 x 6-10 um, perhaps because he
measured immature asci. No intact ascospores were seen, all having broken while being
teased from the asci. The fracturing of the ascospore to give part-ascospores is typical of
N. scleroticus, as discussed in earlier sections. The part-ascospores, 60-72 x 1.0-1.5 um,
are pointed at one end and blunt at the other, and appear to be aseptate. The septum at
the blunt end of the part-ascospores and the fracturing of the ascospores indicates that
at least the thick central septum typical of ascospores of N. scleroticus was present. In
addition, the material may not have been mature at the time of collection, and for that
reason the thin septa of the part-ascospores were not in evidence. Hyphae similar to
those found on many specimens of N. scleroticus were present on the adaxial surfaces of
the uppermost unfolding leaves, but no conidia were found on these hyphae.

Although the teleomorph of B. madagascariensis is very similar to that of N. scleroticus,
the lack of conidia on the upper leaves and the uncertainty of the ascospore septation
make the reduction of that taxon to synonymy with N. scleroticus tenuous.

12. Balansia triraphidis (herbarium name)

SPECIMENS EXAMINED-AUSTRALIA. NorTHERN TERRITORY. On Triodia bitextura
Lazarides (as Triraphis pungens R.Br. on specimen packet): 34 MILE SIDING ON NT RAILWAY
15.1.1913 GF Hill VPRI439.

Brittlebank (1940) listed Balansia sp. as a pathogen of Triraphis in his “Australian Fungi
Index’, citing the source of the record as VPRI (Pascoe, pers. comm.). The specimen
received from that herbarium had Balansia triraphidis on the packet, and despite an
intensive literature search no formal description has been found. The specimen consists
of one badly weathered, black ascostroma, 4 x 3 mm, surrounding an axillary bud.
Although the morphology of the teleomorph could not be determined, handwritten
notes in the specimen packet provide the following information: perithecia 370 x 140
um, asci 190-210 x 6 um, ascospores 8 per ascus, 96 x 1-1% um and 120 x 1-1% um,
multiseptate. Until evidence to the contrary is found, this specimen is considered to be
N. scleroticus.

Summary of the synonyms of Nigrocornus scleroticus

Nigrocornus scleroticus (Pat.) Ryley

Epichloé sclerotica Pat.

Ophiodothis sclerotica (Pat.) Henn.

= Balansia sclerotica (Pat.) Hohn.

= Parepichloé sclerotica (Pat.) J. White & P.V.Reddy
= Hypocrella axillaris Cooke

= Epichloé oplismeni Henn.

= Epichloé schumanniana Henn.

= Ophiodothis paspali Henn. (nomen nudum)

= Balansia cynodontis Syd.

= Balansia sclerotica var. deformans Govindu & Thirum.

= Balansia triraphidis (herbarium name)

¢= Epichloé volkensii Henn.

¢= Ophiodothis vorax var. paspali Henn.
¢= Ophiodothis arundinellae Henn.

°= Balansia trachypogonis Doidge

¢= Balansia madagascariensis Vienn.-Bourg.

Other specimens of Nigrocornus scleroticus examined

SPECIMENS EXAMINED-ASIA AND PACIFIC REGION: AUSTRALIA. New SouTH WALES.
On Entolasia stricta (R.Br.) Hughes: GLENBROOK 9.XII.1933 LR Fraser DAR29874; MOUNT
TOMAH 21.V.1977 C Nuzum DAR28740, 9.V1.1977 J] Walker DAR30009, 9.V1.1977 C
Nuzum DAR30011 (As Hypocrella sp. on all specimen packets). On Entolasia marginata
(R.Br.) Hughes: GLENBROOK 09.XII.1933 L Fraser DAR29874. On Oplismenus imbecillis
(R.Br.) Roem. & Schult.: MOUNT TOMAH 6.IV.1977 R Keogh DAR28742, 21.V.1977 C Nuzum
DAR28741 (As Hypocrella sp. on both specimen packets). On Triodia sp.: PILLIGA SCRUB
8.X.1918 JB Cleland DAR256 (As Epichloé typhina on specimen packet), NORTHERN
TERRITORY. On Eriachne mucronata R.Br: BICKERTON ISLAND 17.VI.1948 RL Specht
BRIP2817; CORKSCREW PASS 4.VII.1948 ST Blake BRIP2811 DAR21400 (as Balansia sp.).
On Sarga plumosum (R.Br.) R.E.Spangler [as Sorghum plumosum (R.Br.) P.Beauv.]: STUART
HIGHWAY 30 KM N DALY WATERS, 17.[II.2000 RG Shivas IT Riley C&K Vanky BRIP26983.
On Schizachyrium pachyarthron C.Gardner: FLORENCE FALLS (LITCHFIELD) 13.[II.2000 RG
Shivas BRIP27878. On Sorghum sp.: KATHERINE 17.II].2000 RG Shivas BRIP27702. On
Triodia basedowii Pritzel: FINKE R 02.IV.2002 P Latz DAR60915. On Triodia burbidgeana
S.W.L.Jacobs: PORT BRADSHAW 18.XII.1998 RG Shivas BRIP25528. On Triodia procera R.Br.:
GROOTE EYLANDT 7.V.1948 RL Specht BRIP2818. On Triodia pungens R.Br.: ULURU 26.V.1979
P Latz DAR61057. On Triodia shinzii (Henrard) Lazarides: NNW ALICE SPRINGS 26.11.2000
C&K Vanky BRIP27466. QUEENSLAND. On Bothriochloa ewartiana (Domin.) C.E.Hubb.:
KIDSTON VIII.1954 SL Everist BRIP2808 DAR 21409 (as Balansia sp.). On Chrysopogon
fallax S.T.Blake: 10 KM $ GLADSTONE 25.IV.2004 RG Shivas BRIP39883; KANGAROO HILLS
(INGHAM) 27.V.1965 IC Tommerup BRIP2809 DAR 23783 (as Balansia sp.); E MAREEBA
24.11.2005 TS Marney BRIP46794; 24 KM N MT MOLLOY 02.V.2005 TS Marney BRIP45836.
On Cymbopogon refractus (R.Br.) A.Camus: (KENMORE) BRISBANE 15.]II.1981 MJ Ryley
BRIP13388*. On Eremochloa bimaculata Hack.: GEEBUNG (BRISBANE) 05.IV.2003 RG Shivas
BRIP39619. On Entolasia stricta (R.Br.) Hughes: BRISBANE VI.1968 R Creagh BRIP2810;
CHAPEL HILL (BRISBANE) 3.1X.1980 MJ Ryley BRIP13389. On Eragrostis pubescens (R.Br.)
Steud. (as Eragrostis oxylepis Torr.): WALSH R .III.1891 T Barclay-Millar DAR69754 (see
Hypocrella axillaris above). On Panicum sp.: BEATRICE R (PALMERSTON) 9.III.1941 LG Miles
BRIP2813 DAR 21408 (as Balansia sp.). On Heteropogon contortus (L.) P.Beauv. ex Roem. &
Schult: 20 KM N GIN GIN, 25.IV.2003 MDE & RG Shivas BRIP47180. On Paspalidium
criniforme S.T.Blake: HIRSTGLEN 8.III.1979 MJ Ryley BRIP13390*, 26.VIII.1980 MJ Ryley
_ BRIP13391*, 9.1V.1981 MJ Ryley BRIP 13392, 11.1V.2003 MJ Ryley BRIP39912, .2003 MJ
Ryley BRIP45139. On ? Paspalidium distans (Trin.) Hughes: JULATTEN 30.IV.1987 JL Alcorn
BRIP15816. On Paspalum scrobiculatum L.: MT COTTON (BRISBANE) 6.1.1980 MJ Ryley
BRIP13393*, 4.11.1981 MJ Ryley BRIP13394. On Paspalidium sp.: MAREEBA WETLANDS
(NEAR MAREEBA) 01.V.2004 MDE Shivas BRIP44114. On Sarga leiocladum (Hack.)
R.E.Spangler [as Sorghum leiocladum (Hack.) C.E.Hubb.]: BLACKBUTT CK (BLACKBUTT)
1.IV.1979 MJ Ryley BRIP13399; cooyaR 1.1V.1979 MJ Ryley BRIP 13400*, 2.1I1.1991 M
Ryley BRIP17463; CROWS NEST 22.[X.1977 MJ Ryley BRIP13396; HIRSTGLEN 9.[X.1977 MJ
Ryley BRIP13395, 19.XII.1977 RF Langdon IMI 224366, 10.X1.1978 MJ Ryley BRIP13398,

107

108

29.X1.1979 MJ Ryley BRIP13401, 28.111.1980 MJ Ryley BRIP 13403*, 9.IV.1981, MJ Ryley
BRIP 13404*; KENMORE (BRISBANE) EX HIRSTGLEN 1.1X.1977 MJ Ryley BRIP 15373; J
BJELKE-PETERSEN RESEARCH STATION (KINGAROY) 7.XII.2000 M Ryley BRIP27613;
MAIDENWELL 13.XII.2000 RG Shivas MJ Ryley BRIP27596; MAPLETON 6.X1.1978 MJ Ryley
BRIP13397; sT LUCIA (BRISBANE) EX HIRSTGLEN 27.II].1980 MJ Ryley BRIP13402*. On
Sarga plumosum (R.Br.) R.E.Spangler [as Sorghum plumosum (R.Br.) P.Beauv.]: ATHERTON
IV.1960 G Keefer BRIP2815 DAR 21411 (as Balansia sp.). On Themeda triandra Forssk. [as
Themeda australis (R.Br.) Stapf]: BULLERINGA NEAR CHILLAGOE 24.V.2002 PR Trevorrow
PR O'Keefe BRIP29111; MT NEBO 10.1I.1981 MJ Ryley BRIP13405*; MT TAMBORINE
21.1V.1962 DK Campbell BRIP2816 DAR 21412 (as Balansia sp.). On Triodia sp.: 266 KM N
CHARTERS TOWERS .V.2004 TS Marney BRIP44584; 40 KM W OF JERICHO 24.112004 DR
Beasley BRIP43737; TORRENS CK 26.]II.1980 P Curran BRIP13406. On ? Bothriochloa sp.:
150 KM NW CHARTERS TOWERS .IV.1989 J&O Matthews BRIP16640*. On unknown hosts:
241 KM N CHARTERS TOWERS 06.V.2004 TS Marney BRIP44582; MUSGRAVE 15.VII.1999 M
Gunther BRIP26753; RIFLE CK (NEAR MT MOLLOY) 30.IV.1987 JL Alcorn BRIP15784.
WESTERN AUSTRALIA. On Sarga timorense (Kunth.) R.E.Spangler [as Sorghum stipoideum
(Ewart & White) Gardner & C.E.Hubb.]: POINT SPRINGS (NEAR KUNUNURRA) 8.X.1996 AA
Mitchell BRIP27800, AA Mitchell BRIP28853. On Triodia bynoei (C.E.Hubb.) Lazarides:
MITCHELL PLATEAU 10.11.1986 R Shivas PERTH741884. On Triodia epactia S.W.L.Jacobs:
ONSLO(W) 18.V.1997 AA Mitchell BRIP27802. On Triodia sp.: BEAGLE BAY 1.III.2001 AA
Mitchell BRIP39323; KARYINI 11.VIIL2005 MJ Ryley BRIP46838, KARRATHA 09.VIII.2005
MJ Ryley BRIP46839; OOGALANOONGOO 3.VI.1996 AA Mitchell BRIP27801. CHINA.
YUNNAN. On Andropogon sp.: .1919 AV Brooks IMI182686*. On Pogantherum crinitum
(Thunb.) Kunth [as Pogantherum paniceum (Lam.) Hack.]: TENGUYEH .X.1919 G Forrest
IMI4388 ex G. Forrest No. 18549. JAPAN. On Paspalum thunbergii Kunth ex Steud.:
SHIZOUKA 18.X.1921 K Hara IMI4367 IMI22213 ex Sydow Fungi exotici exsiccata* (as
Ophiodothis vorax var. paspali on specimen packet). NEW GUINEA. On Themeda triandra
Forssk. [as Themeda australis (R.Br.) Stapf]: DARU ISLAND 5.V1.1957 F Kleckham IMI74093.
TONGA. On Cyrtocorrum oxyphyllum (Hochst. ex Steud.) Stapf: WA Sykes PDD47078*.
INDIAN SUBCONTINENT. INDIA. On Andropogon sp.: DHERWAR .X1.1964 VS Seshadri
IMI116178*; NAGPUR 1.X.1922 RM Pearl JARI21105. On Brachiaria distachya (L.) Stapf: Ex
BANARAS HINDU UNIVERSITY .[X.1962 RA Singh IMI123625*. On Cymbopogon martinii
(Roxb.) J. Watson: EX URKRAM UNIVERSITY (UJJAIN) 27.11.1979 BS Sharma IMI235875*.
On Dichanthium caricosum (L.) A.Camus: EX BANARAS HINDU UNIVERSITY .X.1965 RA
Singh IMI123626*. On Digitaria biformis Willd.: EX BANARAS HINDU UNIVERSITY .[X.1963
RA Singh IMI123627*. On Ischaemum sp.: MUNNAR KERALA DISTRICT 17.1.1965 T
Raghunatti IMJ116179*. On Setaria pumila sub sp. pallide-fusca (Schum.) B.K.Simon [as
Setaria pallide-fusca (Schum.) Stapf & C.E.Hubb.]: EX BANARAS HINDU UNIVERSITY .IX.1963
RA Singh IMI123629. On Themeda sp.: ORISSA 3.[X.1949 HF Mooney IMI44594*. AFRICA:
GHANA (AS GOLD COAST COLONY). On Anadelphia sp.: AyiKUMA 2.VI1.1949 GJ
Hughes IMI46347*. MALAWI (AS NYASALAND ON SOME). On Hyparrhenia dissoluta
(Nees) C.E.Hubb.: NENO 2.VII.1949 PJ Wuhl? IMI38763; zomBa 7.V.1949 PJ Wuhl?
IMI35550*. On Hyparrhenia sp.: LILONGWE 11.II1.1964 DCM Corbett IMI114417*; ZOMBA
19.111.1927 EJ Rutter? IMI75064*. NIGERIA. On Andropogon sp.: OYO PROVINCE 6.VI.1954
RM Jarbron? IMI56874*. SIERRA LEONE. On Andropogon gabonensis Stapf: NEWTON
6.VIII.1939 FC Deighton IMI4385*. On Andropogon tectorum Schum. & Thonn.: NEWTON
6.VIIL.1939 FC Deighton IMI 4384*; HILL STATION 27.VII.1941 FC Deighton IMI10965*;
KEINADUGU DISTRICT .VIII.1963 H Mead IMI112570*; MusatA 1.VII.1948 FC Deighton
IMI32562*; REGENT 11.VIII.1955 CT Pyle IMI61714*; RoKUPR 25.VII.1939 FC Deighton
IMI4383*. On Oplismenus hirtellus (L.) P.Beauv.: KORTRIGHT 17.VIII.1958 FA Melville & T

109

Horker IMI77026; NJALA 18.VII.1927 FC Deighton IMI4607 * (As Epichloé oplismeni on
both specimen packets). TANZANIA. On ?¢ Hyparrhenia sp.: PONGWE TANGA .IV.1970 DJ
Allen IM1I158973*. ZAMBIA (AS NORTHERN RHODESIA ON SOME). On Diheteropogon
amplectens (Nees) W.D.Clayt. (as Andropogon amplectens Nees): CHILANGA 4.III.1963 A
Angus IMI112416*; KAFUE GAME RESERVE 27.IV.1962 A Angus IMI100139; KASAMA
24.11.1960 A Angus IMI1 19807. On Digitaria sp.: MAZABUKA 2.1V.1962 A Angus IMI100111.
ZIMBABWE (AS RHODESIA ON IMI 182949). On Cynodon dactylon (L.) Pers.: MATOPOS
RESEARCH STATION .II.2002 DA Frederickson BRIP39212*. On Setaria pumila sub sp.
pallide-fusca (Schum.) B.K.Simon [as Setaria pallide-fusca (Schum.) Stapf & C.E.Hubb.]:
QUE QUE 19.1.1974 A Rothwell IMI182949. UNKNOWN. On Brachiaria distachya (L.)
Stapf: IMI 4387.

On these specimens the ascostromata are black, corniform, curved or straight, papillate,
and variable in length and width (Figs. 1B-E). At one extreme are ascostromata on
Themeda triandra (IMI74093) which measure 15-17 x 3-4 mm and at the other are
those on Oplismenus hirtellus (IMI4607), being 2-3 x 1.0-1.5 mm. For most specimens
the length:width ratio of ascostromata is >2:1, but on the specimens of Triodia species
collected in Australia the ratio is very close to 1:1. The characteristics of the perithecia,
asci and ascospores on ascostromata which could be examined are, in most cases,
identical to those of the corresponding characteristics of the type specimen. For
three specimens, IM1I4367, IMI22213 (both on Paspalum thunbergii from Japan), and
IMI114417 (on Hyparrhenia sp. from Malawi), the ranges of ascospore length (160-280
um) are different to that of the type specimen (140-220 um). A dried hyphal matrix was
found covering the abaxial surfaces of the uppermost leaves on most specimens (Fig.
1F), and on some of these (marked * in the specimen list above) there were conidia
identical in all respects to those found in the hyphal matrix on the type specimen.

Other specimens received as Balansia sclerotica

A number of specimens received as Balansia sclerotica from IMI were not conspecific
with N. scleroticus. Specimens IMI4449, IMI4478, and IMI4481 were prepared slides
consisting of transverse sections of immature ascostromata with characteristics similar
to N. scleroticus. The specimen packet of IMI4478 indicates that the slide was made
from specimen number 18549 of the collection of George Forrest; ascostromata of that
specimen are deposited as IM14388 (see specimen list above). IMI118290 and IMI138634
were dried cultures from which conidia, 13-15 x 1.0-1.5 um and with characteristics
similar to those of the anamorph of N. scleroticus, were gathered. IMI112156 consists
of a conidiostroma of Ephelis sp. IMI75075 is a smut fungus, while the other three
(IMI48964, IMI48969 and IMI98181), all collected on Panicum congoense Franch. from
western Africa, have characteristics typical of Parepichloé cinerea (Berk. & Broome) J.E.
White & P.V. Reddy (1998).

_ SPECIMENS EXAMINED-CHINA. YUNNAN PROVINCE. On Pogantherum crinitum (Thunb.)
Kunth [as Pogantherum paniceum (Lam.) Hack.]: .1917-1919 IMI4478 ex G. Forrest No.
18549. INDIA. On Cymbopogon martinii (Roxb.) J.E Watson: 20.IV.1966 MJ Thirumalachar
IMI118290. On unidentified host: POONA MJ Thirumalachar IMI138634. MALAYSIA. On
Brachiaria mutica (Forssk.) Stapf: SELANGOR .1897 Ridley IMI4481 (As Epichloé volkensii on
specimen packet). NEW GUINEA. On Digitaria smutsii Stent: AtyuURA 19.11.1965 D Petty
IMI112156. REPUBLIC OF GUINEA. On Panicum congoense Franch.: PELLEL KOURA

110

6.X1.1962 P Adames IMI98181. SIERRA LEONE. On Panicum congoense Franch.: GHAP?
12.X.1951, HD Jordan IMI48964, KASANKO 24.X.1951 HD Jordan IMI48969. THAILAND
(AS SIAM). On Cymbopogon nardus (L.) Rendle: 3.VIII.1925 Garret IM14449. UGANDA.
On Hyparrhenia cymbaria Stapf: KAWANDA .VI.1944 CG Hansford IMI75075.

Hypocrealean fungi associated with Nigrocornus ascostromata

1. Nectriella balansiae R.H.Arnold, Mycologia 59: 248 (1967)

SPECIMENS EXAMINED-AUSTRALIA. QUEENSLAND. On ascostromata of Nigrocornus
scleroticus: KENMORE (BRISBANE) 15.III.1981 MJ Ryley BRIP13495 (On Cymbopogon
refractus). CONGO. On ascostromata of Nigrocornus scleroticus: 15.X1.1891 J. Dybowski (as
Hyalodothis clavus: HOLOTYPE F 6844 ex Patouillard Herb. 597) (grass host unknown).

Hyalodothis Pat. & Har. was described by Patouillard & Hariot (1893) with H. clavus Pat. &
Har. as the type, and only, species. Diehl (1950) examined the type specimen of H. clavus
and considered it to be “a species of Balansia identical with the African Epichloé volkensii P.
Henn.” As a consequence he reduced Hyalodothis to synonymy with Balansia. Later, Arnold
(1967) examined the type specimen of H. clavus and found small (100-165 x 60-100 um),
spherical-ovoid perithecia immersed in the ascostromata, where they were scattered
between those of the Balansia species. She also rejected Hyalodothis and H. clavus on the
grounds that the original descriptions included elements of Balansia volkensii and another
fungus, and named the latter Nectriella balansiae R.H.Arnold, without describing an
anamorph. Rossman et al., (1999) re-examined the type specimen and confirmed
Arnold’s description, with only minor modifications. During this study, perithecia
which matched the description of N. balansiae were found in ascostromata on the type
specimen of H. clavus and on an Australian specimen of N. scleroticus (BRIP13495), but
no mature asci or ascospores were found in either.

Until evidence to the contrary is found, the Australian specimen is designated as
Nectriella balansiae.

2. Bionectria sp.

SPECIMENS EXAMINED-AUSTRALIA. New SouTH WALES. On ascostromata of
Nigrocornus scleroticus (all as Hypocrella axillaris): MOUNT TOMAH 21.V.1977 C Nuzum
DAR28740 (On Entolasia stricta), 9.V1.1977 J Walker DAR30009 (On Entolasia stricta),
9.V1.1977, C Nuzum DAR 30011 (On Entolasia stricta), 6.1V.1977 R Keogh DAR28742 (On
Oplismenus imbecillis), 21.V.1977 C Nuzum DAR28741 (On Oplismenus imbecillis).

Walker (from annotations, slides and cultures in specimen packets) found light yellow,
raised, solitary or gregarious, dome-shaped perithecia of a Nectria-like species on some
Nigrocornus ascostromata on the specimens listed above. On all of these specimens except
DAR30011 he also found the sporodochia of a fungus which he ascribed to Myrothecium
Tode. My examination of the specimens showed that the conidia of the latter fungus are
hyaline, thin-walled, aseptate, ellipsoidal, straight or slightly curved, with a distinctive
hilum and 10-15 x 2.2-2.5 um. The conidiophores are penicillate with two phialides
arising from the supporting cell, each phialide being 3-4 um wide at the widest point,
narrowing to approx. 2 um at the tip. On a 1-month-old culture of DAR28741(b) there
are discrete, raised sporodochia with a dark green spore mass. The conidia are more
variable than those on the host tissue, being cylindrical-ovate, 10-15 x 3-4 um, but with

111

a prominent protruding hilum. The asci in the Nectria-like perithecia are clavate, thin-
walled, unitunicate, and lack any apparent apical thickening. There were 8 ascospores
‘per ascus, the ascospores being hyaline, thin- and smooth-walled, 1-septate, fusiform,
10-15 x 2.5-3 um, and with a slight constriction at the septum of some.

The orange perithecia place this fungus in the Bionectriaceae rather than in the
Nectriaceae, where it is most closely aligned with Bionectria Speg. (Schroers, 2001), and its
anamorph has characteristics which would place it in Clonostachys Corda, the anamorph
of Bionectria. This fungus closely resembles Bionectria epichloé (Speg.) Schroers [syn.
Nectriopsis epichloé (Speg.) Samuels], which has been found on the stromata of species
of Epichloé and Balansia in the Americas (Samuels, 1988; Schroers, 2001). However,
although the dimensions of the ascospores in the Australian specimens lie within the
ranges for those of N. epichloé, its conidia are longer than those provided in Samuels’
and Schroer’s descriptions (5-8 x 2.5-5 um and 4.8-9.6 x 2.2-3.6 um, respectively).
Nectriopsis macroepichloé Samuels was described as colonising ascostromata of
Balansia cyperacearum (Berk. & M.A. Curtis) Diehl in Venezuela, but its ascospores are
considerably longer than those of B. epichloé and the Bionectria species on N. scleroticus
ascostromata (Samuels, 1988). It is possible that the specimens of Bionectria found on
some ascostromata of N. scleroticus in Australia represent a new species.

Acknowledgments
I thank Dr Ray Langdon, former Reader in Botany, University of Queensland, for his guidance
and patience during my postgraduate studies, and for his esteemed and enduring friendship since
then. I also thank the curators of herbaria for loans of type and other specimens listed in this
paper. Thanks also to Dr Michael Priest, Dr Ian Pascoe, and Dr Shaun Pennycook for reviewing
this paper.

Literature Cited

Arnold RH. 1967. The Nectriella element of “Hyalodothis. Mycologia 59: 246-254.

Bailey FM. 1891. Contributions to the Queensland flora. Bot. Bull. Dep. Agric Qd 3.

Bailey FM. 1913. Comprehensive Catalogue of Queensland Plants. Government Printer, Brisbane.

Berkeley MJ, Curtis, MA. 1883. Sylloge Fungorum 2: 652.

Bischoff J.E, White JF Jr. 2003. The Plant-infecting Clavicipitaleans. In Clavicipitalean Fungi:
Evolutionary Biology, Chemistry, Biocontrol, and Cultural Impacts (Eds. J White Jr, CW Bacon,
NL Hywel-Jones, JW Spatafora), pp. 125-149. Marcel Dekker Inc., New York NY, USA.

Bresadola G, Saccardo PA. 1899. Fungi Congoenses enumerati I. Bull. Soc. Roy. Bot. Belg. 38: 161.

Brittlebank CC. 1940. The Brittlebank Catalogue of Fungi and Bacteria Causing Plant Diseases in
Australia (unpublished, held in the National Herbarium of Victoria).

Castellani E, Ciferri R. 1937. Prod. Mycofl. Afr. Or. Ist. Agr. Coloniale Italiano, Firenze.

Cooke MC. 1892. Australian fungi. Grevillea 20: 4-7.

Diehl WW. 1950. Balansia and the Balansiae in America. Agriculture Monograph No. 4. United States
Department of Agriculture, Washington DC.

Doidge EM. 1948. South African ascomycetes in the national herbarium. Part 4. Bothalia 4: 837-880.

Govindu HC, Thirumalachar MJ. 1963. Studies on some species of Ephelis and Balansia occurring in
India. II Morphological and taxonomic status of Balansia. Mycopathol. Mycol. Appl. 20: 297-306.

Hennings P. 1895a. Fungi kamerunenses I. Bot. Jahrb. Syst. 22: 72-111.

Hennings P. 1895b. Pilze Ostafrikas in Deutsch-Ost Afrika. Band II. In Pflanzenw. Ost-Afrikas (Ed. A.
Engler), Teil C, pp. 30-35. D. Reimer, Berlin.

Hennings P. 1900. Fungi in Zahlbriickner plantae pentherianae. Ann. Naturhist. Mus. Wien 15: 1-3.

Hennings P. 1901. Fungi japonici. Bot. Jahrb. Syst. 28: 274-275.

Hennings P. 1906. Fungi japonici VI. Bot. Jahrb. Syst. 37: 162.

Hodge KT. 2003. Clavicipitaceous anamorphs. In Clavicipitalean Fungi: Evolutionary Biology,
Chemistry, Biocontrol, and Cultural Impacts (eds J White Jr, CW Bacon, NL Hywel-Jones, JW
Spatafora), pp. 75-123. Marcel Dekker Inc., New York NY, USA. .

Hohnel F Von. 1910. Fragmente zur Mykologie No. 630. Kaiserl. Akad. Wiss., Math.-Naturwiss. K1.,
Abt. 1, 119: 57-65.

Hohnel F Von 1911. Fragmente zur Mykologie No. 704. Sitzungsber. Kaiserl. Akad. Wiss., Math.-
Naturwiss. K]., Abt. 1, 120: 449.

Luttrell ES, Bacon CW. 1977. Classification of Myriogenospora in the Clavicipitaceae. Can. J. Bot.
55: 2090-2097.

Massee G. 1896. New or critical fungi. J. Bot. 34: 145-154.

Palmer J, Lazarides M, McCusker A, Weiller CM. 2005. Eragrostis. In Flora of Australia Vol. 44B
Poaceae 3 (ed K Mallett), pp. 346-409. ABRS/CSIRO Publishing, Melbourne, Australia.

Patouillard N. 1890. Contribution a la flore mycologique du Tonkin. VI. Pyrenomycetes. J. Bot.
(Morot) 4: 61-67.

Patouillard N, Hariot P. 1893. Fungos aliquot novos in regione congoana collectos. Bull. Soc. mycol.
Fr. 9: 206-211.

Petch T. 1916. Revisions of Ceylon fungi (Part IV). Ann. Roy. Bot. Gard. (Peradeniya) 6: 153-183.

Roger L. 1953. Phytopathologie des pays chauds. Tome II. Etude descriptive des Maladies parasitaires
des plantes des pays chauds. Hypocréacées genre Balansia Speg. Encycl. mycol. 18: 1537.

Rossman A, Samuels GJ, Rogerson CT, Lowen R. 1999. Genera of Bionectriaceae, Hypocreaceae
and Nectriaceae (Hypocreales, Ascomycetes). Studies in Mycology 42. Centraalbureau voor
Schimmelcultures, Baarn/Delft, The Netherlands.

Ryley MJ. 2003. Nigrocornus scleroticus, a common Old World balansioid fungus. In Clavicipitalean
Fungi: Evolutionary Biology, Chemistry, Biocontrol, and Cultural Impacts (eds J White Jr, CW
Bacon, NL Hywel-Jones, JW Spatafora), pp. 247-271. Marcel Dekker Inc., New York NY, USA.

Samuels GJ. 1988. Fungicolous, Lichenicolous, and Myxomyceticolous Species of Hypocreopsis,
Nectriopsis, Nectria, Peristomialis, and Trichonectria. Mem. New York Bot. Grdn. 48. Bronx, New
York Botanical Garden.

Schroers H-J. 2001. A Monograph of Bionectria (Ascomycota, Hypocreales, Bionectriaceae) and its
Clonostachys anamorph. Studies in Mycology 46. Centraalbureau voor Schimmelcultures, Utrecht,
The Netherlands.

Sydow H Von. 1935. Beschreibungen neuer sudafrikanischer pilze VI. Annls mycol. 33: 230-237.

Viennot-Bourgin G. 1964. Etude de micromycétes parasites récoltés a Madagascar, 3° Ascomycetes et
Imperfecti. Balansia madagascariensis n.sp. Annls Inst. natn. agron., Paris, Ser. 2, 2: 16-25.

White JF Jr. 1997. Systematics of the graminicolous clavicipitaceae. In Neotyphodium/Grass
Interactions (eds CW Bacon, NS Hill), pp. 27-39. Plenum Press, New York.

White JF Jr, Reddy PV. 1998. Examination of structure and molecular genetic phylogenetic
relationships of some graminicolous symbionts in genera Epichloé and Parepichloé. Mycologia
90: 226-234.

MYCOTAXON

Volume 95, pp. 113-116 January-March 2006

Rick’s species revision:
Mitremyces zanchianus versus Calostoma zanchianum

TuRI G. BASEIA’?, VAGNER G. CORTEZ” & FRANCISCO D.CALONGE?

baseia@cb.ufrn.br
‘Universidade Federal do Rio Grande do Norte, CB
Depto. Botanica, Ecologia e Zoologia, 59072-970, Natal, RN, Brazil

cortezvg@yahoo.com.br
*Universidade Federal do Rio Grande do Sul
Depto. Botanica, 91501-970, Porto Alegre, RS, Brazil

calonge@ma-rjb.csic.es
3Real Jardin Botanico, CSIC
Plaza de Murillo 2, 28014 Madrid, Spain

Abstract — After the revision of Mitremyces zanchianus we confirm this species
as a valid name in the Sclerodermataceae and propose a new combination to the
genus Calostoma. Description and illustrations of the type and SEM images of the
basidiospores are given.

Key words — Agaricomycetidae, Sclerodermataceae, Gasteromycetes, taxonomy,
neotropics

Introduction

The role played by Rick in the development of Brazilian mycology is not measured by
his numerous works alone (for a full list see Fidalgo, 1962), but by his collaboration with
foreign mycologists (e.g. Lloyd, Rehm, Bresadola, Sydow), which furthered the study the
Brazilian fungi. In addition, it is worth emphasizing that Rick influenced and encouraged
fellow mycologists, such as Theissen and Torrend (Fidalgo 1962). A representative part
of the Rick’s collection in Brazil is preserved in the Herbarium Anchieta (PACA), located
in the State of Rio Grande do Sul.

The genus Calostoma, which was established by Desvaux in 1809, has priority over
Mitremyces, a synonym erected by Nees in 1817. According to Kirketal. (2001), Calostoma
comprises about 15 species and is currently included in the family Sclerodermataceae
Corda (= Calostomaceae E. Fisch.). Calostoma species are characterized by the pseudo-
stipitate basidioma with a peridium composed of two to four layers and opening by only
one apical star-like pore, and basidiospores that are globose to elliptic with reticulate or
pitted ornamentation (Miller & Miller 1988).

At present, no representatives of the Calostoma have been reported for Brazil except
for Mitremyces zanchianus, a rare species described by Rick (1961, but see comments

114

below). Our primary goal is to determine whether Rick’s species should be placed in
Calostoma.

Materials and methods

Macroscopic characters were examined following usual techniques utilized in
taxonomic studies of gasteroid fungi including a detailed description from the fresh
specimen. Microscopic characters were determined according to Miller & Miller (1988).
Basidiospores were examined using a Philips XL20 Scanning Electron Microscope
(SEM).

Results

Calostoma zanchianum (Rick) Baseia & Calonge, nov. comb. Figs. 1-3
Basionym: Mitremyces zanchianus Rick in Iheringia Sér. Bot..9: 456, 1961.

Basidiomata stalked, head egg-shaped, 1.3 cm long, 1 cm broad; exoperidium white
silky, rather thick, gelatinous, rugose surface ruptured by the growth of fruitbody.
Endoperidium pinkish white, cartilaginous, smooth. Mouth regularly star-shaped
consisting of 4 long slits, splitting at maturity; stalk strongly dilated, subglobose, 1.2 cm
long, 1.3 cm broad. Spores 30-35 x 15-20 um, fusiform to elliptic, smooth, colourless to
pale yellowish, provided with a longitudinal groove.

MATERIAL EXAMINED ~ Holotypus of Herbarium Anchieta (PACA 19.673), collected
by Father Rémulo Zanchi in March 1943 from the current municipality of Sao Joao
do Polesine (formerly Polesine, municipality of Cachoeira do Sul, as indicated in the
herbarium notes), central part of Rio Grande do Sul State, Brazil.

Fig. 1 Calostoma zanchianum (holotypus) a: Mature basidioma. b: Top view

115

Fig. 2-3: Calostoma zanchianum (holotypus). Basidiospores under SEM

116

Discussion

This species is easily recognized by several distinct characters: a stalk strongly dilated at
the base, a mouth consisting of four long slits, and elliptic to fusiform basidiospores with
a longitudinal groove. Those singular characters separate Calostoma zanchianum from
other Calostoma species. This taxon also has some interesting ecological data: Zanchi’s
notes cite that it was found growing on roots of an unknown native tree.

In fact, Rick himself never published the collection as a new species. The species
was published in a posthumous series (i.e., Basidiomycetes Eubasidii in Rio Grande do
Sul - Brasilia) by Father Balduino Rambo, another noteworthy botanist who compiled
all fungi studied and collected by Rick, including several non-published taxa. Thus,
Mitremyces zanchianus was only validly published 15 years after Rick’s death in 1946.

Unfortunately, the only known material of this species is the holotype. Efforts are
underway to collect new material so as to document the morphological variation and
biology of this unusual species.

Acknowledgments
We express our sincere gratitude to the curator of Anchieta Herbarium (PACA) for the loaned
material. Thanks are also given to the Conselho Nacional de Desenvolvimento Cientifico
e Tecnoldgico (CNPq) for financial support; and to Tereza Cristina de Oliveira Galvao for the
illustrations. We are grateful to Prof. H. Kreisel, Prof. G. Moreno and Dr. P. M. Kirk for the critical
revision of the manuscript and checking of the English text.

References

Desvaux NA. 1809. Observations sur quelques genres a établir dans la famille dés Champignons.
Journal de Botanique 2: 38-105.

Fidalgo O. 1962. Rick, o Pai da Micologia Brasileira. Rickia 1: 3-11.

Kirk PM, Cannon PF, David JC, Stalpers JA. 2001. Ainsworth & Bisby’s Dictionary of the Fungi.
9 ed. CABI Int. Publ., UK,

Miller OK, Miller HH. 1988. Gasteromycetes: Morphology and Developmental Features. Mad
River, Eureka, CA, 156 pp.

Nees v. Essenbeck CG. 1817. Das System der Pilze und Schwamme. Wiirzburg, p. 136.

Rick J. 1961. Basidiomycetes Eubasidii in Rio Grande do Sul. Iheringia, Ser. Bot. 9: 451-490.

MY COTAXON

Volume 95, pp. 117-131 January-March 2006

Taxonomic studies on Indian Phellinus s.|. species:
parsimony analysis using morphological characters

PRASAD LAMROOD

pylamrood@yahoo.com
Department of Botany, Modern College
Ganeshkhind, Pune - 411 053, Maharashtra, India

ARISTOTELES GOES-NETO

agoesnt@uefs.br
Laboratorio de Pesquisa em Microbiologia (LAPEM),
Depto. de Ciéncias Biologicas, Universidade Estadual de Feira de Santana (UEFS)
Km 3, BR-116 (norte), Feira de Santana, Bahia, 44.031-460, Brazil

Abstract — Parsimony analysis of Indian Phellinus s.l. species based on basidiomata
morphological characters was carried out. Fifty-four samples belonging to 23 species
collected from different hosts were used. Trees were produced using parsimony analysis,
heuristics search with random taxon addition sequences, tree-bisection-reconnection
branch swapping without topological constraints. Out of 84 morphological characters
used in the present analysis, 35 characters were binary and 49 were multistate and
treated as non-additive. Parsimony analysis revealed that most of the studied specimens
could be assigned to P. rimosus complex (Fulvifomes), PB. pini complex (Porodaedalea),
and P. igniarius complex (Phellinus s.s.).

Key words — basidiomata morphology, cladistic analysis, Hymenochaetaceae, South
Asia, tropical rain forest

Introduction

The circumscription of genera in the Hymenochaetaceae is imprecise, even in the field
of traditional systematics (Corner, 1991). The same situation occurs at generic level,
notably in Phellinus Quél., which accounts for more than half of the total number of
species of Hymenochaetales. The genus Phellinus includes several species complexes,
and is generally regarded as polyphyletic (Ryvarden 1991, Fischer 1996ab, Wagner &
Fischer 2002). Phellinus s.l. is worldwide in distribution (Lloyd 1915, Bondarzew 1953,
Overholts 1929, 1953, Lowe 1957, Cunningham 1965, Fidalgo 1968, Niemela 1972,
Ryvarden 1972, Donk 1974, Gilbertson & Ryvarden 1987, Rajchenberg 1989, Larsen &
Cobb-Poulle 1990). A survey of the world taxa of Phellinus resulted in the recognition
of 154 species and 67 forms and varieties (Larsen & Cobb-Poulle 1990, Rabba 1994,
Fischer 1996ab).

118

Species of Phellinus are parasitic, perthophytic and/or saprobic causing white rot that
degrades both lignin and cellulose (Rabba 1994, Vaidya 1995, Fischer 1996ab). They
dwell on a wide variety of angiosperms and/or gymnosperms (Wagner & Fischer 2002)
causing heart rot disease in live standing trees. Besides being a wood decaying fungus,
Phellinus serves as a medicine in the western part of India (Vaidya & Bhor 1991, Vaidya
& Rabba 1993, Vaidya & Lamrood 2000) and also in traditional Chinese and Korean
medicine (Mizuno 2000, Smith et al. 2002).

Species are characterized by poroid basidiomata with variable shape that even
between closely related species may range from resupinate, effused-reflexed, pileate,
and substipitate to stipitate (Wagner & Fischer 2002). The generic concepts of Phellinus
and its closest relative Inonotus P. Karst. have been traditionally based on mitism of the
hyphal system and consistency of the fruit body (i.e. Phellinus: dimitic and perennial;
Inonotus: monomitic and annual) but this has been repeatedly demonstrated as artificial
(Fiasson & Niemela 1984, Corner 1991, Dai 1999, Fischer 1996ab, Wagner & Fischer
2002), and inconsistent in Phellinus (Fischer 1996ab). In several taxa, the dimitic hyphal
system is vague or lacking, e.g. members of P. robustus complex and P. sulphurascens Pilat
(Fischer 1996b). Intermediate forms occur as in P discipes (Berk.) Ryvarden, P. erectus
A. David et al., and P. gilvus (Schwein.) Pat., in which the fruit bodies are annual and
have dimitic hyphal system. On the other hand, species like P pachyphloeus (Pat.) Pat.,
P. poeltii Ryvarden, P. robustus (P. Karst.) Bourdot & Galzin and P. sulphurascens have
perennial fruit bodies but have monomitic hyphal system or show transitions between
monomitic and dimitic hyphal systems (Domanski et al. 1973, Jahn 1981, Fiasson &
Niemela 1984, Corner 1991, Ryvarden & Gilbertson 1994, Wagner & Fischer 2002).

Extensive studies on the occurrence and systematics of Phellinus have been carried
out for European and North American taxa (Jahn 1981, Ryvarden 1978, Fiasson &
Niemela 1984, Jiilich 1984, Gilbertson & Ryvarden, 1986, 1987, Ryvarden & Gilbertson,
1994). As stated by numerous authors (Bondarzew 1953, Niemela 1972, 1975, Domanski
et al. 1973, Kotlaba & Pouzar 1978, Ryvarden 1978, Fiasson & Niemela 1984, Parmasto
1988, Ryvarden & Gilbertson 1994, Fischer 1996b) the European taxa of Phellinus can be
divided into a number of groups. Besides the type species, Phellinus contains a varying
number of closely related taxa, which, in many cases, were originally considered as
varieties or forms of the type species. The species complexes that are recognized for
Europe are: P igniarius complex, P pini complex (Fischer 1996ab), and P. robustus
complex. Three additional groups with P ferrugineofuscus (P. Karst.) Bourdot & Galzin,
P. ferruginosus (Schrad.) Pat., and P. rimosus (Berk.) Pilat are also recognized (Fischer
1996b). The P igniarius and P. robustus complexes are also mentioned for North America
(Gilbertson 1979).

Numerous characters from morphology, anatomy, sexuality, nuclear behaviour,
pigmentation and ecology would suggest that Phellinus is heterogeneous (Fiasson 1982,
Fiasson & Niemela 1984, Dai 1999, Fischer 1996b). Because of the uncertainty of the
concept of Phellinus, as well as recognized divergences within the genus, the species
complexes have repeatedly been acknowledged as separate genera. Based upon the
examination of mostly North American and European collections, several attempts
were made to split Phellinus into smaller, more natural genera. As a result Phellinus s.1.
comprises numerous generic notions (Fiasson & Niemela 1984, Wagner & Fischer 2002)

119

made up of Fomitiporella Murrill, Fomitiporia Murrill, Fulvifomes Murrill, Fuscoporella
Murrill, Fuscoporia Murrill, Ochroporus J. Schrot., Phaeoporus J. Schrét., Phellinidium
(Kotl.) Fiasson & Niemela, Phellopilus Niemela et al., Phylloporia Murrill, Porodaedalea
Murrill, Pseudofomes Lazaro Ibiza, Pyropolyporus Murrill, and Scalaria Lazaro Ibiza
(Wagner & Fischer 2002).

The comprehensive study of Fiasson & Niemela (1984) was mostly based on
morphology, anatomy, pigmentation, protein pattern, cultural type and nuclear
behaviour. Based on the characters derived from this study, Fiasson & Niemela (1984)
revised the taxonomy of the European poroid Hymenchaetales and proposed to split the
Hymenchaetales into two families, Phellinaceae, composed of Fomitiporia, Fulvifomes,
Fuscoporia, Inonotopsis Parmasto, Ochroporus, Onnia P. Karst., Phellinidium, Phellinus
s.s., and Porodaedalea, and a newly described Inonotaceae, composed of Inonotus s.s.,
Inocutis Fiasson & Niemela, and Phylloporia (Wagner & Fischer 2002). Since the study
of Fiasson & Niemela was mostly based on European material, neglecting the numerous
tropical species, this suggested splitting concept was not followed subsequently
(Gilbertson & Ryvarden 1986, 1987, Parmasto 1988, Larsen & Cobb-Poulle 1990,
Ryvarden & Gilbertson 1994). The generic splitting has been accepted in only a few
studies such as Nuss (1986) and Hansen & Knudsen (1997). Dai (1999) also accepted
genera like Fomitiporia and Phellinidium but granted subgeneric level to Fulvifomes,
Fuscoporia, Phellinidiopsis, Phellinus s.s., and Porodaedalea (Wagner & Fischer 2002).

As extensive phylogenetic data are still missing for non-European taxa, which make
up approximately two thirds of the presently known species, the generic concept of
Phellinus is mostly based on the European taxa (Wagner & Fischer 2002). However,
fragmentary work has been done in India, mainly pertaining to Himalaya and a few
parts of the central Peninsula (Bagchee & Bakshi 1950, Bagchee 1961, Singh 1966, Bakshi
1958, 1971, Thind & Chatrath 1957, Thind & Dhanda 1980, Roy 1979, Tiwari et al. 1989,
Sharma, 1993), as well as in southern parts (Ganesh & Leelavathy 1986, Natarajan &
Kolanduvelu 1985). The most comprehensive account on this genus in Maharashtra is
the work of Rabba (1994). Before Rabba (1994) and Rabba et al. (1994) only nine species
were known from Maharashtra and 50 species from India (as Fomes). High rainfall, high
humidity and hot temperature favour the growth of many species of Phellinus in the
forests of Maharashtra. Neither the species (Parmasto 1985) nor the generic concepts in
Phellinus are stable and will only become more concise when species from all parts of
the globe are included in an analysis of the genus (Wagner & Fischer 2002). Towards this
end, a study was undertaken of Phellinus s.1. found in Maharashtra.

Materials and methods

Collection of samples

Fifty-four samples of Phellinus were collected in India, mainly during the monsoon
season. Six samples were collected in 1987-92 while the other samples were collected
during 1998-2002. Collections were made in various regions of western Maharashtra
(i.e. Konkan region), including in and around Pune city (Pune University Campus
(PUC), Amba valley, and Simhagarh fort) on various plant hosts (Table 1).

120

The samples were kept in clean polythene bags with a label indicating the date and
place of collection, name of the collector, name of the host (in case of field collection),
name of the shop and shop owner (in case of market collection), type of fruiting body
and a brief description of the specimen. Specimens were then taken to the laboratory.

Spore prints, obtained from fresh basidiomata on cellophane paper, were maintained
in airtight plastic bags. After drying in a oven at 40°-45°C the basidiomata were stored in
cardboard boxes and deposited in Herbaria Poonensis, Department of Botany, University
of Pune under the accession number ‘PH: All the characters used in the analysis were
evaluated in dried basidiomata.

Identification

Specimens were identified following a study of external and internal morphology.
The color, texture, type of attachment of the basidiomata, hymenial and pileal surface
of the basidiomata, margin, pore morphology, and dissepiment were observed and
noted. Measurements of basidiomata were taken as in Ryvarden & Johansen (1980).
Detailed microscopic examinations were carried out by cutting freehand longitudinal
thin sections of basidiomata, passing through hymenia. Sections were first treated with
absolute alcohol for a few seconds and then transferred to a solution of 10% KOH to
allow the swelling of different hymenial structures. Sections were washed two to three
times with distilled water (1 minute per washing), then stained with 1% phloxine (for
visualization of basidia), and teased apart in lactoglycerine with 1% cotton blue (for
visualization of setae, hyphal tips, hyphae, etc.). Semipermanent slides were prepared
in lactoglycerine. Permanent slides were prepared in polyvinyl alcohol (PVA) medium
(Omar et al. 1979) and observed under a bright field microscope (Olympus BX 40) with
an attached color camera (Hamamatsu 3CCD C6157 and UVP).

The identification of specimens was done using a key (Larsen & Cobb-Poulle 1990).
The color scheme of Jordan & David (1995) was used to describe color of morphological
structures.

Morphological Characters

Eighty-four morphological characters were used in the analysis. The list of characters
and character states (Table 2) was prepared according to Gdes-Neto et al. (2001) and
Kim & Jung (2002). A character state matrix was then prepared accordingly.

The characters of Phellinus merrilliiand P. linteus were compared with the descriptions
given by Larsen & Cobb-Poulle (1990), Rabba (1994), Dai & Xu (1998) and Lim et al.
(2003), abbreviated as LCP, R, D, Y, respectively. Similarly, the description of P baumii
Pilat was compared with those in Larsen & Cobb-Poulle (1990), Dai & Xu (1998) and
Lim et al. (2003).

Parsimony analysis

The character code for any character ‘not determined’ was coded as (?) and any
character that was absent in a particular species was coded as missing (-). The newly
generated data matrix was analyzed with PAUP 4.0 (Swofford 1999). Unrooted trees
were produced using parsimony analysis, heuristics search with random taxon
addition sequences, tree-bisection-reconnection branch swapping without topological
constraints.

121

Results

Fifty-four samples belonging to 23 species were collected from 18 different plant hosts.
Parsimony analysis conducted in PAUP resulted in 12 most parsimonious trees of 291
steps in length with CI = 0.38 and RI = 0.43. The strict consensus tree is represented in
Fig. 1. Three retrieved clades are consistent with proposed Phellinus species complexes
(or genera).

Clade 1 comprised P. torulosus, P. baumii (LCP), P. conchatus, P. baumii (D), P. baumii
(Y), P linteus (D), P linteus (Y), P. linteus, P. linteus (LCP), and P. linteus (R), species that
have hymenial setae, hyaline to brown spores, pileate basidiomata, and skeletal hyphae
that are brown, thick-walled, septate, and rarely branched.

Furthermore, P baumii (D) and P. baumii (Y) are closer to each other than to P
baumii (LCP), which grouped with P. conchatus. These two taxa are similar with respect
to many characters but have distinct setal characters. P baumii (LCP) has only hymenial
setae while P. conchatus has both hymenial and tramal setae. These taxa have hyaline
spores while most of the characters of generative and skeletal hyphae are missing in the
case of P baumii (LCP). Although P baumii is usually treated as akin to P. linteus, it was
observed that P linteus forms a less inclusive clade sharing characters like presence of
hymenial setae and brown spores, but the spores of P linteus are slightly thick-walled.
Also, the spores of P. baumii are ellipsoid while P linteus has ovoid spores. Moreover, P
linteus as described by Dai & Xu (1998) and Lim et al. (2003) was not similar to the P
linteus described by Larsen & Cobb-Poulle (1990), Rabba (1994), and the sample of the
present study. This could be attributed to the fact that many characters are missing.

Clade 2 is composed of P rickii, P sp., BP lamaensis and P. orientalis. Although all
these taxa have subglobose, thin-walled and hyaline basidiospores, the former two have
only hymenial setae while the latter two have tramal and hymenial setae.

Clade 3 is formed by the species P. coffeatoporus, P. pappianus, P. badius, P. macgregorii,
P. stratosus, P. fastuosus, P. lloydii, P. merrillii (R), RP. merrillii and PB. merrillii (LCP). All
these species lack setae, and have slightly thick or thick-walled, brown basidiospores.

Discussion

This is the first attempt to analyze the species concept of Indian species of Phellinus. In
this study, character evolution was not considered and the study was entirely based on
the morphological characters.

Because of the complexity in the family as well as in the genera of Hymenochaetaceae,
mycologists have divided the family and even genera into smaller taxa. This has resulted
in several species complexes especially within the genus Phellinus, e.g. P. rimosus
complex, P. pini complex, P. igniarius complex, etc. The parsimony analysis revealed that
many of the studied specimens could be assigned to at least three of these complexes.

P. conchatus, for example, was previously regarded as a member of P pini
complex. Fiasson & Niemela (1984) proposed a new combination for this species
using Porodaedalea as a generic name, i.e. Porodaedalea conchata instead of Phellinus
conchatus. P. conchatus, however, was regarded as a member of P. igniarius complex by
Fischer (1987). In the present study P. conchatus grouped together with P baumii (LCP).

122

However, P. baumii was treated as a close member of P linteus. In addition, P. torulosus
also grouped together with these species.

P. igniarius complex is recognized by the species having well developed dimitic
hyphal system, setae always present, and non-dextrinoid and hyaline basidiospores
becoming brown or yellow with age. Both P conchatus and P. baumii (LCP) comply with
the characters of this complex but P. conchatus has both tramal and hymenial setae while
P. baumii has only hymenial setae. Moreover, P. conchatus is oligonucleate, haploid, and
bipolar heterothallic while P torulosus is binucleate (Fischer 1996b). Furthermore,
P. torulosus shares characters of several complexes within Phellinus and seems to be
closer to P. ferreus and P. pini (Fiasson and Niemela 1984). The taxonomic position of
P. torulosus is rather isolated in Europe and more closely related to taxa occurring in
North America (P. gilvus) or the tropics (P. licnoides (Mont.) Pat.). In the present study P
torulosus shares characters of P. iginarius complex along with P. conchatus and P. baumii
(hen

P. baumii and P linteus can be distinguished on morphological features. P baumii has
long been regarded as a synonym of P. linteus, owing to morphological similarities, until
Dai & Xu (1998) discriminated them (Lim et al. 2003). These species are well separated
from each other in Clade 1. Moreover, although P. baumiti is closer to P linteus, it grouped
with other Phellinus spp. of a major ‘P. igniarius complex’ clade. The Indian specimen of
P. linteus, P. linteus (LCP) and P. linteus (R) were closer to each other than to P. linteus
(D) and P linteus (Y). It is suggested that P linteus might have intermediate forms and
these taxa, especially those from India, need further evaluation using other data sets.

Taxa of the P pini complex are apparently restricted to Europe (Fischer 1996a).
However, Overholts (1953), Owens (1936), and Parmasto (1985), based on morphology,
suggested the existence of undescribed taxa within P. pini complex.

The P. pini complex is characterized by species with dimitic hyphal system with
skeletal hyphae, annual or perennial basidiomata, presence of setae, and basidiospores
with variable morphology that are hyaline, becoming slightly yellow with age, and
nondextrinoid. The basidiospores and host specificity to conifers distinguishes the
P. pini complex from other groups. In the present analysis, taxa like P rickii, P. sp.
(probably a new species), P. lamaensis and P. orientalis were observed to share the
characters of the complex. P. sp., P. lamaensis and P. orientalis have resupinate to effused-
reflex basidiomata. Amongst these three species, P. sp. has annual basidiomata and host
specificity. It was found only on Broussonetia papyrifera, while only P. rickii has pileate,
applanate basidiomata. In basidiospore morphology, all species of this clade except for
P. rickii, have hyaline, thin-walled, subglobose basidiospores; P. rickii has brown thin-
walled spores. Both hymenial and tramal setae were observed in P. lamaensis and P.
orientalis, and only hymenial setae were observed in P. rickii and P. sp.

The P. rimosus complex has been recognized as a unique group with similar rusty
brown spores, absence of setae, and ungulate basidiomata rapidly becoming black and
rimose. Murrill proposed a new name Fulvifomes Murrill 1914, for this group. Ryvarden
(1987) included P. badius, P. caryophylii, P. fastuosus, P. nilgheriensis, P. robiniae and P.
rimosus in this complex. During the present study it was observed that a large clade
shares these characters. Along with P. badius and P. fastuosus, species like P. coffeatoporus,
P. pappianus, P. macgregorii, P. stratosus, P. lloydii, P. merrillii (R), PR. merrillii (LCP), and
P. merrillii (specimens of present study) agree with the characters of P. rimosus complex.

123

P adamantinus
P aureobrunneus
P sublinteus
P crocatus
P griseoporus
P sanjanii
P coffeatoporus
P fastuosus
P lloydii
P merrillii R
P merrillii P. rimosus
P merrillii LCP
P pappianus
P badius (Fulvifomes)
P macqregorii
P stratosus

complex

P minutiporus
P rickii P. pini
Psp
9 P lamaensis
P orientalis
P baumii D
P baumii Y
P torulosus
P baumii LCP
P conchatus P. igniarius
1 P linteus D complex
P linteus Y
P linteus
P linteus LCP
P linteus R

Fig. 1. Strict consensus tree for 23 Phellinus species in India.
Note: (Description of species according to LCP = Larsen and Cobb- Poulle 1990,
D = Dai and Xu 1998, R = Rabba 1994, Y = Y. Lim et al. 2003.).

compyex

(Porodaedalea)

(Phellinus s.s.)

These species have pigmented brown spores, lack setae, and have pileate, perennial
basidiomata.

P. sublinteus, P. griseoporus, and P. crocatus have varying basidioma morphology, and
basidiospore shape and color. All, however, have thick-walled basidiospores. This clade
was observed to be somewhat isolated from the rest of the main clades and the species
within the clade could not be assigned to any particular species complex, and thus need
further evaluation.

P. minutiporus showed rather close association with the taxa belonging to P. iginarius
complex while P. sanjanii were closer to P. rimosus complex than the other studied taxa.
Both P adamantinus and P. aureobrunneus formed residual taxa in the tree and could
not be assigned to any particular species complex.

124

Table 1: Phellinus collections studied and their collection data.

Species

P. adamantinus (Berk.)
Ryvarden

P. aureobrunneus J.E.
Wright & Blumenf.

P. badius
(Berk.) G. Cunn.

P. coffeatoporus
Kotl. & Pouzar

P. conchatus (Pers.)
Quél.

P. crocatus

(Fr.) Ryvarden
P. fastuosus

(Lév.) Ryvarden

P. griseoporus
D.A. Reid

P. lamaensis (Murrill)
Sacc. & Trotter

P linteus
(Berk. & M.A.
Curtis) Teng.

P. lloydii
(Cleland) G. Cunn.

P. merrillii
(Murrill) Ryvarden

Host
Albizia lebbeck (L.)

Benth.
Eucalyptus globulus
Labill.

Tamarindus indica L.

Albizia lebbeck

Acacia nilotica (L)
Delile

Acacia nilotica

Actinodaphne
angustifolia (Blume)
Nees

Acacia nilotica

Artocarpus
integrifolius L.f.

Albizia lebbeck

Olea dioica Roxb.

Mangifera indica L.
Olea dioica

Pongamia glabra Vent.
Tamarindus indica

Artocarpus
integrifolius

Acacia leucophloea
Willd.

Acacia nilotica

Artocarpus
integrifolius

Site
Near Kothi Gate (PUC)
Alice Garden (PUC)

Bremen Square, Aundh,
Pune
Near Kothi Gate (PUC)

Lake side of Pashan

In front of Botany
Department (PUC)
Bhimashankar

Alice Garden (PUC)

Sandu Brothers, Nerul,
Navi Mumbai

Adali, Sawantwadi,
Sindhudurg

Near Kothi Gate (PUC)

Bhimashankar

Amba Valley

Karnala Bird Sanctury
Karnala Bird Sanctury
Alibaugh

Base of Sinhagad Fort

Seetabai cha Dara
Sinhagad Fort

Lokhande Aushadhalaya
(LA), Ravivar Peth,

Pune
Anthropology Dept.
(PUC)
Anthropology Dept.
UC
Lake de of Pashan

Lokhande Aushadhalaya,
(LA), Ravivar Peth,
Pune

Sandu Brothers, Nerul,
Navi Mumbai

Bhakti Cha Mala, Dapoli
Bhakti Cha Mala, Dapoli

Date
2. VITI.2000
27.V 11.2000

5.VI.2001

2. VIII.2000
VI.1999

2. VIII.2000

27.1X.1987

21.VII.2000

111.2000

VII.1988

2. VIII.2000
2. VIII.2000
25.X11.2001

25.XI1.2000
19.1X.2000
19.1X.2000
14.1X.2000
1.VII.2000
1.VII.2000

IV.1999

17.V 11.2000
17.VII.2000

13. VII1.2001
IV.1999

111.2000

IX.1998
1X.1998

Sample
PH5A
BH2

PH20

PH4
PH12

PH13

VA-252

PH7

PH34S1

Adali20

PH5
PH6
PH41

PH24
PH30
PH29
PH18
PH9
PH9A

BHS3i22

PHIS
PHI5A

PH17
PH32L1

PH35S2

PH36B1
PH37B2

Table 1. (cont.).
Species

-P. merrillii (cont.)

P. macgregorii (Bres.)
Ryvarden

P. minutiporus
Bondartseva & S.
Herrera

P orientalis
Bondartseva & S.
Herrera

P. pappianus (Bres.)
Ryvarden

P. rickii Teixeira
P. sanjanii (Lloyd)

Ryvarden
P. stratosus Pat.

P. sublinteus (Murrill)

Ryvarden

P. torulosus (Pers.)
Bourdot & Galzin
Phellinus sp.

Host

Site

Artocarpus integrifolius Nardave, Kankavali,

(cont.)

Azadirachta indica
A. Juss.
Caesalpinia coriaria

(Jacq.) Willd.

Gliricidia sepium (Jacq.)

Kunth ex Walp.

Acacia nilotica

Albizia lebbeck
Thespesia populnea
(L.) Sol. ex Correa

Acacia nilotica

Swietenia mahagoni
(L.) Jacq.
Tamarindus indica
Tamarindus indica
Azadirachta indica
Gliricidia sepium
Mangifera indica

Peltophorum
ferrugineum Benth.

Cassia fistula L.

Neon pial
Sindhudurg
Nardave, Kankavali,
Sindhudurg
Nardave, Kankavali,
Sindhudurg
Adali, Sawantwadi,
Sindhudurg
Deorukh, Ratnagiri

Deorukh, Ratnagiri

Near Arts Faculty
(PUC)

Near Examination
Section (PUC)

Pune University
Campus (PUC)

Near Post Office (PUC)

Near S.T.P. (PUC)
Near S.T.P. (PUC)

Pune University
Campus

Aundh Gate, (PUC)

Harihareshwar

Near Examination
Section

Alice Garden (PUC)

Pune University
Campus (PUC)
Pune University
Campus (PUC)
Between S.T.P. and
E.M.R.C. (PUG)
Between S.T.P. and
EMERC. (PUG)
Radhanagari

Alice Garden (PUC)

Rear of Main Building

(PUC)
Central Bee Research
Station, Pune

Broussonetia papyrifera Botanical Garden,

(L.) Vent.

Botany Dept. (PUC)

Date
XII.2001

XII.2001

VII.1988

V.2002
V.2002
15. VII.2000

15. VII.2000

2.VIII.2000

21.VII.2000
2. VIII.2000
15. VIII.2000
26.X1.1992

2.VIII. 2000

19.1X.2000

2. VIII.2000

17.VI1I.2000

24.1X.1988

15.11131992

2.VIII.2000

2. VIII.2000

XI.2000
27.V 11.2000
TX.1999

VI.2000

V1.2002

125

Sample
PH47A
PH47B

PH47C
PH47D
Adali21

M2
M4
PH10

PH16
PH2

PH8
PH43
PH2Z1
VA-117

PH31

PH1

PH22

PH14
VA-354
VA-287
PH23
PHILS

PH42
PES
PH26

PH27

PH44

126

Table 2. List of characters and character states.

Character 1

ne CHARACTER
Life strategy

2 Basidioma morphology

3 Basidioma

4 Type of basidioma

5 Attachment of pilei

6 Base of pilei

7 Consistency of basidioma

8 Weight of basidioma

9 Separability from host

10 Basidioma gregariousness

11 Color of pileal surface

12 Texture of pileal surface

13 Zonation of pileal surface

14 Sulcation of pileal surface

15 Cracks in pileal surface

16 Warts in pileal surface

7 Rimosity of pileal surface

18 Nodosity of pileal surface

19 Rugosity of pileal surface

20 Ridges in pileal surface

21 Induration of pileal surface

22 Shape of pileal surface

23 Moss covered

24 Margin

20 Thickness of margin

26 Shape of margin

Di Fertility of margin

28 Texture of margin

29 Color of margin

30 Color of margin compared to pore

surface

31 Consistency of margin

32 Morphology of margin

33 Size of margin

34 Color of pore surface

Character State

0 = annual, 1 = perennial

0 = resupinate, 1 = effused-reflex,

2 = pileate

0 = sessile, 1 = spurious stipitate

0 = confluent, 1 = applanate,
2 = ungulate, 3 = imbricate, 4 =
triquetrous, 5 = bracket, 6 = semi
ungulate, 7 = pendent, 8 = convex

0 = semicircular, 1 = dimidiate,

2 = lobate

0 = attached by broad base, 1 = attached
by narrow base, 2 = attached laterally

0 = brittle, 1 = corky, 2 = woody hard,
3 = pulvinate

0 = light, 1 = medium, 2 = heavy

0 = easily, 1 = not easily

0 = solitary, 1 = grouped

0 = yellow, 1 = brown, 2 = red,

3 = black

0 = glabrous, 1 = velvety,

2 = tomentose, 3 = velutinate,

4 = pruinose

0 = azonate, 1 = zonate

0 = sulcate, 1 = non sulcate

0 = cracking, 1 = not cracking

0 = warty, 1 = not warty

0 = rimose, 1 = not rimose

0 = nodose, 1 = not nodose

0 = rugose, 1 = not rugose

0 = ridged, 1 = not ridged

0 = indurate, 1 = not indurate

0 = flat, 1 = rounded

0 = yes, 1 = no

0 = entire, 1 = lobed

0 = thin, | = thick

0 = acute, 1 = obtuse, 2 = blunt,

3 = rounded, 4 = nodular

O= sterile; l= fertile

0 = glabrous, 1 = tomentose,

2 = velutinate

0 = yellow, 1 = brown

0 = paler than pore surface, 1 = darker
than pore surface, 2 = concolorous

0 = brittle, 1 = firm

0 = soft, 1 = rough, 2 = sulcate

0 = below 2.5 mm, | = above 2.5 mm,

2 = more that 5mm

0 = yellow, 1 = brown, 2 = red, 3 = gray

Table 2. (cont.).

Character
No.

36
oF
38

39.
40

4]
42

43
44
45
46

47
48
49

50
51
a2
D2
54

=
56

oy)
58

oy)
60
61

63
64
65

66
67

CHARACTER

Pore surface in light
Shape of pore surface

Texture of pore surface
Pore shape

Pores per mm
Tube layer

Color of tubes
Color of tube layer

Length of tubes

Layer strata

Black line between layers
Size of tubes

Thickness of context
Consistency of context
Luster of context

Texture of context

Dark line between context

Tissue of context
Color of context
Size of context

Generative hyphae

Branching of generative hyphae

Septa of generative hyphae
Color of generative hyphae

Size of generative hyphae
Skeletal hyphae

Branching of skeletal hyphae

Septa of skeletal hyphae

Color of skeletal hyphae
Size of skeletal hyphae
Setae

Hymenial setae
Shape of hymenial setae

“27

Character State

0 = not glancing, 1 = glancing

0 = flat, 1 = round

0 = glabrous, 1 = tomentose, 2 = sulcate

0 = angular, 1 = circular, 2 = irregular,

3 = regular, 4 = cappilate and / or toothed

0 = up to 6,1 =up to 9,2 =up to 12

0 = indistinctly stratified, 1 = distinctly
stratified

0 = yellow, 1 = brown, 2 = red

0 = paler than context, 1 = concolorous,

2 = darker than context
0 = short, 1 = long

0 = single, 1 = double or multiple

0 = absent, 1 = present

0 = up to5 mm, 1 = up to 7 mm, 2 = up to
10 mm, 3 = up to 12 mm, 4 = more than
12mm

0 = thin, 1 = thick

0 = fibrous, 1 = corky, 2 = woody hard

0 = silky or golden on broken surfaces,

1 = without a luster, 2 = fibrous luster

0 = azonate, 1 = zonate

0 = absent, 1 = present

0 = of one kind, 1 = of two kinds

0 = yellow, 1 = brown, 2 = red, 3 = black

0 = up to5 mm, | = up to 10 mm, 2 = more
than 10 mm

0 = thin-walled, 1 = thick-walled

0 = branched, 1 = unbranched, 2 = rarely
branched

0 = unseptate, 1 = rarely septate, 2 = septate

0 = hyaline, 1 = yellow, 2 = brown,

3 = green

0=upto4um, 1=upto5um

0 = thin-walled, 1 = thick-walled

0 = branched, 1 = unbranched, 2 = rarely
branched

0 = non-septate, 1 = rarely septate,

2 = septate

0 = yellow, 1 = brown

0 = below 6 um, 1 = above 6 um

0 = both absent, 1 = only hymenial setae,

2 = both present

0 = thick-walled, 1 = thin-walled, 2 = absent

0 = straight, 1 = ventricose, 2 = uncinate,

3 = subulate, 4 = fusiform, 5 = conical,

6 = absent

128

Table 2 (concluded)
Character
Nev CHARACTER
68 Septa of hymenial setae
69 Base of hymenial setae
70 Tip of hymenial setae
71 Color of hymenial setae in water
72 Color of hymenial setae in KOH
yes) Tramal setae
74 Septa of tramal setae
75 Apex of tramal setae
76 Shape of tramal setae
7h Color of tramal setae in water
78 Color of tramal setae in KOH
i) Basidium shape
80 Basidiospore morphology
81 Basidiospore wall
82 Basidiospore pigmentation
83 Basidiospore color in water
84 Basidiospore color in KOH

Character State

0 = non-septate, 1 = septate, 2 = absent

0 = globular base, 1 = ventricose, 2 =
inflated, 3 = bent base, 4 = bulbous base,
5 = absent

0 = ventricose, 1 = straight, 2 = acute,

3 = absent

0 = yellow, 1 = brown, 2 = absent

0 = thick-walled, 1 = thin-walled, 2 = very
elongated, 3 = absent

0 = non-septate, 1 = septate, 2 = absent

0 = acute, 1 = blunt, 2 = absent

0 = cylindrical, 1 = elongated, 2 = absent

0 = yellow, 1 = brown, 2 = absent

0 = globose, 1 = subglobose, 2 = clavate,

3 = pyriform, 4 = barrel shaped

0 = globose, 1 = subglobose, 2 = ovoid,

3 = ellipsoid

0 = thin, 1 = thick, 2 = slightly thick

0 = hyaline, 1 = pigmented

0 = yellow, 1 = brown, 2 = hyaline

0 = pale golden brown, 1 = dull brown,

2 = olivaceous, 3 = brown

Acknowledgements

We would like to thank all the people that indirectly or directly contributed to this work, and,
especially, Dr James Ginns and Dr Eric McKenzie for exhaustive reviews and invaluable criticism.
This work is part of the PhD thesis of the first author and he would like to thank Dr Jitendra
Vaidya as well as the head of the Department of Botany, University of Pune for providing necessary
facilities.

Literature cited

Bagchee KD. 1961. The fungal diseases of Sal (Shorea robusta Gaertn. F. and Fils) IV. Fomes
caryophyllii (Rac.) Bres. a destructive heart rot of Sal. Indian Forest Records (N.S.) 2: 25-58.
Bagchee KD, Bakshi BK. 1950. Some fungi as wound parasite on Indian trees. Indian Forester 76:

244-253.

Bakshi BK. 1958. New records of hymenomycetes in India. Indian Phytopathology. 11: 88.

Bakshi BK. 1971. The Polyporaceae (On Trees and Timber). ICAR, New Delhi 58-62, 246.

Bondarzew AS. 1953. The Polyporaceae of the European USSR and Caucasia. U.S.S.R Academy of
Sciences Printing House, Moscow. [in Russian].

Corner EJH. 1991. Ad polyporaceas. VII. Beih. Nova Hedw. 101: 1-175.

Cunningham GH. 1965. Polyporaceae of New Zeland. New Zealand Department Scientific and
Industrial Research Bulletin. 164: 1-304.

Dai YC. 1999. Phellinus sensu lato (Aphyllophorales. Hymenochaetaceae) in East Asia. Acta Bot.
Fenn. 166: 1-115.

Dai YC, Xu MA. 1998. Studies on the medicinal polypore, Phellinus baumii, and its kin P. linteus.
Mycotaxon 67: 191-200.

Domanski S, Orlos H, Skirgiello A. 1973. Fungi. Polyporaceae II (pileate), Mucronoporaceae II
(pileate), Ganodermataceae, Bonderzewiaceae, Boletopsidaceae, Fistulinaceae. Foreign Scientific
Publications, Poland.

Donk MA. 1974. Checklist of European polypores. Royal Netherlands Academy of Arts and Science
Press, Netherlands.

Fiasson JL. 1982. Distribution of styrylpyrones in the basidiocarp of various Hymenochaetaceae.
Bioch. Syst. Ecol. 10: 289-296.

Fiasson JL, Niemela T. 1984. The Hymenochaetales: a revision of the European poroid taxa.
Karstenia 24: 14-28.

Fidalgo O. 1968. Phellinus from Venezuela - I. Mem. New York Bot. Gard. 17: 109-147.

Fischer M. 1987. Biosystematische Untersuchungen an den Porlingsgattungen Phellinus Quél. und
Inonotus Karst. Bibl. Mycol. 107: 1-133.

Fischer M. 1996a. Molecular and microscopical studies in the Phellinus pini group. Mycologia 88:
230-238.

Fischer M. 1996b. On the species complexes within Phellinus: Fomitiporia revised. Mycol. Res. 100:
1459-1467.

Ganesh PN, Leelavathy KM. 1986. New records of Phellinus from India. Curr. Sci. 55: 727-728.

Gilbertson RL. 1979. Wood rotting fungi of North America. Mycologia 72: 1-49.

Gilbertson RL, Ryvarden L. 1986. North American Polypores. Vol.1, Fungiflora, Norway.

Gilbertson RL, Ryvarden L. 1987. North American Polypores. Vol. 2, Fungiflora, Norway.

Goés-Neto A, Loguercio-Leite C, Guerrero RT. 2001. Morphological cladistic analysis of tropical
Hymenochaetales (Basidomycota). Mycotaxon 79: 467-479.

130

Hansen L, Knudsen H. 1997. Nordic macromycetes. Vol. 3. Helsinki University Printing House,
Finland.

Jahn H. 1981. Die resupinaten Phellinus - Arten in Mitteleuropa. Nachtrage 1967-1981. Bibl.
Mycol. 81: 109-151.

Jordan M, David C. 1995. Encyclopedia of Fungi of Britain and Europe. David and Charles Book,
UK.

Julich W. 1984. Basidiomycetes of South-East Asia. Persoonia 12: 107-117.

Kim S-Y, Jung HS. 2002. Cladistic analysis of the Polyporaceae using morphological characters.
Mycotaxon 82: 295-314.

Kotlaba F, Pouzar Z. 1978. Revision of the original material of Phellinus sulphurascens Pil.,
Xanthochrous glomeratus ssp. heinrichii and Polyporus rheades Pers. (Hymenochaetaceae).
Ceska Mycologie 24: 146-152.

Larsen MJ, Cobb-Poulle LA. 1990. Phellinus (Hymenochaetaceae). A survey of the world taxa.
Synopsis Fungorum 3: 1-206.

Lim YM, Lee JS, Jung HS. 2003. Type studies on Phellinus baumii and Phellinus linteus. Mycotaxon
85: 201-210.

Lloyd CG. 1915. Synopsis of the genus Fomes. Mycological Writings 4: 209-288.

Lowe JL. 1957. Polyporaceae of North America. The genus Fomes. State University College of
Forestry at Syracuse University Technical Publication 80: 1-97.

Mizuno T. 2000. Development of an antitumour biological response modifier from Phellinus linteus
(Berk. et Curt.) Teng (Aphyllophoromycetideae). Int. J. Med. Mushr. 2: 21-33.

Natarajan K, Kolandavelu K. 1985. Resupinate Aphyllophorales from South India - I. Kavaka 12:
71-76.

Niemela T. 1972. On Fennoscandian Polypores. II. Phellinus laevigatus (Fr.) Bourd. & Galz. and
P. lundellii Niemela, n. sp. Ann. Bot. Fenn. 9: 41-59.

Niemela T. 1975. On Fennoscandian polypores 4. Phellinus igniarius, P. nigricans and P. populicola,
n. sp. Ann. Bot. Fenn. 12: 93-122.

Nuss I. 1986. Zur Okologie der Porlinge II. Bibl. Mycol. 105: 1-299.

Omar MB, Bolland L, Heather WA. 1979. A permanent mounting medium for fungi. Bull. Br.
Mycol. Soc. 13: 31-32.

Overholts LO. 1929. Research methods in the taxonomy of Hymenomycetes. Proceedings of the
International Conference of Plant Sciences 2: 1688-1712.

Overholts LO. 1953. The Polyporaceae of United States, Alaska and Canada. University of Michigan
Press, U.S.A.

Owens CF. 1936. Studies on the wood rotting fungus Fomes pini. Variation in morphology and
growth habit. Am. J. Bot. 23: 144-149.

Parmasto E. 1985. Species concept in Hymenochaetaceae (Fungi, Hymenochaetales). Proc. Ind.
Acad. Sci. 94: 369-380.

Parmasto E. 1988. What is Ochroporus ossatus (Hymenochaetaceae)? Mycotaxon 32: 219-222.

Rabba AS. 1994. Studies in the genus Phellinus Quél. from Maharashtra. Ph.D. thesis. University
of Pune, India.

Rabba AS, Vaidya JG, Nanda MK. 1994. The genus Phellinus from Bhimashankar forests. Biol. Ind.
5: 47-56.

Rajchenberg M. 1989. Polyporaceae (Aphyllophorales, Basidiomycetes) from southern South
America: A mycogeographical view. Sydowia 41: 277-291.

Roy A. 1979. Taxonomy of Fomes durissimus. Mycologia 71: 1005-1009.

131

Ryvarden L. 1972. A critical checklist of the Polyporaceae in tropical East Africa. Norw. J. Bot. 19:
229-238.

Ryvarden L. 1978. Polyporaceae of North Europe. Fungiflora, Norway.

Ryvarden L. 1987. New and noteworthy polypores from tropical America. Mycotaxon 28: 525-
541.

Ryvarden L. 1991. Genera of polypores, nomenclature and taxonomy. Synopsis Fungorum 5:
1-363.

Ryvarden L, Gilbertson RL. 1994. European polypores part 2. Synopsis Fungorum 7: 394-743.

Ryvarden L, Johansen I. 1980. A preliminary polypore flora of East Africa. Fungiflora, Norway.

Sharma JR. 1993. New records of polypores from India. Ind. J. For. 16: 186-187.

Singh B. 1966. Timber decay due to five species of Fomes as new record in India. Indian Forester
92; 653-655.

Smith JE, Rowan NJ, Sullivan R. 2002. Medicinal Mushrooms: their therapeutic properties and
current medicinal usage with special emphasis on cancer treatments. Cancer Research, UK
(URL http://sci.cancerresearchuk.org/labs/med_mush/med_mush.html).

Swofford DL. 1999. PAUP” 4.0: phylogenetic analysis using parsimony, version 4.0b10. Sinauer
Associates Inc., U.S.A.

Thind KS, Chatrath MS. 1957. The Polyporaceae of the Mussoorie Hills II. Research Bulletin of the
Punjab University 125: 431-442.

Thind KS, Dhanda RS. 1980. The Polyporaceae of India. X. Kavaka 8: 59-67.

Tiwari DP, Harsh NSK, Tiwari CK. 1989. Polypore flora of Jabalpur and its eastern Suburbs. Biomes
4: 69-79.

Vaidya JG. 1995. Biology of the Fungi. Satyajeet Prakashan, India.

Vaidya JG, Bhor GL. 1991. Medicinal important wood rotting fungi with special emphasis on
phansomba. Deerghayu International 7: 16-19.

Vaidya JG, Lamrood PY. 2000. Traditional medicinal mushrooms and fungi of India. International
Journal of Medicinal Mushrooms 2: 209-214.

Vaidya JG, Rabba AS. 1993. Fungi in folk medicine. Mycologist 7: 131-133.

Wagner T, Fischer M. 2002. Proceedings towards a natural classification of the worldwide taxa
Phellinus s.1. and Inonotus s.1., and phylogenetic relationships of allied genera. Mycologia 94:
998-1016.

HS?

MY COTAXON

Volume 95, pp. 133-136 January-March 2006

Paecilomyces verticillatus,
a new species isolated from soil in China

ZHU Li, YANFENG HAN
& ZONGQI LIANG

zhuliluck@ 163.com swallow112886@yahoo.com.cn
*zqliang472@yahoo.com.cn

Institute of Fungus Resources, Guizhou University
Guiyang 550025, China

Abstract—A new species, Paecilomyces verticillatus, isolated from soil samples
of Guiyang City, Guizhou Province, China, is described and illustrated. It can be
distinguished by white colonies when grown on Czapek agar, whorls of phialides arising
from undifferentiated hyphae, and subglobose conidia.

Key words—fungi, hyphomycete, taxonomy, morphology

Introduction

Samson (1974) discussed the morphology differences between Verticillium Nees and
Paecilomyces Bainier. The genus Verticillium is characterized by verticillate conidiophores,
awl-shaped phialides and conidia in slimy heads. However, Verticillium sect. Prostrata
contains some species with Paecilomyces-like, slightly swollen phialides and conidia in
chains. Our new species, Paecilomyces verticillatus, resembles Verticillium species that
produce phialides always in whorls on aerial hyphae or simple conidiophores. The fact
that the phialides in our proposed new species typically have inflated bases with abruptly
tapering necks places it in the genus Paecilomyces.

Materials and Methods

Collection and strains isolation

Strain GZDX-IFR49-01 was isolated from soil collected from Forest Park, Guiyang,
Guizhou Province, China, May, 2003. Two grams of soil were added to a flask containing
20m sterilized water and glass beads. The soil suspension was diluted to a concentration
of 10°'!-10° after shaking for about 10min. A 1ml soil suspension (concentration 10°)
was mixed with Martin medium in sterilized 9 cm diam Petri dish and incubated at
25°C for 5 days. Colonies showing a typical Paecilomyces conidiogenous structure were
then purified by transplanting to Martin's slants.

*Corresponding author: Zongqi Liang

134

Identification of strains

The strains were transplanted onto Czapek agar, potato dextrose agar (PDA), and
Sabouraud agar in accordance with procedures set forth in Brown and Smith (1957) and
Samson (1974). After incubation at 25-26°C for 14 days, strains were identified based on ~
colony characters, conidiogenous structures, and other biological features.

The type culture GZDX-IFR49-01 and the holotype GZDX49-01 of P. verticillatus (a
dried plate culture on Czapek agar) were deposited in the Institute of Fungus Resources,
Guizhou University, China.

Description of new species

Paecilomyces verticillatus Z.Q. Liang, Z. Li & Y.F. Han sp. nov. Figs. 1-6
On agaro Czapekii coloniae 35-55 mm diam in 14 diebus ad 25°C, albae, floccosa, margine
irregularis, reserso albae. Hyphae hyaline, levia, 1.2-1.8 um crasssa. Conidiophora breva,
9.6-19.8 um longa. Phialides 7.8-14.4 x 1.2-2.4 ym, verticillatis, conis vel bases cylindres.
Conidia hyalina, levia, subglobasa vel ellipsoidea, catenulatae, 1.2-1.8 x 0.6-1.2 um.

Typus: GZDX-IFR49-01 et cultara viva GZDX49-01, isolatus ab soli in sylvis, Guiyang,
Provinice Guizhou, V, 2003, Y. F Han & H. L. Chu; in Guizhou Univ., conservatur.

Colonies on Czapek agar growing rapidly, attaining a diameter of 35-55 mm within
14 days at 25°C; ridgy, white, floss, irregular in the margin; reverse white. Vegetative
hyphae septate, hyaline, smooth-walled, 1.2-1.8 tm wide. Conidiophores hyaline,
smooth-walled, 9.6-19.8 um, directly bearing a whorl of 3 to 5 phialides or verticillate
prophialides with a whorl of 3 phialides. Phialides 7.8-14.4 x 1.2-2.4 um, awl-shaped or
consisting of a cylindrical basal portion and a thin neck, less than 0.5 um wide. Conidia
one-celled, hyaline, smooth-walled, mostly subglobose to ellipsoidal, 1.2-1.8 x 0.6-1.2
um; few fusiform, 1.8-3.0 x 1.8-2.4 um, forming divergent, dry chains or aggregating
spore group.

Distribution: Guizhou Province, China.

Discussion

Seven accepted species of Paecilomyces with subglobose conidia were identified using
CABI Bioscience Database, CBS Database and recent papers (Table 1).

Table 1. Seven accepted species of Paecilomyces with subglobose conidia

P. militaris Z.Q. Liang P. stipitatus Y.F. Han & Z.Q. Liang
P. niveus Stolk & Samson P. vinaceus Y.F. Han & Z.Q. Liang
P. odonatae Zuo Y. Liu et al P. viridis Segretain et al. ex Samson

P. rariramus Z.Q. Liang & B. Wang

135

Fig. 1-6 Colony and conidiogenous structure of Paecilomyces verticillatus
1-3, 5-6. Conidiogenous structure. 4. Colony Bar = 10 wm.

The thermophilic nature of P. niveus (Samson 1974), the yellow-green colony reverse of
P. viridis (Samson 1974), the vinaceous colony reverse of P. vinaceus (Han et al. 2005),
the rarely branching conidiogenous structures of P rariramus (Liang 2003), and the
larger conidia (1.7-5.9 x 1.7-3.3 um) and yellow colony reverse of P. stipitatus (Han et al.
2005) do not exist in P. verticillatus.

P. odonatae (Liu et al. 1996) and P. militaris (Liang 2001) are closely related to the new
species. However, P. odonatae has both globose conidia in straight chains and cylindrical
conidia in oblique chains. P militaris also exhibits both straight and oblique chain
conidial arrangements and produces larger conidia (2-3.2 x 1.5-2 um) than those of P
verticillatus.

Paecilomyces verticillatus can be distinguished from all the other species in the genus
by producing (1) phialides that often arise from undifferentiated hyphae in whorls, (2)
white colonies on Czapek agar, and (3) subglobose conidia.

136
Acknowledgements

This project was supported by the National Natural Science Foundation of China (No. 30270011).
We are grateful to Professors Zuoyi Liu and Jichuan Kang for their comments on the manuscript.
At the same time, we sincerely appreciate editorial review and revisions.

References

Brown AHS, Smith G. 1957. The genus Paecilomyces Bainier and its perfect stage Byssochlamys
Westling. Trans. Brit. Mycol. Sac. 40 (1): 17 - 89.

Han YF, Chu HL, Liang ZQ. 2005. Two new species of the genus Paecilomyces in China. Mycotaxon
923011 2316.

Liang ZQ, Wang B, Kang JC. 2003. Several rare entopathogenic fungi from western Sichuan
Mountains. Fangal Diversity 12: 129 - 134.

Liang ZQ. 2001. A corroboration of the anamorph of Cordyceps militaris - Paecilomyces militaris
Liang sp.nov.. Acta Edulis Fungi 8 (4): 28 - 32.

Liu ZY, Liang ZQ, Liu AY. 1996. A new species Paecilomyces isolated from Cordyceps odonatae.
Mycosystema 9: 83 - 87.

Samson RA. 1974. Paecilomyces and some allied Hyphomycetes. Stud. Mycol. 6: 1 - 119.

MYCOTAZXON

Volume 95, pp. 137-180 January-March 2006

A monograph of the genus Cookeina
(Ascomycota, Pezizales, Sarcoscyphaceae)

TERESA ITURRIAGA & DONALD H. PFISTER

titurri@usb.ve
Departmento de Biologia de Organismos, Universidad Simon Bolivar
Caracas, Venezuela

dpfister@oeb,harvard.edu
Department of Organismic and Evolutionary Biology, Harvard University
Cambridge, MA, USA

Abstract—Eight species of the wood inhabiting pantropical genus Cookeina are
described and illustrated. The genus Cookeina is characterized by large, stipitate or
sessile brightly colored apothecial ascoma, with or without hairs, and by distinctive,
thick-walled asci that have eccentricly placed opercula. An overview of the morphology,
development and life histories of the species are given along with discussion of their
relationships. A new species, C. colensoiopsis, is described from Venezuela, C. speciosa is
recognized as a species complex, and a lectotype is designated for C. sinensis.

Key words—Pezizomycetes, cup-fungi, taxonomy ,

Table of Contents
OTL OUUCLION se eee ne. en eee ee 1387) elaxOnOmicticatment....9 6s 2s 146
Historical background ................. 138 KeVilO SD CClCS metas fee me on nace 147
Materials and methods................. 139 DCSCTIDUOTS carmen here ae 147
Morphology and distribution ........ 140 Cooke COINSOt: ae ates 147
Macroscopic features................. 140 Cookeina colensoiopsis............. 151
PA SCL oben den ths Sth te a a 142 Cookeingd indica .........cc....00055. 154
UR SCOSDOTCSiaturee yc ck eee tat 142 Goole oul 155
celay nyse Nee f pt Se oe ee Cookeina sinensis”... Nes. 159
Beis BU SUSU ai eth geo oe GOokeinaispeciosd an eee 160
Excipular construction ............. 143
Cookeina tricholoma ............... 165
Develonment.is A889. Ae 144
Spore cischarcet ety. eaes acs 144 Cookeina venezuelae ............... 170
Anamorphic state...................- 145 Excliidedispecies #925. sn a iam 174
Distribution (eee eee 1450) Acknowledgements ar Aaa) tag 176

Phylogeny: sore ie) a eee 146 Se Literatireciteds ree anstes Sates 176

138

Introduction

In this monograph we present an account of the genus Cookeina, a member of
the Pezizales, which is comprised of species with lowland tropical and subtropical
distributions. Species in the genus inhabit recently fallen angiospermous woody
substrates and are presumed to be saprotrophic. The apothecial ascomata are brightly
colored, range in size up to about 3 cm in diameter and are often stipitate. Because
they are large, brightly colored and sometimes occurr in profusion in a single small
area, members of this genus are frequently collected. Even so, distributional records are
incomplete and primarily account for the common species. Nonetheless, the knowledge
of the biology of the species is minimal.

The genus has been placed in the Sarcoscyphaceae by all modern authors (Denison
1967, Eckblad 1968, Korf 1970, 1972, 1973, Le Gal 1953, Rifai 1968) and it has been
well characterized based on macro- and microscopic features. Circumscription has
been debated only in regard to the placement of Peziza insititia. This taxon has been
placed in Cookeina or alternatively in the monotypic genus Boedijnopeziza (Ito & Imai
1937). Recently, Melendez-Howell et al. (2003) and Weinstein et al. (2002) include
Boedijnopeziza in Cookeina. Within the Sarcoscyphaceae Cookeina has been allied
most closely to Microstoma. Together Cookeina and Microstoma form a monophyletic
group that has been recognized formally as the tribe Boedijnopezizeae (Cabrello 1988,
Harrington et al. 1999, Korf 1970, 1972, 1973).

In this work we summarize current knowledge about the genus and provide
identification keys, descriptions, and commentaries. We bring together in a single source
the literature related to this genus. We are aware of certain gaps related to distributional
records, particularly regarding Africa.

Historical background

Dating from the earliest days of biodiversity exploration in the Caribbean, the history of
the genus Cookeina spans three hundred years. In 1705 an illustration of Peziza speciosa
from the West Indies was published (Plumier 1705). The figure caption in Latin and
French, a polynomial and the only description we have of Plumier’s collections, reads
“Fungoides cyathiforme coccineum, oris pilosis/Foungoide en maniére de verre couleur
décarlete, a bord velu.” With this brief commentary, the defining macroscopic characters
of this fungus and of the genus Cookeina, to which it would ultimately be referred, were
set down. These fungi are goblet-shaped, scarlet to carmine, with hairs at the mouth or
margin of the apothecial ascomata. Although recorded by Fries (1822) under Peziza
speciosa this early record went largely unnoticed until Dennis (1994) provided an
intrepretation of Plumier’s illustration that placed it in the genus Cookeina. Under the
broad, inclusive genus Peziza other species sharing these characteristics were described
in the years following Fries. As tropical areas of the world were explored during the
middle years of the 19th century several species were added, which ultimately were
treated in the genus Cookeina. The short descriptions from this period often lacked
essential details of spore size and hair morphology resulting in the production of many
synonymous names for the common species. In the late 19" century, as part of a trend
toward erecting segregate genera for the larger members of the Pezizales, several authors

ile ke)

nearly simultaneously created genera to accommodate these distinctive species. Cooke
(1879) placed P sulcipes, P. hindsii, P. tricholoma and P. insititia, all referable to Cookeina
today, in Peziza subgenus Trichoscypha. Saccardo (1889) raised Cooke’s subgenus
Trichoscypha to generic level but in doing so created a later homonym. Trichoscypha
Hooker f. (Bentham & Hooker 1862) is a genus in the Anacardiaceae. Further confusion
exists because Boudier (1885) used Trichoscypha as a generic name for inoperculate
discomycetes mostly belonging to the genus Lachnellula (Hyaloscyphaceae). Saccardo
(1889) included species with both operculate and inoperculate asci in Trichoscypha.
When Kuntze (1891) erected the genus Cookeina his circumscription created a highly
heterogeneous assemblage of taxa including members of both the Pezizales and Helotiales
but encompassed those taxa previously treated in Trichoscypha. Finally, Pilocratera was
described (Hennings (1891). It post-dates the creation of Cookeina but was in general
use for a period. Seaver (1927) designated P. tricholoma as the type species of the genus
Cookeina; all authors have followed this typification. Cookeina, Trichoscypha and
Pilocratera, are all based on the same type species (Eckblad, 1968).

Seaver (1913, 1925, 1927, 1928, 1936, 1942) studied the American species and
codified both the use of the name and the concept of the genus Cookeina. At the
same time, Boedijn (1929, 1933) studied and described Asian materials. Boedijns
observations on spore germination and ascus construction contributed to the overall
knowledge of the genus. With some hesitation Seaver (1925) added C. tetraspora to the
genus. This species differs in construction of the excipulum and in spore morphology.
Later, it was designated the type species of the genus Nanoscypha (Denison 1972). Le
Gal (1953) regularized the taxonomy through study of type material and elucidated
the ascus morphology, as discussed more fully below. Weinstein et al. (2002) discussed
relationships of the species based on a molecular phylogenetic study. Several authors
treated one or more species from specific geographical regions as follows: Africa and
Madagascar (Alasoadudra 1972, Douanla-Meli & Langer 2005, Le Gal 1953, 1960,
Moravec, 1997), Indonesia (Boedijn 1929,1933), the Americas (Calonge 1986, Chacon
& Medel 1990, Denison 1963, 1967, Dennis 1970, Gamundi, 1957, 1959, 1971, Hanlin et
al. 1991, Hanlin 1993, Romero & Gamundi 1986, Tobon 1991), the West Indies (Dennis
1954, Maldonado Gonzalez 2000, Patouillard in Duss 1903, Pfister 1974, Seaver 1936,
Vooren 2002, 2003), Asia and India (Durrieu et al. 1997, Liou & Chen 1977, Nagao
1997, Otani 1971, 1975, Pfister & Kausal 1984, Wang 1997, Wang 2001, Yang 1990) and
Australasia (Rifai 1968).

Materials and methods

This study used herbarium specimens and living material, particularly from South
America. Type specimens of all taxa were examined when available. A concerted effort
was made to collect and document specimens during two summers in an Amazonian
forest in the southern part of Venezuela. In that study color variation in Cookeina
speciosa was a particular focus. Collections from that study were deposited in the
following herbaria: FH, USB, VEN.

Dried specimens were prepared for microscopic examination by rehydrating a small
portion of an apothecium in water for 1-2 hours. The sample was then oriented on the
stage of a sliding freezing microtome, covered with 50% aqueous commercial mucilage

140

and frozen. Median sections 20 to 50 um thick were made. Sections were removed from
the blade with a small, wet brush and placed on a microscope slide, where they were
either mounted directly for examination or left to air-dry on the slide. In either case
sections were selected under the dissecting scope, transferred with an insect pin to a
slide and mounted in water, Cotton Blue in lactic acid or Congo Red in ammonia. Where
quality and condition allowed 10 to 30 measurements of each structure were recorded
for each set of sections. Only asci that contained mature ascospores were measured.
Ascus measurements do not include the thin hyphal base. Ascospore sizes are based
on the measurement of discharged ascospores; colors are given for fresh, dry and re-
hydrated material. Drawings were made using a measured free hand method.

Terminology for cell types and arrangements follows Korf (1952, 1973) and Pfister
& Kimbrough (2001). Herbarium acronyms follow Index Herbariorum (www.nybg.
org/bsci/ih/ih.html); author’s names are abbreviated following Authors of Fungal Names
(www.indexfungorum.org/AuthorsOfFungalNames.htm).

In the nomenclators the notation “!!” following citations indicates, that holotype,
neotype, or isotype material was examined. The notation “!” indicates that syntype,
paratype, or other authentic material was examined. A question mark before a species
name indicates that type material was not examined but that the indicated placement is
probable. Specimens examined are cited with the data as they appear on the packet label,
supplemental data are enclosed in square brackets. Other abbreviations used are HT
= holotype, IT = isotype, PT = paratype, and NT = neotype. Over the course of these
studies many collections were consulted most are listed in the specimen cited section
but citations have been shortened and a few collections that were consulted incidentally
have not been listed.

Results and general discussion

Macroscopic features

Apothecia of Cookeina species are relatively large, ranging up to 3 cm in diam. They
are characteristically pliable, resilient and not easily broken by handling. Carotenoids
are present (Arpin 1969) which give the hymenia colors ranging from yellow and orange
to scarlet and dark tones of mauve (see figure 1). In a few cases ascomata are white; in
others maroon to brown. Apothecia of C. colensoi and C. venezuelae have short stipes
or are nearly sessile. When present, stipes may range in length up to 8 cm. The outer
surface of the ascomata, or the receptacle, may have distinct hairs distributed either
over the entire surface, as in C. tricholoma and C. sinensis, or at the margins, as in C.
insititia and C. speciosa. Cookeina colensoi, C. indica and C. venezuelae lack prominent
hairs. Hairs are composed of fascicles of fused hyphae originating from the ectal or the
medullary excipulum. Receptacle surfaces of all species are to some degree tomentose
due to the projecting free hyphae that arise from the ectal excipulum.

Figure 1. Habitat photographs of species of Cookeina. A. C. tricholoma TL-11427 (C). B. C.
tricholoma TL 11409 (C). C. C. speciosa TL 8405 (C). D. C. speciosa TL - 11393 (C). E. C. speciosa
TL- 11475 (C). FE. C. venezuelae Halling 5452 (NY). A-E courtesy of Jens Petersen (copyright
Jens H. Petersen/MycoKey) specimens from Ecuador, and FE. was used with the permission of Roy
Halling, specimen from Venezuela.

142

Asci

Asci are large, up to 550 um long and 40 um broad and have thick walls. No part of
the wall colors blue in iodine solutions; wall layers are differentially stained in Congo —
red in ammonia and the operculum stains more deeply in Congo red than surrounding
regions of the wall. The long cylindrical asci are rounded proximally and distally. Asci
have prominent, apically thickened opercula eccentrically located at the ascus apex. The
asci open along a line of dehiscence to form the operculum. The thickened operculum
is hinged at the lower region and it folds back at the time of rupture. Samuelson (1975)
described the apical apparatus using TEM and Melendez-Howell et al. (2003) gave
detailed information on ascus wall-layering using TEM. The asci are produced from
narrow ascogenous hyphae which expand abruptly at the base of the asci. This gives
the asci a rounded base. No croziers were observed. Because of the thinness of the
hyphae at the ascus base, the hymenium often separates from the subhymenium when
preparing mounts for microscopy. In all species asci mature synchronously. Within a
single ascoma all ascospores are at exactly the same stage of development. The controls
involved in this process are unknown. Asci that are constricted basally and that mature
simultaneously are known in Cookeina, its sister genus Microstoma and in Chorioactis
Kupfer ex Eckblad (Pfister & Kurogi 2004) which is placed in the Sarcosomataceae.

Le Gal (1953), Eckblad (1968) and Samuelson (1975) discussed the construction of
the ascus in Cookeina species with a particular emphasis on their apical structure. The
eccentric position and thickening of the operculum have been variously interpreted. The
notation of such asci as “suboperculate” has been discussed by these authors.

Ascospores

Ascospores are pink or buff in deposit and range up to 52 um long and 21 um wide.
They are ellipsoid, fusoid, or naviculate often appearing flattened on one side or curved,
as in C. insititia. In light microscopy ascospores are smooth or have low longitudinal
ridges or grooves and occasionally have transverse folds. The ridges may be unbroken
from pole to pole or they may form disjunct rows that may anastomose. Berkeley
(1875), who was the first to observe the markings, mentioned that one specimen of
C. tricholoma had “longitudinal dots as a Diatom.” SEM studies of the smooth-spored
species show some divergence. Melendez-Howell et al. (2003) illustrated low ridges and
reticulations on the surface of ascospores of C. insititia and Moravec (1997) depicted
similar markings in C. colensoi but Weinstein et al. (2002) indicate that the spores are
smooth.

In some species the ascospore walls are thickened at the poles, forming short apiculae.
Apiculae are well developed in C. speciosa and C. venezuelae, whereas in C. tricholoma
the walls are thickened but the spores are not conspicuously apiculate. In other species
polar thickenings are variably present. Boedijn (1933) found that in these species germ
tubes originated from the apiculae. He observed that C. insititia has a single wall layer;
Pfister (1973) verified this and noted that the other species of Cookeina, including C.
colensoi and C. venezuelae, all have double spore walls. Pfister (1973) stated that these
walls separate readily in 10-15% KOH. Melendez-Howell et al. (2003) through TEM
studies showed that the perispore layer of C. insititia is very thin and that the spores
have one wall layer or “paroi proper” as compared to the multiple layers present in C.
tricholoma. TEM studies of C. speciosa (as C. sulcipes) failed to show clear ascospore wall
layers (Melendez-Howell et al. 2003).

143

Berthet (1964) reported, and Pfister (1978a) confirmed, that ascospores are
multinucleate, a character of the family Sarcoscyphaceae. Ascospores always contain
oil guttules. There may be a single guttule, several large guttules or numerous small
droplets; guttulation is somewhat variable within a species. There is a tendency for the
guttules to fuse and amalgamate in drying and rehydration and, although the presence
or absence of guttules is an important character, their number and arrangement is not
reliable, particularly in dried specimens.

Paraphyses

Paraphyses are 1-6 um wide at the apex, hyphoid and are sometimes slightly
thinner below the apex but are not prominently enlarged above. Their cells form lateral
projections that frequently fuse with cells of adjacent paraphyses. The result is a tight,
interwoven, three-dimensional network surrounding the asci, among which individual
paraphyses are often difficult to discern. For this reason some authors have said that
paraphyses are lacking. We have seen paraphyses in all material examined. The apices
are free and in some collections extend above the hymenium. In C. colensoiopsis and
C. speciosa the terminal cells form setae that project above the level of the hymenium.
Berthet (1964) reports the cells of the paraphyses to be multinucleate.

Hairs and receptacle surface

In all taxa, the surface of the receptacle is minutely tomentose or granulose due to the
presence of globose to angular cells on the outer surface. These cells give the receptacle
a pruinose appearance. In addition, short projecting hyphae, only clearly seen under
the microscope, produce a tomentum. The tomentum may show two morphologies:
1) individual monilioid processes that arise from the margin and the receptacle. These
elements are composed of 2-5 short hyaline cells with thick and rugose walls; 2) fused
triangular bundles of cells at the margin that are wide at the base and narrow towards
the apex.

True hairs are easily seen with the unaided eye and may reach a length of 7 mm. They
are composed of adherent hyphal filaments running parallel to one another. The hairs
arise from the cells of the outer excipulum and are located in 3-5 rows at the margin of
the disc except in C. sinensis and C. tricholoma where the hairs arise from the medullary
excipulum and are more or less evenly distributed over the outside of the receptacle and
the stalk (fig. 2).

Excipular construction

The patterns of excipular organization vary only in minor detail from species to
species. The ectal excipulum is composed of two layers: an outer ectal excipulum up
to 175 um thick, of textura globosa to textura angularis, the cells of which are arranged
in indistinct rows of 3 to 7 cells. These cells have thick walls, especially the cells toward
the outer surface where they also become rounded. The inner ectal excipulum is a layer
at the junction between the medullary and outer ectal excipulum. It is composed of
textura intricata or textura oblita, of loosely interwoven, septate, branched, thin-walled
hyphae. In some cases the hyphae are immersed in a distinct gelatinous matrix with
hyphae oriented perpendicular to the surface of the receptacle. This gelatinous layer can
be seen as a light refractive continuous band in median sections. A gel layer is present
in C. colensoi, C. colensoiopsis, C. insititia and C. venezuelae. Despite its prominence gel
has often been overlooked in these species. We occasionally saw gel in other species

144

\y
Hy
KY)
(3
aN

pu
(

Figure 2. Cookeina venezuelae and C. tricholoma, cross sections of apothecia showing tissues and
hairs. A. C. venezuelae, stipled regions indicate gelatinous tissues, hairs are superficial and arise
from the ectal excipulum. B. C. tricholoma, no gelatinous tissues are present and hairs arise from
the medullary excipulum.

but in those cases it occurred in isolated pockets within the excipulum rather than as a
continuous, uniform layer and was variable within even a single collection.

The medullary excipulum, the innermost layer, which forms the core of the
apothecium, is composed of textura porrecta to textura intricata. It is built up of narrow,
septate, somewhat thick-walled hyphae that run parallel to the outer surface of the
apothecium. The subhymenium, the layer beneath the hymenium, from which asci
arise, is of dense textura intricata.

Development

Only C. tricholoma has been studied in any detail regarding apothecial development
(Pfister 1978a). Based on a study of primordia collected in the field the hymenium
is exposed in the youngest material observed. Pfister (1978a) suggested that all
Sarcoscyphaceae develop in agymnohymenial fashion; this has yet to be challenged or
confirmed across the entire family. Boedijn (1933) reported that in juvenile states the
hymenium of C. insititia is covered by a “nearly continuous subconical sheath, which
by expansion of the cup ruptures radially and gives rise to a ring of hairs.” Wang (1997)
made similar observations. We have made no attempt to comparatively study primordial
states in this work.

Spore discharge

In all species asci mature simultaneously. Boedijn (1933) observed that ascospores
were discharged mostly in an oblique direction due to the eccentricity of the ascus
opening. Both Seaver (1928) and Boedjin (1933) commented on ascospore discharge
in Cookeina, most probably in C. speciosa, based on their drawings of the ascospores.

145

Boedjin claimed that the ascus jet (ascospores and epiplasm) passed through the
ascostome (ascus pore) all at once, while Seaver (1928) suggested there was a contraction
between each individual spore ejection. In clarifying his earlier observation Seaver
(1942) said that he had not stated there was a pause between each ascospore being
ejected, as implied by Boedijn (1933), but that there was an expansion and contraction
of the ascostome between each spore ejection.

Despite the uniform maturation of the asci, Boedijn (1933) noted that ascospores
were discharged over a period of several days. Zoberi (1973) showed that as water
evaporated from the apothecium, or when it was removed mechanically, ascospore
discharge occurred. All spores were discharged within a 5-hour period.

One of our observations from the field relates to Zoberi’s experimental work. In
the stipitate taxa the cup may fill with water during rains. As these cups fill the added
mass causes the tough and resilient stipes to bend and dump out the accumulated
water. Because the stipes are resilient and flexibile the cup resumes its previous position
and is undamaged. ‘Thus, the cups can fill, be emptied and be hydrated for ascospore
discharge.

Anamorphic state, growth and cultivation

Boedijn (1929, 1933) reported germination of ascospores of Cookeina tricholoma
and C. speciosa as C. sulcipes. He noted three types of germination. One in which one
or two germ tubes were formed but no conidia, a second in which spores produced
numerous short germ tubes, each of which bore several conidia, and a third type in
which several germ tubes formed, elongated but only rarely produced conidia. Modes
of germination in Cookeina species were studied by Paden (1975), Hanlin et al. (1991),
Hanlin (1993) and Melendez- Howell (1986) and were found to conform to the original
observation of Boedijn. The anamorphic states are similar to those of Sarcoscypha
(Alexopoulos & Butler 1949, Harrington 1990, Rosinski 1953), Phillipsia (Paden 1975,
1984) and Nanoscypha (Pfister 1973).

Berthet (1964) stated that cultures were light in color, white or cream, never grey
or black. He indicated that septal aureoles, thickenings associated with septa, are very
well developed in cultures. Sanchez et al. (1993) and Sanchez Vazquez et al. (1995),
investigating in Mexico the edible Cookeina speciosa, determined the conditions under
which ascomata develop and the cultural requirements necessary for fruiting. Sanchez
Vazquez et al. (1995) suggests this species causes a white rot which is in agreement with
our general observations on the condition of wood associated with fruiting.

Distribution

Two species, C. speciosa and C. tricholoma, are pantropical but C. speciosa represents
a species complex and there is variation within the complex (Weinstein et al. 2002).
Other species seem to be more limited in distribution. Cookeina colensoi is primarily a
southern hemisphere taxon occurring in subtropical zones. A few collections are known
above the equator in Asia and the Americas. Cookeina indica, C. insititia, and C. sinensis
are restricted to Asia. The range for C. indica has been expanded in recent years from
India to Southwestern China (Yang 1997). In the Americas, C. venezuelae is known from
northern South America, Central America and from the West Indies. Gamundi (1983)
presented a distribution map for Central and South American species. In this paper C.
colensoiopsis is described from Mexico and Venezuela.

146

Phylogeny and relationships

The genus Cookeina has been placed in the family Sarcoscyphaceae in modern
treatments (Cabrello 1988, Eckblad 1968, Harrington et al. 1999, Korf 1970, 1972, 1973,
Le Gal 1969, Weinstein et al. 2002). The family is recognized fundamentally in the sense
of Korf (1970, 1972, 1973) as one of two families considered to have thick ascus walls and
thickened opercular areas. The Sarcoscyphaceae are generally brightly pigmented and
the Sarcosomataceae are generally dark in color. In all molecular phylogenetic studies a
monophyletic Sarcoscyphaceae is recovered. Within the group, Cookeina and Microstoma
form a well-supported clade. This group corresponds to the tribe Boedijnopezizeae as
delimited by Korf (1970).

Weinstein et al. (2002) studied the species of Cookeina using ITS sequence data.
Morphologically the species are distinguished by the combination of several features
including ascospore shape and surface relief, presence and orgin of apothecial hairs
and presence or absence of gelatinous material within the cortical layer of the excipular
tissue. The genus was shown to be monophyletic with several well-supported lineages
that correspond to the morphological species concept traditionally used. Collections
referred to as C. speciosa segregate within a clade. Hymenial color differences correlate
with groups within that clade. In this work we consider C. speciosa to represent a
species complex. Detailed populational studies will be necessary to understand fully
relationships within this complex. The placement of C. insititia in the ITS study is
ambiguous but falls within Cookeina. Thus, the genus Boedijnopeziza, with C. insititia as
the type species, is not recognized.

Taxonomic treatment

Cookeina Kuntze, Rev. Gen. Pl. 2:849. 1891.

[= Trichoscypha (Cooke) Sacc., Syll. fung. 8: 160. 1889, non Hook. f, 1862.]

= Pilocratera Henn., Bot. Jahrb. Syst. 17: 9. 1891.

= Boedijnopeziza S. Ito & S. Imai, Trans. Sapporo Nat. Hist. Soc. 15: 58. 1937.
TYPE SPECIES: Peziza tricholoma Mont. (selected Seaver, 1927)

Apothecia medium to large, cupulate to funnel-shaped, sessile or stipitate. Hymenium
white, pink, yellow, orange, salmon, rose, or chocolate. Outer surface of the apothecium
concolorous or lighter than the hymenium, nearly glabrous to tomentose or with long,
prominent fasciculate hairs on the margin. Excipulum of two distinct layers: an inner
layer of textura intricata of rather narrow diameter and an outer layer of pyriform to
globose cells which arise from hyphae originating in the medullary excipulum. The
outer layer is constructed of two zones, the inner zone of which may contain gelatinous
material. Asci cylindrical with a prominently thickened lateral operculum, J-, eight-
spored, at the base abruptly connected to a narrow, long, hypha, all spores within a
single apothecium at the same state of maturation. Ascospores hyaline, smooth or
with longitudinal and rarely transverse markings, ellipsoid to fusoid, pinkish or buff in
deposit, often bilaterally asymmetrical, guttulate. Paraphyses anastomosing to form a
network around the asci, in some species developing apically to form setiform hairs.

SUBSTRATE: On decaying, generally recently dead, twigs, branches, and larger logs.

DISTRIBUTION: Species are found throughout the lowland tropics. C. tricholoma and
C. speciosa are pantropical. Other species have restricted distributions.

147

Key to species of Cookeina

. Outer surface of the ascomata with distinct hairs that are visible without a handlens,
WiteamVelEGevelODeCtStl Cums ured ork dies emer ne Stee, A A, Wee ea 1

. Outer surface of the ascomata lacking obvious hairs, lacking a stipe or with a short

. Hairs arranged prominently at the margin of the apothecium, hairs pyramidal in form,
apothecia narrow goblet form, gel layer present in the excipulum, ascospores
narrow sub-fusoid to fusoid, asymmetrical and distinctly curved, with pointed
CLS wapebtntee cece chiki. crore tk dora: Mas cen tpn ate os UE, eam tt ye C. insititia

. Hairs either grouped at the margin or more or less evenly distributed over the
outersurface of the apothecium, apothecia widely flaring, ascospores ellipsoid to

DTOAcLyMUSOid Seawe moctate We. Ao, hae tie, SME AD COTE Rey EEVOUAED, K EIS SE OSE 3
. Hairs forming distinct rows or ridges at the margin of the apothecia, hairs arising
from the medullary layer, ascospores ellipsoid .................. C. speciosa complex
. Hairs more or less evenly covering the outer surface of the apothecium, spores
ellipsoidito, broad fusoidt. pe anette: Serthaieeces! teed. cap gere: Pee 4
RASCOSPOLES SITOOU A uth, A SAR eD. SIEAE, Lhe 2 PEM RESSE A ah sh. se REE C. sinensis
BASCOSpOTes Valli lOneitudinal stliall OLS aeeesce Aime eee eae C.tricholoma

. Excipulum lacking gelatinous material, ascospores elliptical to broadly fusoid with
longitudinal striations, flattened at one side, appearing sub-papillate ... C. indica

PAX CIPULUEN WILD, SelALINOUS IaLelial mayne. a. Meee ee eh ae ee vee meres eR TAOS ee rt 6

. Ascospores ornamented with both longitudinal and transverse folds, ellipsoid,
apiculate at each end, bilaterally symmetrical or asymmetrical....... C.venezuelae

. Ascospores smooth (if considered short stipitate, C. insititia could key here) ......... 7,

. Paraphyses without setose projections, ascospores ellipsoid to subfusoid, sometimes
SDOLEADICULLOmpapll ae: presental DOGS ater nee ene eee ee C. colensoi

. Paraphyses with setose projections, ascospores ellipsoid, smooth .... C. colensoiopsis

Descriptions of species

Cookeina colensoi (Berk.) Seaver, Mycologia 5: 191. 1913. Fig. 3

= Peziza colensoi Berk. in Hooker, Fl. nov.-zel. 2: 200. 1855 !! = Sarcoscypha colensoi
(Berk.) Sacc., Syll. fung. 8: 157. 1889. = Cookeina colensoi (Berk.) Seaver, Mycologia
5: 191. 1913. [misapplied = Cookeina venezuelae (Berk. & M.A. Curtis.) Le Gal] =
Boedijnopeziza colensoi (Berk.) Korf & Erb, Phytologia 21: 202. 1971.

= Peziza aluticolor Berk., J. Linn. Soc., Bot. 13: 176. 1872 [1873] !! = Geopyxis aluticolor
(Berk.) Sacc., Syll. fung. 8: 64. 1889. = Ciboria aluticolor (Berk.) Rick, Ann. Mycol. 2:
408. 1904.

= Geopyxis moelleriana Henn., Hedwigia 41:30. 1902.

= Geopyxis ciborioides Starback, Ark. Bot. 20 (2): 1. 1904. = Geopyxis aluticolor var.
ciborioides (Starback) Rick, Brotéria Sér. Bot. 25: 81. 1931. = Cookeina colensoi var.
ciborioides (Starback) Gamundi, Bol. Soc. Argent. Bot. 6: 218. 1957.

148

= Ciboria sessilis Starback, Ark. Bot. Utgivet. Avk. Svenska 2 (5): 3. 1904 !

= Ciboria argentinensis Speg., Anales Mus. Nac. Hist. Nat. Buenos Aires II 19: 444. 1909
"I

[= Peziza subtropica Speg. in ed., fide Gamundi (1959)]

Apothecia scattered, short stipitate centrally, seldom subsessile, deeply cup-shaped,
when dry, 2-15 mm tall and 2-17 mm diam. Disc brighter colored than receptacle, when
fresh, orange to orange-yellow, when dry, ochre, ochraceous or orange-ochraceous.
Margin frequently in-rolled when dry, with 0-4 low circular ridges more evident when
dry, with tomentum bundles originating from the outer excipulum. Receptacle when
fresh, paler than disc, up to 25 mm tall and 2-20 mm diam; when rehydrated, orange to
golden-yellow to yellow to light-yellow to cream; when dry, 10-17 mm diam, cream,
light yellow, yellow, orange, ochre, beige, or brown; sometimes drying in a venose,
convoluted, ribbed pattern, more evident at the base of the receptacle where it shows a
ribbed or venous pattern, continuing as striations on the stipe; furfuraceus. Stipe short
to substipitate, when fresh or re-hydrated light yellow to cream-colored to whitish and
2-20 x 1-3 mm, when dry yellow to orange, concolorous with dry receptacle and 2-15
x 1-2 mm, sub-cylindrical somewhat wider at the base with a disc-shaped “holdfast”
reaching 2 mm diam, with longitudinal ridges and furrows when dry on all of its
length and sometimes extending towards the receptacle. Tomentum of two types: 1)
individual monilioid processes that arise from the margin and also sparsely covering
all the receptacle giving it a furfuraceous appearance, composed of 3-5 short hyaline
cells, cells 8-12 tum diam with thick and rugose walls, walls 2-4 um wide, hairs 44-100
x 10-14 um; 2) fused triangular-shaped bundles of cells present at the margin, 40-100
uum long, 34-64 um wide at the base, and 8-22 um wide at the apex. Outer excipulum of
textura primatica to textura angularis, becoming globose on the outside, forming a 3-5
celled-layer of 20-40 um thick, cells 8-14 x 8-16 um, walls of outer cells roughened with
brownish material, outer layer is irregularly thickened giving it a pruinose appearance.
Medullary excipulum divided into two layers: the layer adjacent to the ectal excipulum
of textura oblita, of thin-walled hyphae immersed in a gel and oriented perpendicular
to the receptacle surface, (20-) 40-80 tm wide, hyphae 1-5 um diam. The layer more
proximal to the sub-hymenium of fextura porrecta 60-90 um thick, sometimes with gel
in patches, long—celled, arranged parallel to the receptacle surface, cells 3-6 um wide.
Subhymenium textura intrincata, 20-40 um wide, somewhat gelatinized. Hymenium
280-350 um thick, with no setae present. Asci cylindrical, base round to slightly
tapering, (252-) 340-416 x 16-24 um, abruptly arising from thin basal hyphae 8-32 x
4—8 um, 8-spored located in the top 1/2 of the ascus, Ascospores obliquely uniseriate,
broad elliptic-fusoid narrowing at the poles, unequal with a flatter side, sometimes short
apiculi or papillae present, (0-)2(-3) large oil guttules and often several smaller ones,
hyaline, smooth, 24-40 x 9-16 um. Paraphyses filiform, septate, braching, with frequent
anastomosis forming a dense network, agglutinated, 1.6-4 um wide in the middle,
enlarging at the apex to 4 um, equal to the asci or exceeding them by 2-4 um.

SUBSTRATE: on twigs 6-10 mm diam, on decomposed wood.

DISTRIBUTION: Australia, New Zealand, India, Madagascar, Samoa, China, Argentina,
Brasil, Colombia, Jamaica, Mexico .

ILLUSTRATIONS: Hooker (1855) as Peziza colensoi, f. 5a-c; Cooke (1879) as P. colensoi
fig 108, as P. aluticolor f. 198; Cooke (1892) as Geopyxis aluticolor, fig. 144; Massee (1896)

149

Figure 3. Cookeina colensoi. A. Cross section showing outer layer of the excipulum, bar = um. B.
Ascospores, bar = um. New Zealand, Bay of Plenty, Kaimai Ranges, vic. Katikati, 15 Feb 1998, S. P.
Mortimer (PDD 68535).

tab. 16, fig. 14-15; Starback (1904) as Geopyxis ciborioides, f. 1-3; Starback (1904) as
Ciboria sessilis, figs 8, 9; Le Gal (1953) figs. 110-113;

Gamundi (1957) Lam. I; Rifai (1968) figs. 21, 22; Chacon & Medel (1990) figs. 17-20;
Hood (1992) fig. 14 a; Weinstein et al. (2002) fig. 3E.

NOTES ON TYPE SPECIMENS AND NOMENCLATURE: The holotype specimen of C.
colensoi from Berkeley’s herbarium (K) has a drawing of a the characteristic spore
on the packet. The specimen was placed in a type cover by R. W. G. Dennis (Brian
Spooner, pers. com.) although it is note labeled as completely as the prologue suggests
(see specimens cited below). Massee (1896) cites Colenso, no. 2810. His drawing and
description accurately depict the structure of the outer excipulum and may be the first
to describe and illustrate the anatomy of this species. After a study of the holotype of
Peziza aluticolor we agree with Cooke (1879) and Saccardo (1889) that this material
should be referred to C. colensoi. Seaver (1928) used the name C. colensoi for a different
species, C. venezuelae, as pointed out by Le Gal (1953). The type specimen of Geopyxis
ciborioides (Brazil, Rio Grande do Sul, col. Ijuhy, ad ramos mucescentes humi jacentes
in silva primaea, 4/4 1893, 323 B) was not located in our search. Gamundi (1957) also
was unable to locate the type specimen and followed Rick (1931) in treating this as G.
aluticolor var. ciborioides. Gamundi (1957) stated that Geopyxis aluticolor var. ciborioides
differs from Cookeina colensoi only by the absence of paraphyses. In our experience, all
species of Cookeina have paraphyses; we question the observation that they are absent
in this taxon. We studied the holotype and isotype specimens of Ciboria argentinensis
as did Gamundi, but found that Gamundi’s (1957) measurements of ascospores and
asci differed from ours, 24-28.8 x 8.4-9.6 um vs. 24-32 x 8.8-13.6 um for ascospores
and 317-335 x 14.5-18.8 um and 340-380 x 16-24 um for asci. She stated that asci and
ascospores of C. argentinensis are smaller than those found in other collections of C.
colensoi. It is the case that asci and ascospores of C. argentinensis fall at the lower range
for this species but they are not as small as she indicated. Based on the description, Le
Gal (1953) thought G. elata was a synonym of C. colensoi, not of C. sulcipes as Boedijn

150

(1933) indicated. On reading the description, we can understand Le Gal's interpretation,
since the evident marginal hairs and furrows of C. speciosa are not mentioned, though
two of the characters that Massee (1898) describes are not at all typical of C. colensoi:
the length of the stipe (6-8 cm) and its growing on the ground. We were able to examine
the type specimen (NY) of this species, and determined it to be C. speciosa. It presents
the following characters, typical of C. speciosa: marginal ridges (three in this specimen)
with evident hairs, no gel in the excipular tissues, fine striations on the ascospores, and
hymenial setae. It is likely that Massee’s mention of this fungus growing on soil is based
on material fruiting on buried twigs. We were unable to locate any of the original material
of Geopyxis moelleriana (St. Cathar. bei Blumenau und Velha auf Holz, April 1891, 24
November 1891. No. 54b, 252, 903. Col. Moller). The holotype of Ciboria sessilis, from
Brazil, consists on a few apothecia, all with short stipes (up to 5 mm), with the exception
of one which has a stipe 15 mm long. The specific epithet “sessilis” may not have been
particularly appropriate.

GENERAL Notes: This species is easily recognized because of its lack of hairs,
presence of a gelatinous excipular layer and ascospores that appear smooth under the
light microscope. The ascospore surface was shown by Weinstein et al. (2002) to be
smooth under SEM examination; this conforms to the standard interpretation of the
species. Moravec (1997) described the spore ornamentation under light microscopy as
wrinkled and under SEM showed low, interconnected ridges and channels. His material
was from Madagascar and has not been reexamined by us. Le Gal (1953) indicated
that ascospores were smooth in the materials she examined from Madagscar. Neither
Moravec nor Le Gal mentioned the presence of a gelatinous layer. As fresh material from
Madagascar becomes available it might be worthwhile to reexamine it critically and to
consider the possiblity that the Madagascar specimens represent a distinct, undescribed
species.

There are several variable features among collections. In some specimens, the cells
of both types of tomentum were covered with an amorphous material or deposition.
These deposits give the cells a rugose appearance. There is variation in spore and ascus
size. For example, a collection from Sao Leopoldo, Brazil, from the Lloyd herbarium
(BPI) has spores 13-14 x 5-6 um; these are smaller than we recorded but the other
characters match well C. colensoi. Le Gal (1953) reported asci up to 440 um, triangular
hairs up to 160 um tall and 100 um wide at the base. These are larger than we found
for these structures. Rifai’s (1968) measurements of hairs are larger as well, 150 um
long and 80 um at the base. But he reports asci and paraphyses that are thinner: asci
14-18 um, paraphyses 1-1.8 um. Korf & Erb (Korf 1971) transfered C. colensoi to
Boedijnopeziza and later Korf (1973) used the character of presence of a gelatinous layer
to distinguish the genus Boedijnopeziza. Examination of their material showed it to be
C. venezuelae rather than C. colensoi. The gel layer as a character for distinguishing the
genus Boedijnopeziza has been the subject of considerable debate over the years. For a
more detailed discussion of the confusion surrounding Boedijnopeziza and gelatinous
material see the introduction.

SPECIMENS EXAMINED. ARGENTINA. BUENOS AIRES: Punta Lara, ad ramenta
arborum sempervirentium in silva marginali, locis umbrosis, 9 Jun 1949, R. Singer
2129 (CUP); TUCUMAN: ramas muertas putrescentes, Celtis sp., 16 April 1906, C.
Spegazzini 4107 (LPS, HT with Spegazzini’s drawings of asci, ascospores and paraphyses,

tot

IT (2 packets) of Ciboria argentinensis); Anta Muerta, Sierra de San Javier, on old fallen
branches, 24 Apr 1949, Singer e& Digilio 2116 (CUP); Quebrada de Lules, ad ramos
emortuos, 2 Apr 1949, R. Singer 2114 (CUP); 35km del camino a Tafi del Valle, 26 Feb
1949, R. Singer 2115 (CUP). AUSTRALIA. NEW SOUTH WALES: Clarence River, HT
of Peziza aluticolor (K, NY-G. Massee Herb.); Bobong Creek, Wild Cattle Creek State
Forest, near Cascade, on undetermined wood, 11 Feb 1984, R. Coveny 38/1984 (DAR
63642a); Dorrigo, Dorrigo National Park, on undetermined wood, 12 Feb 1984, R.
Covey 56/1984 (DAR 63646a). BRASIL. MATO GROSSO: Sta. Anna de Chapada, in
silva ad lignum. 23 Feb 1894, Madine 546 (B); HT of Ciboria sessilis Starback (S); G. O.
Malme, 546B (S); NOVA PETROPOLIS: 1923, Rick (FH); SANTA CATARINA: Porto
Novo, Sta. Catharina, 1928, Rick 531 (FH) [as Geopyxis aluticolor]; Sao Leopoldo, in
ramis frequentissima, 1903, Rick 14 Austro-Americani (NY, FH, FH-Pat) [as Ciboria
aluticolor]; Feb 1904 (FH) [as Ciboria aluticolor]; Sao Leopoldo, Rio Grande do Sul,
1925, Rick (FH) [as Geopyxis aluticolor]; Sao Leopoldo, J. Dutra 33 (NY); S. Salvador, 4
Jan 1944, Rick 20803 (NY) [as Ciboria], packet is empty. CHINA. GUIZHOU: on twigs,
4 Aug 1988, Li Yu Zong, Yu-chen & Ying Jian-zhe 59537 ex HMAS (FH), Xishungbanna,
Menlen, ex situ of endangerous plants area, 500 m. alt, on rotten wood. M. Zang 11532,
25 X 1988 (HKAS 20381). COLOMBIA. MAGDALENA: Sierra Nevada de Santa Marta,
Cerro Quemado trail, 1500-2300m, 24 Aug 1935, G. W. Martin 3714 (FH). INDIA.
West Kameng, A. P., on wood in an angiospermous forest, 5 Sept 1981, Rishi Kaushal
18556 (FH); as previous, Rishi Kaushal 18557 (FH). MEXICO. TAMAULIPAS: Rancho
del Cielo, on fallen limb, 29 Jul 1974, A. J. Sharp 62500 [ ex Herb. Univ. Tenn. 39652]
(CUP 62500) (FH 39652). NEW ZEALAND. SOUTHERN NORTH ISLAND.: On dead
sticks, near the River Manawatu, Colenso, holotype of P colensoi (K), (NY-G. Massee
Herb) [as Peziza colensoi, Peziza aluticolor],; AUCKLAND: Hunua Ranges, Cossey’s
Track, on wood, 9 May 1996, 1996 Fungal Foray (PDD66040); BAY OF PLENTY: Kaimai
Ranges, Timms Road, vic. Katikati, on decorticated wood, 15 Feb 1998, S. P. Mortimer
(PDD 68535); COROMANDEL: Kauaeranga Valley, vic. Thames, on decorticated wood,
1 Apr 1981, G. J. Samuels & H. Thiers (PDD 42052); On decorticated wood, 1 Apr 1981,
G. J. Samuels, H. Thiers, (PDD 42053); Kopu-Tairua Road, Kaitarakihi Summit Track,
37 08'S, 175 41’E, on decorticated wood, 14 Mar 1998, P. R. Johnston, R. E. Beever, S. L.
Stephenson (PDD 68628); vic. Port Charles, track from Stoney Bay to Fletcher Bay, on
wood, 25 Feb 1989, P. R. Johnston (PDD 55306); NORTHLAND: Mangamuka Scenic
Reserve, on wood, 8 May 1983, G. J. Samuels, T. Matsushima, R. H. Petersen (PDD
46278); Omahuta S. F., Omahuta Kauri Sanctuary vic. Mangamuka Bridge, on wood, 10
May 1981, G. J. Samuels, E. Horak (PDD 42049); WAIKATO: vic. Otorohanga, Native
Forest Restoration Trust, Owen Lewis Reserve, 220m, on blackened, decorticated wood,
24 May 2000, P. R. Johnston (PDD 71534); Waitomo, on bark and decort. wood, 26 Apr
1983, G. J. Samuels, P. R. Johnston, R. H. Petersen (NY, PDD 46838). SAMOA. C. G. Lloyd
5020 (FH-Pat) [as Peziza (Geopyxis) aluticolor]; Jan 1900, C. G. Lloyd 5020 (NY); 1904-5,
C. G. Lloyd 5021 (NY), infertile.

Cookeina colensoiopsis Iturriaga & Pfister, sp. nov. Fig. 4

Haec species C. colensoi similitudit ex strato gelatinoso, tomento et ascosporis laevibus
adest, sed haec differt eo setas in hymenio habet. Holotypus: Cerro El Avila, on wood, Norte
de Caracas, Agosto 2002, Tamia Souto (FH)

Apothecia scattered, centrally stipitate, deeply cup-shaped, up to 20 mm tall when
fresh, and 14-15 mm tall when dry. Receptacle, when fresh, 17 mm tall and 2-15
mm diam, when dry 6-8 mm tall and 15-20 mm diam; when fresh lighter colored

152

than the disc, when rehydrated, light yellow receptacle and margin; when dry, beige;
drying in a venose-ribbed pattern at the base, which continues with striation in the
stipe, furfuraceous uniformly because of white hair-like projections. Stipe cream-
colored (fresh), sub-cylindrical, somewhat wider at the base, 3-13 x 1-3 mm (fresh) and
up to 2 x 9 mm (dry), longitudinally ribbed when dry, furfuraceous with white hair-
like projections. Disc darker colored than receptacle, bright yellow to orange (fresh),
ochre (dried), orange (rehydrated). Margin concolorous to receptacle when fresh or
dry, ribbed with three striations or ridges, presenting the two types of tomentum. —
Tomentum of two types, originating from the outer excipulum: 1) individual monilioid
processes, minute, as hair-like projections, covering margin, receptacle and stipe, giving
it a furfuraceous appearance, 30-92 x 10-24 um, 2-10 cells tall, cells round or elongated
with thick-rugose walls, cells 10-22 x 8-16 um; 2) short and whitish triangular-shaped —
bundles consisting of 5-12 fused individual monilioid gosto 2002, Tamia Souto (FH).
processes, only present on marginal ridges. Outer ectal excipulum of textura globulosa
to textura prismatica, 4-5-celled layer 30-90 um wide, cells 8.0—14 um diam. Medullary

Figure 4. Cookeina colensoiopsis. A. Cross section showing outer layer of the excipulum, bar = 25
tum. B. Ascospores, bar = 10 um. C, C* Ascus bases, bar = 25 ttm. D. Setose apices of paraphyses, bar
= 25 um. Caracas, Venezuela; on decaying wood, 1903, A. E Blakeslee (FH).

h53

excipulum divided into two layers: the layer proximate to the ectal excipulum of textura
oblita, thin-walled hypha immersed in a gel and oriented outwards perpendicular to the
receptacle’s surface, layer 50-100 ttm wide, hyphae 2-4 um diam. The layer proximate
to the sub-hymenium (or more distant to the ectal excipulum) of textura porrecta,
long-celled, layer 60-100 (—600) um wide, cells 4-6 um wide. Subhymenium fextura
intricata, somewhat gelatinized, layer 4550 um wide. Hymenium 380-450 um thick.
Hymenial setae present, intemixed with asci and paraphyses, brownish, 430-440 x 2
tm, with lanceolate terminal cell, exceeding hymenial elements by 10-20 um. Asci long
cylindrical with a round base, 340-420 x 10-20 um, ending in an abrupt manner to
connect with hyphal-like basal appendage, a few times tapering slightly at base, basal
appendage 4-28 x 4 um. Ascospores obliquely uniseriate broad elliptic, unequally sided,
narrowing slightly at ends, with a short apiculum present at both ends, mostly 2 large
central oil guttules with two smaller ones at ends, hyaline, smooth walled, with no wall
markings, 30-34 x 12-14 um. Paraphyses filiform, septate, branching, anastomosing to
form a network, agglutinated, 2-4 um wide in the middle, enlarging in a clavate shape
at the apex to 4.0 um.

SUBSTRATE: on decaying wood.

DISTRIBUTION: known from Venezuela, possibly only from El Avila National Park.

GENERAL Notes: Our attention was caught by an unusual specimen identified as C.
colensoi. Denison (1967) studied this collection and wrote that “a single collection [of C.
colensoi] is known from Venezuela, which suggests that it may yet be found in Central
America.’ In order to determine if this specimen really belonged to C. colensoi, it was re-
examined and found to differ in form of the paraphyses from C. colensoi. This specimen
was collected by A. F. Blakeslee in 1903, in Caracas, Venezuela, on decaying wood (FH).
Specimen annotations by Blakeslee indicated that “it is not P venezueliana [sic]” and that
ascospores are 40-45 x 14-16 um (our measurements from the same specimen were 30-
34 x 12-14 um). The species was known only from that single collection from the Caracas
region, and we do not know the exact locations Blakeslee visited. Since the Caracas area
is reasonably well collected and in view of the urban expansion, we assumed that the
species no longer existed. Those initial conclusions proved to be wrong. In August 2002
a Cookeina specimen collected from Parque Nacional El Avila massif, located at the
northern side of the city of Caracas was brought to the senior author for determination.
It proved to be this species that we have now described as C. colensoiopsis.

Measurements from the recent collection (Paratype: PT) are larger than those from
Blakeslee (HT): outer ectal excipulum layer 40-50 um wide (HT), 30-90 tum (PT); inner
ectal excipulum gelatinized, 30-40 um widte (HT) and 50-100 um (PT); medullary
excipulum non-gelatinized 60-100 um wide (HT) and 470-600 um (PT); asci up to 360
um (HT) and to 420 um (PT).

This species resembles C. colensoi in the presence of a gel layer, tomentum and
smooth ascospores, but differs from it in having hymenial setae. Such setae were
observed previously only in C. speciosa.

SPECIMENS EXAMINED. VENEZUELA. FEDERAL DISTRICT: Caracas, on decaying

wood, 1903, A. F. Blakeslee, Det.: D. H. Linder. [as Cookeina colensoi] (FH). Holotype;
Cerro El Avila, on wood, Norte de Caracas, Agosto 2002, Tamia Souto (FH).

154

Cookeina indica Pfister & R. Kaushal, Mycotaxon 20: 117. 1984 !!,! Fig. 5

Apothecia scattered to gregarious, cupulate, disc-shaped when dry, centrally to slightly
eccentrically stipitate, sub-stipitate, or sessile, with a narrow point of attachment, up to 35
mm high and up to 30 mm in diam, tough in consistency. Receptacle concolorous with
the disc, yellow when fresh, when dry, orange to blackish, light ochre when re-hydrated,
nearly smooth except at the margin. Stipe, when present, solid, terete, whitish, smooth,
up to 22 mm long and up to 1.5 mm thick, short or often reduced to a narrow point of
attachment of 1 x 1 mm. Disc deeply concave, yellow when fresh, smooth. Margin entire,
minutely tomentose. Tomentum as hair-like processes arising from the cells of the outer
excipulum, composed of up to 4 round cells, 40-80 x 10-14 um. Ectal excipulum of
textura angularis to textura globulosa, of 3-6 cell layers, 40-50 um thick, cells 10-25 x
14.5-25 um. Medullary excipulum divided into two layers: the layer proximate to the
ectal excipulum of textura porrecta, long and parallel, without a gel. The layer proximate
to the subhymenium of textura intricata to textura porrecta, up to 160 um thick, of
interwoven hyphae in a more or less parallel arrangement at the junction between
the medullary and outer layers, 4-6 um diam. Subhymenium of textura intricata of
loosely interwoven septate and branched hyphae 2-2.7 um diam. Asci long cylindrical,
apices obtuse, at the base usually abruptly contracted or attenuated into a narrow basal
hyphal extension, 300-370 x 14-20 um, thick-walled, with 8 ascospores. Ascospores
ellipsoid to broad elliptic-fusoid to fusiform in face view, in side view, flattened at one
side narrowing towards the poles, in both views appearing sub-papillate; wall 1.0-1.5
um, thicker at the poles; hyaline, ornamentation of fine longitudinal, parallel ridges
approximately 1 per um that sometimes anastomose; guttules arranged in four possible
ways: 1) with 3 guttules, 2) 1-2 central guttules with smaller surrounding guttules, 3)
two large central guttules, two of middle size accompanied by smaller ones toward
the poles, or 4) numerous guttules; (18-) 26.5-40.0 (-47) x 10-15 (-17) um, usually
obliquely uniseriate. Paraphyses thread-like, delicate, septate, frequently anastomosing,
sometimes constricted at septa, (-2.5) 3-4 (-4.5) um in the middle, branching more
often at the apex, and presenting varied types of apices, sometimes several types can be
present in one apothecium: 1) swollen-clavate apices up to 5 um. 2) mucronate apices
with 5 um at its widest diameter ending in a somewhat pointed apex of 1 um diameter,
or 3) irregular up to 4 um wide; the mucronate type apices (2) projects slightly beyond
the ascus tips.

SUBSTRATE: On angiospermous wood.

DIsTRIBUTION: India, West Kameng (holotype and paratype locality), and China,
Yunnan (Yang 1990).

ILLUSTRATIONS: Pfister & Kaushal (1984), fig 1; Weinstein et al. (2002), fig. 3B.

NOTES ON TYPE SPECIMENS AND NOMENCLATURE: Specimens examined are mostly
those studied by Pfister & Kaushal (1984). No specimens of Cookeina mundkurii S. C.
Kaushal have been available for study but we suspect it is C. indica.

GENERAL Notes: Cookeina indica has narrow ellipsoid to fusoid, often inequilateral,
ascospores that are narrower than those found in either C. sulcipes or C. tricholoma,
the other species with longitudinally striate ascospores. The striations in C. indica form
more or less continuous bands on the spores. This species is characterized further by
having a smooth receptacle, with only minute marginal hair-like projections. There is no

155

Figure 5. Cookeina indica. A. Cross section showing outer layer of the excipulum, bar = 25 um. B.
Ascospores, bar = 10 um. C. Apices of paraphyses, bar = 10 um. Yunnan, China; 5 Nov 1999, 119
(HMAS).

gelatinous material in the ascomata. A distinctive feature for this species is the variety
of shapes of the apical cells of the paraphyses. Mucronate and irregular cell shapes such
as these are only present in this species. The typical filiform, slightly clavate, paraphyses
found in all species of the genus and are also present in C. indica. Yang (1990) suggested
that Teng (1963) reported C. indica under the name C. colensoi.

SPECIMENS EXAMINED. CHINA. YUNNAN: On wood, 5 Nov 1999, 119 ex HMAS
(FH); On wood, 5 Nov 1999, 119 (HMAS). INDIA. West Kameng, A. P. [Arunachal
Pradesh], Tipi, on wood in an angiospermous forest, (alt. 300 m), 16 Sept 1981, Rishi
Kaushal 18611, Holotype (FH); Photo of isotype specimen [as Cookeina insititia] at
PAN (FH) (not examined at this time previously examined by Pfister & Kaushal (1984));
Dehra, on Dalbergia sp., 2 Sept 1952, K. S. Thind 572400, Paratype (BPI) [as Cookeina
colensoi| slide made from Paratype specimen (FH).

Cookeina insititia (Berk. & M.A. Curtis) Kuntze, Revis. gen. pl. 2: 849. 1891. Fig. 6

= Peziza insititia Berk. & M.A. Curtis, Proc. Amer. Acad. Arts 4: 127. 1860!,!! = Trichoscypha

___ insititia (Berk. & M.A. Curtis) Sacc., Syll. fung. 8: 161. 1889. = Pilocratera insititia
(Berk. & M.A. Curtis) Sacc. & Traverso, Syll. fung. 20: 412. 1911. = Boedijnopeziza
insititia (Berk. & M.A. Curtis) S. Ito & S. Imai, Trans. Sapporo. Nat. Hist. Soc. 15: 58.
1937. = Microstoma insititia (Berk. & M.A. Curtis) Boedijn, Sydowia 5: 212. 1951.

=Trichoscypha magnispora Lloyd, Mycol. Writings 6: 1050. 1921!

=Boedijnopeziza sphaeroidospora Y. Otani in Kobayasi et al., Bull. Natl. Sci. Mus. 14(3):
407.1971!

156

Apothecia scattered to gregarious, centrally stipitated, 9-25 mm tall when dry, mostly
not exceeding 1 cm in length when fresh (fide Boedjin, 1933). Disc deeply concave,
white to pale cream, when dry concolorous or lighter than dry receptacle. Receptacle
deep-cup shaped, infundibiliform, urceolate to turbinate, seated on a well defined
stipe, white to whitish, to pale cream colored, paler than the disc; when dry beige or
yellow-ochre, 5-12 mm tall and 4-11 mm diam. Margin sometimes flesh-colored or
concolorous with the receptacle, with white, erect, triangular-flattened hairs. Stipe
terete whitish, when dry 3-16 mm long by 1-2 mm diam, when fresh up to 40 mm long
fide Boedjin (1933), drying in a venose pattern due to contraction of the gel, covered
by tomentum, sometimes with a disc-shaped point of attachment. Hairs of three types,
all originated from outer ectal excipulum cells: 1) marginal twisted (when dry) hairs,
light yellow, triangular and flattened, in 1-2 rows, up to 2 mm long and 0.5 mm at the
base and gradually tapering towards the pointed apex; when young these hairs totally
cover the hymenium in a nearly continuous sub-conical sheath, which later opens as
the disc expands, splitting into 4-5 separate compound hairs positioned in an imbricate
fashion then dividing at maturity in to many compound hairs, each formed by bundles
of parallel, septate, unbranched, sub-hyaline hyphae; 2) hairs, straight, in the margin
intermixed with the twisted hairs, and covering mainly the upper part of the receptacle,
though some cover the receptacle, flat, half the size of the marginal ones, but similar in
structure to them, composed of bundles of parallel, septate, unbranched, sub-hyaline
hyphae 4-9 um diam, turning wider and shorter, up to 14 um wide, at the base of the
bundle. 3) a tomentum composed of hyphal projections of th outer cells of the excipulum
covering receptacle and stipe. Ectal excipulum composed of two layers: Outer ectal
excipulum texturaglobulosa to angularis, layer of 30-50 um thick, composed of two to
four or sometimes more layers of globose, sub-globose or rarely polygonal cells 9-24 um
diam; the most external cells are globose, up to 28 um diam, with thick and sometimes
warted walls 2-3 tum wide. In some cases these cells aggregate to form masses of loosely
connected cells, which appear as irregular small projections at surface view. Inner ectal
excipulum of textura oblita, of loosely interwoven, delicate, septate, branched, thin-
walled hyphae immersed in a distinct gelatinous matrix and oriented perpendicular to
the receptacle’s surface, layer (20—)40-80 um thick,hyphae 1.0-5.0 um diam. Medullary
excipulum of textura porrecta to intricata, of parallel hyphae running parallel to the
outer surface of the receptacle, 1.8-6.3 um diam, septate, typically unbranched and
becoming intricate near the margin. Subhymenium of textura intricata, composed of
loosely interwoven septate and branched hyphae 2-2.7 um diam. Hymenium about 390
uum thick. Asci cylindrical, tapering to a long thin obconical base, 400-453 x 12-16
tum, thick-walled, wall 1.5-2 tm wide, with 8 ascospores. Ascospores usually obliquely
uniseriate, narrow sub-fusoidal to fusoidal, asymmetrical or distinctly curved, with
pointed ends, hyaline, smooth-walled under light microscope, containing numerous
guttules, 36-47(-52) x 8.0-16 um. Paraphyses filiform, delicate, septate, branched and
irregularly anastomosing, hyaline, 1-2.0 um diam, sometimes with irregular swellings;
their apices profusely divided forming a small number of short branches, 1.5 um diam,
forming a dense irregular network. SUBSTRATE: on wood, on decomposed wood.

DISTRIBUTION: China, Indonesia, Japan, Phillipines, Samoa.

ILLUSTRATIONS: Berkeley & Broome (1875) as Peziza insititia, tab. 5, fig 21; Boedjin
(1933) figs. 2D-E, 3K, I; Lloyd (1921) as Trichoscypha magnispora, plate 179, fig. 1950;

ews

Figure 6. Cookeina insititia. A. Cross section showing outer layer of the excipulum, bar = 20 um. B.
Ascospores, bar = 10 um. Yunnan, China; 17 Oct 1980, Zang Mu (CUP-CH 2527, HKAS 7240).

Massee (1896) as P. insititia, tab. 16, fig. 26-27; Melendez-Howell et al. (2003) figs. 8A-
G, 9A-B, 10A-C and 11A-G; Otani (1971) figs. 17, 18; Rifai (1968) fig 23-25; Seaver
(1928) fig 17i; Weinstein et al. (2002) fig. 3G.

* NOTES ON TYPE SPECIMENS AND NOMENCLATURE: Both the holotype (K) and the
isotype (FH-Curt.) of Peziza insititia were examined. Charles Wright collected the
specimens on the U.S. North Pacific Exploring Expedition under Commanders Ringgold
and Rodgers, but they have slightly different data on their labels. This is not unusual
because of labeling for distribution. A primary set of specimens was given to Asa Gray
who sent specimens to Curtis who in turn sent portions of them to Berkeley. Often only
abbreviated information was provided to Berkeley. The holotype (K) bears the number
148 on the packet, which is the species number as originally listed for P insititia by
Berkeley & Curtis. Other data given are “on dead wood, Bonin Islands” but no further
data on substrate or specific collecting date it states 1853-1856. The isotype (FH-Curt.)
bears a more precise collecting date (Oct. 1854) and information on substrate (ad
lign. inter folia dejecta), as well as the number 367 (C. Wright's collecting number).
Wright and Small collected in the Bonin Islands between October 19 and November 1,
1954 (Pfister, 1978b). Berkeley & Curtis indicate as well that this species is allied to P
tricholoma Mont.

Ito & Imai (1937) erected Boedijnopeziza as a separate genus for C. insititia because
of two features: the presence of a gel layer in the excipulum and smooth ascospores. The
genus Boedijnopeziza is still a question of debate, being accepted by some investigators,
such as Rifai (1968), Korf (1971, 1972, 1973) and Otani (1972) and not by others as
Seaver (1928), Le Gal (1953), Denison (1967), Eckblad (1968), Pfister (1973), and
Weinstein et al. (2000). Boedjin (1951) did not agree on the placement of C. insititia in
the genus Boedjinopeziza, and considered it a member of the genus Microstoma stating
that it had the characters of that genus: a gel layer, large fusoid spores, and anatomosing
paraphyses. More recently a subgenus Bedijnopeziza was created in Cookeina for C.
insititia (Melendez-Howell at al. 2003). This was based on SEM and TEM data related

158

to wall layering and formation of ascospores and asci. It should be pointed out that
Melendez-Howell used original material collected by Wright in the Bonin Islands (PC)
in 1854 for their study. This appears to be an isotype. Cookeina and Microstoma resolve
as sister groups in several analyses (Harrington et al. 1999). Weinstein et al. (2002) used
Microstoma as an outgroup in their study of Cookeina.

Boedijnopeziza sphaeroidospora (Otani 1971) was studied by DHP (unpublished) who
concluded that the type specimen was an immature specimen of Cookeina institia, and
hence the round ascospores were immature. Otani (1975) came to the same conclusion
after studying a series of developing apothecia of C. insititia in the field.

GENERAL NorTEs: We have not seen fresh material of this species; data on fresh
specimens has been incorporated from Boedjin (1933), Rifai (1968), and Durrieu et al.
(1997). The spores are smooth when viewed with the light microscope but they show
low convolute markings under SEM (Melendez-Howell et al. 2003). Bi et al. (1993)
mention that some spores are faintly ribbed but we have not seen such markings. It
had been thought that among all the other species in the genus, a unique characteristic
of C. insititia was the presence of a single ascospore wall layer (Boedjin, 1933; Pfister
1973). Melendez-Howell et al. (2003) studied the wall composition of ascospores of C.
insititia, C. speciosa (as C. sulcipes) and C. tricholoma. The “paroi propre,’ or proper wall
together with the perispore, are the two layers seen in all the ascospores of the Cookeina
species studied by them. They showed that the structure of the “paroi propre” in C.
insititia is less complex than in the other two species. The difference between species is
not in the number of wall layers (as was previously thought), but in the complexity of the
“paroi propre.’ The three species all have proper wall and a perispore, which are similar
in thickness in the three species. The proper wall is more complex with at least three
different layers in C. tricholoma and C. speciosa than in C. insititia (Melendez-Howell et
al., 2003). Melendez-Howell et al. (2003) found the ascus apex to differ from the other
species of Cookeina and the absence of the d2 wall layer distinguishes C. insititia from
the other species. We do not find compelling evidence for the segregation in a separate
genus of C. insititia particularly in light of the phylogenetic study (Weinstein et al.
2002).

SPECIMENS EXAMINED. CHINA. HAINAN: Chang-Kiang, 12 Nov 1934, S. Q. Deng.
6374 (CUP-CH 1386); Tan-hsien, 24 Oct 1943, S. Q. Deng 5564 (CUP-CH 1363); as
above, 30 Oct 1934, S. Q. Deng 5790 (CUP-CA 620); Ting-an, on wood, 18 Nov 1934,
S. Q. Deng 6681 (CUP-CH 622); as above, 13 Nov 1934, S. Q. Deng 6453 (CUP-CH
621). YUNNAN: Hsichung Panna Autonomous, Prefecture, of Tai Nationality Region,
Monlin, Nature Reserve, on rotten wood, 17 Oct 1980, Zang Mu (CUP-CH 2527, HKAS
7240). INDIA: Photo of India specimen at PAN (FH). INDONESIA. JAVA: Somarang,
Di van Leeuven 82 (NY). JAPAN. BONIN ISLANDS: On dead wood, C. Wright 148,
U.S. Pacific Exploring Expedition, [holotype of Peziza insititia] (K); ad lign. inter folia
dejecta, Oct. 1854, U.S. Pac. Ex. Ex., C Wright (367) (FH, FH-Curt.), [isotype of Peziza
insititia] (FH-Curt.); 6 Oct 1915, A. Yasuda 332 [very fragmented] (NY); Titizimia
Island, Renzyudani, 23 Nov 1936, Y. Kobayasi 664 (CUP-JA 664). PHILIPPINES: Six
collections without collection data in OSC, W. C. Denison; On dead wood, Denison 3941
= OSC 24420; Denison 3942 (OSC 67796, 24419); Laguna, Los Bafios, on dead wood,
24 Oct 1921, Colin G. Welles 11671 (NY); Luzon, Mt. Maguiling, on dead wood, 26 Oct
1920, A. Abesanis 10460 (FH-Pat); Oct 1920, O. A. Reinking 10252 (FH-Pat); 28 Sept
1920, O. A. Reinking 28341 (BPI-Lloyd) [holotype of Trichoscypha magnispora]; 25 Oct

159

1920, PR. Malabassan 10447 (FH-Pat); Bois pourris de arbres, 19 Oct 1887, Balansa 43
(FH-Pat); Palo, on fine damp sticks, Jan 1906, A. D. E. Elmer 7205 (NY). SAMOA: 1904-
5, C. G. Lloyd 5019 (NY).

Cookeina sinensis Z. Wang, Mycotaxon 62: 293. 1997 !!

Apothecium solitary or scattered, cupulate, centrally stipitate, up to 25 mm high and
50 mm diam when dry. Receptacle concolorous or paler than the disc, cinnamon-buff
when dry, covered more or less uniformly with conspicuous long hairs. Stipe short,
when rehydrated 8 x 1-2 mm and brownish-orange to cinnamon-buff, concolorous
with receptacle, sub-cylindrical, somewhat wider at the base, with longitudinal ridges
and furrows when dry over its length and sometimes extend to the receptacle. Disc
deeply concave, pinkish, pinkish orange, buff to salmon, ochraceous-orange when dry.
Margin with somewhat inrolled. Hairs fasciculate, white to brownish, arising from the
medullary excipulum, composed of bundles of parallel, septate, thick-walled hyphae,
stiff, bristle-like, 3-7 mm long, individual hyphae 6-8 um diam, walls 1.5-2.5 um wide.
Tomentum not seen. Outer excipulum of textura globulosa, layer (50-) 80-175 um
wide, cells arranged perpendicularly to the surface of the receptacle, 8-24 um diam,
cells thick-walled, particularly the most external ones, walls 1.5-2.5 um thick, hyaline.
In some cases these cells aggregate to form masses of loosely connected cells, which
gives the receptacle a pruinose surface. Inner ectal excipulum a thin layer of loose
textura porrecta to intricata of thin-walled hyphae, layer 64-80 um wide, hyphae 4-11
um diam, no gel present. Medullary excipulum of textura intricata, 230-300 um thick,
hyphae septate, 2.5-10 tum wide. Subhymenium of textura intricata, indistinguishable
from the medullary excipulum, 20-40 um wide. Hymenium 500-525 um thick, easily
separated from the excipular layer. Asci cylindrical, long, 280-387 x 16-20 um, narrow-
hyphoid at base, thick-walled, 2-3 um thick, 8 ascospores. Ascospores broad sub-fusoid
to lemon-shaped, pointed at both ends, pale yellow when mature, smooth-walled, 0- to
biguttulate, 25-40 x 12-17 um. Paraphyses moniliform, slender, septate, branched and
anastomosing, 2.5—4 um.

SUBSTRATE: On dead twigs and debris.

DISTRIBUTION: Only known from China.

ILLUSTRATIONS: Wang (1997) fig. 2.; Wang (2001) fig. 1; Weinstein et al. (2002) fig.
3F,

NOTES ON TYPE SPECIMENS AND NOMENCLATURE: The designated holotype from
HMAS 70088 has no ascospores. The type specimen being infertile, we designate here
an epitype, HKAS 14679, a paratype collected in the same area.

GENERAL NotEs: Cookeina sinensis is very similar to C. tricholoma, the difference
being that the ascospores of C. sinensis are smooth, and those of C. tricholoma are
striate. There are apparently few collections of this fungus and its range to date is limited
to China, including Taiwan (Wang 2001). We were only able to obtain three collections
on loan. Molecular data show it is part of a larger group that contains C. tricholoma, but
it appears to be distinctive from C. tricholoma (Weinstein et al., 2002).

SPECIMENS EXAMINED. CHINA. YUNNAN: MENLEN: Xishuangbanna: On twig, 8
Jun 1986, Li Yu 372 [70088] (HMAS) without ascospores, holotype of Cookeina sinensis;
as above, 72003 (HMAS); Limestone Hill, 1200 m, on rotten wood, 15 Aug 1985, Zang
Mu 10398, 14679 (HKAS) [epitype].

160

Cookeina speciosa (Fr. : Fr.) Dennis, Mycotaxon 51: 239. 1994. Figs. 1 C-E, 7

= Peziza speciosa Fr., Syst. Mycol. 2: 84. 1822 [Type is illustration by Plumier cited by
Dennis (1994) as listed above.] !

= Peziza sulcipes Berk., London J. Bot. 1: 141. 1842. [Type specimen: Surinam Hostin.
(K).] infertile, no spores] ! = Trichoscypha sulcipes (Berk.) Sacc., Syll. fung. 8: 161.
1889. = Cookeina sulcipes (Berk.) Kuntze, Revis. gen. pl. 2: 849. 1891. = Pilocratera
sulcipes (Berk.) Sacc. & Traverso, Syll. fung. 20: 413. 1911.

= Peziza hindsii Berk., London J. Bot. 1: 456. 1842. [Type specimen: on dead wood, New
Ireland, July] (K!) = Lachnea hindsii (Berk.) Pat., Bull. Soc. Mycol. France 4: 98. 1888.
= Trichoscypha hindsii (Berk.) Sacc., Syll. fung. 8: 161. 1889. = Cookeina hindsii (Berk.)
Kuntze, Revis. gen. pl. 2: 849. 1891. = Pilocratera hindsii (Berk.) Henn., Hedwigia 32:
VOSS CR

= Peziza (Aleuria) javanica Nees ex Lév., Ann. Sci. Nat. Bot. Ser 3 3: 39. 1845. [Type
specimen: Java, ad palmas, herb. Blume] PC! = Trichoscypha javanica (Nees ex Lév.)
Sacc., Syll. fung. 8: 162. 1889. = Cookeina javanica (Nees ex Lév.) Kuntze, Revis. gen.
pl. 2: 849. 1891. = Aleuria javanica (Nees ex Lév.) Overeem & D. Overeem, Bull. Jard.
Bot. Buitenzorg. IIT 4: 12. 1922.

= Peziza (Lachnea) amoena Lév., Ann. Sci. Nat. Bot. III 3: 39. 1845. [Type specimen:
Guiana ad truncos] = Trichoscypha amoena (Lév.) Sacc., Syll. fung. 8: 161. 1889. =
Cookeina amoena (Lév.) Kuntze, Revis. gen. Pl. 2: 849. 1891.

= Peziza afzelii Fr., Nova Acta Regiae Soc. Sci. Upsal. III 1: 121. 1851. [type specimen: ad
terra in Guinea, not found at UPS.] = Trichoscypha afzelii (Fr.) Sacc., Syll. fung. 8: 161.
1889. = Cookeina afzelii (Fr.) Kuntze, Revis. gen. pl. 2: 849. 1891. = Pilocratera afzelii
(Fr.) Sacc. & Traverso, Syll. fung. 20: 412. 1911.

= Peziza (Geopyxis) hindsii var. beccariana Ces., Atti Accad. Sci. Fis. 8 (4): 11. 1879. [Type
specimen: lignicola, Ceylon] = Trichoscypha hindsii var. beccariana (Ces.) Sacc, Syll.
fung. 8: 162. 1889.

= Pilocratera engleriana Henn., Bot. Jahrb. Syst. 14: 363. 1892. (tab. 6, fig. 9.) (!) [Lectotype:
designated here because holotype lost, Kamerun, Zenker (B)] ! = Trichoscypha
engleriana (Henn.) Sacc., Syll. fung. 11: 398. 1895.

= Geopyxis elata Massee, Bull. Misc. Inform. 138: 123. 1898! [Type specimen: On the
ground, Kumusi River, W. Fitzgerald, New Guinea (K)!]

= Pilocratera maxima P. Syd., Ann. Mycol. 10: 82. 1912. [Type specimen: ad ligna vel
ramos(?), Siid-Ost-Borneo. Hayoep, 18. 6. 1908, leg H. Winkler no. 2531]

= Pilocratera novoguianensis Ramsb. in Gibbs, Fl. Arfak Mts. p. 185. 1917. [Holotype: In
ligno putrido. Manokoeari, sec. jungle, edge of “korang” forest, 200° Jan 1914, Gibbs
6152]!

= Cookeina sumatrana Boedijn, Recueil Trav. Bot. Néerl. 26: 407. 1929. [Type specimen:
auf vermoderten Baumstammen im Walde zu Soengai Pantojer (Deli) but a specimen
is not particularly noted] = Have not examined type. Le Gal (1953) has it as a synonym
of Cookeina sulcipes.

[= Geopyxis striatospora Maubl. & Roger, Bull. Soc. Mycol. France 52: 83. 1936 (teste Le
Gal, 1953). Nom. inval. No Latin description or diagnosis given] [no specimen in PC]
[Type specimen: leg. A. Mallamaire, Cote-d’Ivoire, 1934]

= Cookeina sulcipes var. fusca Alas., Nova Hedwigia 23: 771. 1972. [Type specimen: U.I.B/
L. 176 but this seems to refer to a series of collections from 1963 and 1964].

= Cookeina globosa Douanla-Meli, Mycotaxon 92: 225. 2005.

Apothecia solitary or clustered, centrally stipitate to rarely subsessile, deep cupulate to
goblet shaped, leathery, becoming wrinkled with age, 10-50 mm broad, 12-80 mm tall.

161

Receptacle cup shaped or rarely funnel shaped, sometimes whitish, minutely scurfy
except around the margin where there are usually up to 5 distinct concentric ridges from
which compound hairs arise in mature specimens, in young specimens the ridges are
absent and the hairs are arranged around the margin as a single row, variable in color,
concolorous or much paler than the disc; when rehydrated light-brown, light-yellow,
light yellowish-beige, yellow, yellowish-brown to ochraceous-yellow, ochraceous-
orange to even white, and brown; when dry, beige to beige-orange, to light-brown,
to dark brown, when dry 6-25 mm diam and 6-14 mm tall; when rehydrated 16-50
mm diam and 8-20 mm tall. Stipe terete or compressed, sometimes grooved, slender,
hollow, slightly attenuate below and often forming a disc-like holdfast at the bottom,
concolorous or even paler than the receptacle, 3-40(-75) x 1-6 mm. Disc deeply
concave, appears smooth to the unaided eye, when fresh pink or salmon, or light-coral
to coral to deep coral, orange, yellow, mauve or light-brown. Margin not inrolled at
maturity, when dry inrolled, when fresh concolorous to receptacle, brown to light yellow
when rehydrated, provided with several rows of long hairs. Tomentum of two types:
1) individual monilioid processes that are present on the margin and as well covering
sparsely all the receptacle giving it a furfuraceous appearance, composed of 2-5 short
hyaline cells, cells 20-30 tm diam with thick and rugose walls, walls 2-5um thick. 2)
fused triangular-shaped bundles of cells present at the margin, 40-100 um long, 34-64
um wide at the base, and 8-22 um wide at the apex. Hairs located in 2-5 concentric
ridges or rows around the margin, approximate distance between rows.um wide, hyphae
2-3 um wide, not staining with Congo Red. Medullary excipulum textura porrecta not
0.25-0.75(-1) mm; all hairs of approximate the same length, 0.25-1 mm long when dry,
0.75-1.25 mm long when rehydrated, each hair composed of fascicles of hyphae which
are longitudinally fused, the exterior hyphae shorter than the others so the compound
hair has a broad base up to 200 um diam, diminishing in width up to a pointed apex,
individual hyphae white to beige 4.5-9.0 um diam. Outer ectal exipulum textura
globosa to angularis or prismatica, layer (28—) 30-60 (-80) um wide, composed by a
few cell layers not staining with Congo Red, lying perpendicular to the surface of the
receptacle, outer cells round to elongated, (15—)16-30 x (9—)12-24 um, cells becoming
rounder and thicker—walled towards the flanks, at the surface of the receptacle groups
of thick-walled and sometimes warted, globose or pyriform cells are often irregularly
ageregated causing the pruinose appearance of the receptacle; internal cells are smaller
and prismatic. Inner ectal excipulum textura intricata to lax intricata, without a gel; this
layer is gelatinized only in infertile young specimens, disappearing at maturity, layer
(20-) 30-80 gelatinized, layer (30-) 40-300 um wide, composed of long compressed
parallel hyphae, 2-4 (-5) um wide, not staining with Congo Red. Subhymenium 15-30
um thick of textura intricata to porrecta, gelatinized in immature specimens, hyphae
irregular, thread-like and loosely interwined with each other. Hymenium 200-390
um tall, with interspread setae present. Setae sometimes dark, tortuose, thick-walled,
exceeding the hymenium by 22-40 um. Asci long cylindrical, (61.6—)250-430(-460)
x 10-30(-40) um, thick-walled, walls 2 um thick; with 8 spores located in the top 2/3
on the ascus, round at the base and abruptly contracted into a basal hyphal appendix,
appendix 6-24(-40) x 2-6(-10) um. Ascospores uniseriate, ellipsoid to broad elliptic
fusoid to subfusoid, somewhat asymmetrical, sometimes one end more pointed and the
other rounder, with more or less projecting apiculi at the poles, subhyaline under the

162

Figure 7. Cookeina speciosa. A. Cross section of an apothecium, bar = 120 um. B. Ascospores,
bar = 10 um. C. Cross section showing outer layer of the excipulum, bar = 25 um. D. Portion of
hymenium with setose paraphyses, bar = 10 um. Yutajé, Venezuela; T: Iturriaga & K. Samuels, 4A-
D4; 4 Jul -7Jul 1997 (FH).

microscope, thick-walled, wall 1 um thick, with 0-2(-multi) guttules, mostly with two
large central guttules and numerous smaller oil drops, at maturity appearing striate from
the presence of fine, rarely anastomosing paralled striate low ridges 1(-2) per um, spores
20-36 x10-18(-20) um. Paraphyses filiform, thread-like, delicate, simple or branching,
anastomosing and forming a network of thin, septate, hyphae, sometimes with irregular
peg-like and one-sided swellings at their middle, more profusely branched at their
apex, ending in rounded clavate tips up to 3 um diam, containing fine granules; same
height as the asci, or exceeding them slightly, (1-)2-3 um wide in the middle, 1-5(-7)
tum wide at the apex.

SUBSTRATE: on wood, on fallen logs, twigs or branches.

DisTRIBUTION: Distributed throughout the tropics in both the new and the old
world. |

ILLUSTRATIONS: Plumier (1705) tab. 168, fig. C; Berkeley (1842) as Peziza hindsii, pl.
15; Berkeley (1852) as P. hindsii, tab. 15, fig. 4; Fries (1860) as Peziza afzelii, pl. 12, fig.

163

28; Cooke (1874) as P. hindsii, plate 27, fig 3; Cooke (1879) as Peziza sulcipes fig. 199, as
P. hindsii fig. 200; Cooke (1892) as Trichoschypha hindsii, fig. 153; Hennings (1892) as
Pilocratera engleriana, pl. VI, fig. 9 a, b; Seaver (1928, 1942) as C. sulcipes, pl. 18, fig.1;
Le Gal (1953) as C. sulcipes, figs. 114-119; Rifai (1968) as C. sulcipes, figs 18-20; Nagao
(1997) as C. sulcipes, fig. 1; Vooren & Lopez (2002) fig. 2; Melendez-Howell et al. (2003)
as C. sulcipes, fig. 1, 3-5, 7.

Notes : Peziza speciosa was based on Plumier’s Tab. 168 Fig C, as pointed out by
Dennis (1994). Prior to Dennis's observation this species was generally known under
the name C. sulcipes and C. hindsii. The number of synonyms for this species is no
doubt related to the diffuse mycological literature of the early to mid 19" century and
also to the variability of this species in hymenial color. In an ITS sequence analysis all
collections referred to C. speciosa fall within a monophyletic clade. Within that clade
there is phylogenetic structure that indicates some genetic variation that correlates as
well with color differences. It is perhaps best to consider this as a species complex until
such time as more complete population studies are done. This and Cookeina tricholoma
are the most common species of the genus in most parts of the tropics. The hairs in rows
at the margin of the disc serve to distinguish this species from C. tricholoma.

For those who might wish to segregate color forms the following guide to the
application of names might be followed: 1) Pilocratera engleriana is the oldest name for
an orange-yellow species. It has not been combined in Cookeina. 2) Peziza javanica and
Peziza amoena were both described in the same publication, one from Java and one from
Guiana but both were described as yellow. 3) fawn or darker forms from Africa were
referred to as C. sulcipes var. fusca. Our morphological studies did not find distinctions
in size of asci, ascospores or apothecia to warrant recognition of these taxa.

GENERAL NOTES: In parts of Mexico C. sulcipes is used as a food as summarized by
Villarreal & Pérez-Moreno (1989) and is listed among those fungi known and used by
indigenous people in Mexico (Chacon 1988). It is used medicinally in Cameroon, Africa
(Dijk et al. 2003).

SPECIMENS EXAMINED. AFRICA. CAMEROON: Zenker Nr. P41, from alcohol (B),
Zenker, Aus der Alkoholsammlung, P41 (B) [holotype of Pilocratera engleriana];
Mount Cameroon (IDENAU. lava floco) on leaf litter, coffee colour from transparencies
inside packet, 1922, Alt (m): 2, S. Dawson 45, K (M): 57300. LIBERIA. CENTRAL
PROVINCE: Gbanga, 20 Sept 1926, D. H. Linder 726 (FH); 7 Sept 1926, D. H. Linder
392 (FH); as above, 23 Sept 1926, D. H. Linder 392 (FH); Kassa Ta, 29 Sept 1926, D.
H. Linder 392A (FH); Mount Barclay, 20 Jul 1926, D. H. Linder (FH); Pehata, 8 Oct
1926, D. H. Linder (FH); UGANDA: Uganda Protectorate, decaying log. [400 Ft], Mt.
Nayge, greyish ochre, abril 1916, R. Dummer 2845 (K). BRAZIL. AMAZONAS: On
rotten wood, June 1901, 2811 (FH). CHINA. YUNNAN: Monlin, Hsichuang Panna
Autonomous Prefecture of Tai Nationality, on rotten wood, 17 Oct 1980, Zang Mu 7240
(FH); Xishungbanna, Menlen, ex situ of endangered plants area, 500m alt, on rotten
wood, 25 Oct 1988, Zang Mu 11532, 20381 (HKAS). COLOMBIA. MAGDALENA: San
Sebastian, Ruth Aldava 296 (FH). COSTA RICA. Cartago, Forest of Turrialba Instituto,
1700 ft, 17 Sept 1964, W. C. Denison, et al. 2354, 2359, 2360, 2363, 2364 (=OSC 21542,
21547, 58562, 67758, 67760); as above, on stick, 19 Sept 1964, Denison, et al. 2389 (=
OSC 67770); as above,1700ft, 19 Sept 1964, Denison, et al. 2394 (= OSC 67772); LIMON
PROVINCE: Finca Castilla, 30m, 23, 25, 26, 29 Jul 1936, C. W. Dodge & V. E Goerger
9314 (FH); Guapiles, Finca Diamante, on dead wood, 18 Sep 1964,. Denison, et al. 2376

164

(= OSC 67767); as above, 400ft, on dead wood, 18 Sept 1964, W. C. Denison, et al. 2375,
2376, 2386 (= OSC 21516, 67766, 67768); as above, 700ft, dead stick, 18 Sept 1964,
Denison, et al. 2386 (= OSC 21548); Portete, 50ft, sticks, 26 Aug 1964, Denison et al.
2111 (= OSC 67717); Westphalia, 10ft, 26 Aug 1964, Denison et al. 2118 (= OSC 67719);
PUNTARENAS: Coto, United Fruit Co., Finca 59, 75ft, on limb, 3 Oct 1964,. Denison
2462 (= OSC 67784, 21531); as above, on rotting wood, 3 Oct 1964, Denison 2453
(= OSC 67781, 21549); as above, 75ft, dead wood, 3 Oct 1964, Denison 2452 (= OSC
67780); as above, 75ft, 3 Oct 1964, Denison, et al. 2454 (= OSC 67782); Golfito, Ravine
back of Balneario, rotting wood, 2 Oct 1964, W. C. Denison 2448, 2449 (= OSC 21512,
21550, 67777, 67778); Above Golfito, 150ft, on rotten wood, 29 Aug 1964, Denison et
al. 2158 (= OSC 67720, 21530); Gorge back of Golfito, 150ft, dead wood, 30 Aug 1964,
Denison, et al. 2162 (= OSC67723, 21544); Hills above Golfito, 200ft, stick, 30 Aug 1964,
Denison, et al. 2179, 2181 (= OSC 67726, 67727); Guanacaste, Tilaran, 1700ft, rotten
limb, 15 Sept 1964,. Denison, et al. 2330 (= OSC 67753, 21517); as above, Rotting wood,
15 Sept 1964, Denison et al. 2329 (= OSC 67752); Alajuela, hot springs near La Marina,
1400ft, branch on ground, 11 Sept 1964, Denison et al..2262 (= OSC 67742); as above.
1500ft, rotting wood, 11 Sept 1964, Denison et al. 2257, 2258 (= OSC 21518, 67739);
Palmar Norte, 200ft, 30 Aug 1964, Denison, et al. 2186 (= OSC 67729. 21532); Gorge just
north of Palmar Norte, 175ft, 31 Aug 1964, Denison, et al. 2195 (= OSC 67731, 21515);
as above, 175ft, stick, 31 Aug 1964, Denison, et al. 2197 (= OSC 67732); PanAm Highway
north of Palmar Norte, 200ft, on stick in cacao plantation, 1 Oct 1964, Denison 2444 (=
OSC 67774); San Jose, University of Costa Rica, 3500ft, standing dead tree, 25 Aug 1964,
W. Westman, Denison 2109 (=OSC 67716, 21521). CUBA. 1856-7, C. Wright (FH); C.
Wright (FH). DOMINICAN REPUBLIC. SEIBO: Canada Hondo, on dead sticks, Nov
1946, R. A. & E. S. Howard (FH); Higuey, on fallen logs in dense woods, Nov 1946, R.
A. & E. S. Howard (FH). FRENCH GUIANA: Vicinity of Cayenne, taken from material
in 418, 1921, W. E. Broadway 418b (FH). GUATEMALA. ‘Alsacia’ Mountains, 1200ft, in
wet ravine, 17 Jul 1936, Winslow Hatch 411 (FH). GUYANA. Plantation Vryheid, 2 Feb
1924, D. H. Linder 843 (FH); Bartica, 9 Dec 1923, D. H. Linder 464 (FH). JAMAICA.
Portland, Blue Mountains, Stony River Base Camp, 1250ft, in woodland, on scree, on
fallen branch, 13 Dec 1973, B. D. Morley & C. Whitefoord 505 (FH); Jul 1902 (FH); Port
Antonio, Road to Park Mount, 6 Feb 1906, A. E. Wight 218 (FH); St. Margaret's Bay, 26
Feb 1906, A. E. Wight (FH). PANAMA. Barro Colorado Island (FH); On spring palm
stem, 12 Dec 1928, W. H. Weston 3298 (FH); Dec 1928 (FH); Canal Zone, trail below
Madden Dam, 250ft, on branch, 7 Oct 1964, Denison 2465, 2466 (=OSC 67787, 67788,
67792, 21541); Las Cruces Trail, 400ft, on rotting wood, 7 Oct 1964, Denison 2471, 2474
(= OSC 67790, 67792). PAPUA NEW GUINEA: Kumusi River, 1859, W. Fitzgerald
58274 (K); New Ireland, R. B. N. 58275 (K). PHILIPPINES. ISABELA PROVINCE:
Luzon Island, Planan, Sitio Dipaguiden, Branagay San Isidro, on decayed log in shade,
16 Apr 1991, Benito C. Tan 361 (FH); Laguna, Los Banos, on dead wood, 24 Oct 1921, C.
G. Wells 11670 (NY); Island of Luzon, Los Bafios (Mt. Maquiling), Province of Laguna,
June-July 1917, 18329 (FH); On dead wood, 24 Oct 1921, Colin G. Welles (CUP 11683);
University of the Philippines Campus, College of Agriculture, on dead wood, Dec 1958,
Lewis A. Schafer (NY); Mud Spring, on wood, 24 Nov 1966, Denison 3938 (= OSC 24423);
as above, Dead branches, 27 Nov 1966, Denison 4730 ( = OSC 28876); as above, Wood,
24 Nov 1966, Rebeca de Guzman, Denison 3943 (= OSC 24418); as above, On dead
logs, 23 Aug 1966, Denison 4706 (= OSC 27971); Quarry, in bark of dead wood, 13 Oct
1966, Denison 3940 (= OSC 24421). SURINAM. Tafelberg, 390m, 11 Aug 1944, Bassett
Maguire 24312 (FH). TRINIDAD. Arima, Verdant Vale, 1913, R. Thaxter (FH); Arima
Valley, Jan 1975, Sylvia Stein (NY); 1879, Rev. M. J. Berkeley 35303 (K); Maravel Valley,

165

on wet decaying wood at border of brook, 18 Aug 1923, D. H. Linder 66 (FH); Port
of Spain, 1912-13, R. Thaxter 3698 (FH); 1913, R. Thaxter 3699 (FH). VENEZUELA.
AMAZONAS: Oeste del Cafio Yutajé, 1km NE del Campamento Yutajé, Bosque de las
Ceibas, pie de monte, 5°35’N, 66°10’O, tronco muerto, 21 Jun 1996, Teresa Iturriaga
y colaboradores 2721, 2722, 2723 (USB); NE del Campamento Yutajé, Bosque en el
lado norte del rio Yutajé, 5°36°51”N, 66°6’85” W, madera muerta, 15 Jun 1996, Teresa
Iturriaga y colaboradores 2596 (USB); Yutajé, Bosque primario donde esta localizada la
parcela “FEX, madera en descomposicion, 17 Jun 1996, Teresa Iturriaga y colaboradores
2610, 2612, 2613 (USB); Yutajé, 80 collections by K. Samuels as part of an ecological
study, 4 Jul -7Jul 1997 (FH, USB); BOLIVAR: Sifontes, Tumeremo, Carretera Tumeremo
— Bochinche, Campamento maderero de INTECMACA, orillas del Rio Botaramo, sobre
tronco, 17-19 Nov 1994, T. Iturriaga, L. Bracamonte, L. Ryvarden, O. Holmquist 2167,
2170, 2180, 2185 (USB); MIRANDA: Parque Nacional Guatopo, 10°03’N, 66°26’ W, 500-
600m, on decorticated wood, 27-30 Nov 1990, G. J. Samuels, B. Hein, S. M. Huhndorf
7680 (FH); G. J. Samuels, B. Hein, S. M. Huhndorf 7681 (FH).

Cookeina tricholoma (Mont.) Kuntze, Revis. Gen. Pl. 2: 849.1891. Figs. 1 A, B, 2
= Peziza (Lachnea) tricholoma Mont., Ann. Sci. Nat. Bot. II 2: 77. 1834 !! = Lachnea
tricholoma (Mont.) Pat., Bull. Soc. Mycol. France 4: 98. 1888. = Trichoscypha tricholoma
(Mont.) Sacc., Syll. fung. 8: 160. 1889. = Pilocratera tricholoma (Mont.) Henn., Bot.
Jahrb. Syst. 17: 9. 1891.
= Peziza tricholoma [var.] & minor Mont., Ann. Sci. Nat. Bot. II 2: 77. 1834.
= Peziza hystrix Berk. Ann. Mag. Nat. Hist. II 9: 201. 1852 !!
= Pilocratera tricholoma var. celebica Henn., Monsunia 1: 33. 1900.
= Peziza medusina Speg. Anales Mus. Nac. Hist. Nat. Buenos Aires II 1: 78. 1902 !! =
Pilocratera medusina (Speg.) Sacc. & D. Sacc., Syll. fung. 18: 32. 1906 !!

= Peziza (Sarcoscypha) striispora Ellis & Everh. Bull. Lab. Nat. Hist. lowa State Univ. 4:
69. 1896. = Sarcoscypha striispora (Ellis & Everh.) Sacc., Syll. fung. 14: 754. 1899.

Apothecia solitary or gregarious, deep cupulate, centrally stipitated to rarely subsessile,
frequently elongated on one side being then suboblique, leathery, receptacle and stipe
covered with long conspicuous hairs more abundant at margin specially in young
apothecia, when dry 7-25 mm tall and (5-)10 x 35(-50) mm diam, when rehydrated
20-25 mm tall. Receptacle when fresh 10-40 mm diam and 5-15 mm deep, paler than
the disc, orange to yellowish-orange, to reddish, to pinkish, to coral red; when drying
5-20 mm diam and light reddish-brown to beige, when rehydrated 10-35(-50) mm
diam, orange to yellow-ochraceus to yellowish brown. Stipe central or slightly eccentric,
slender, concolorous with receptacle, when fresh fleshy, white, orange-buff to salmon-
orange to beige, when dry tough, 2-35(-50) x 1-4 mm, cylindrical or compressed, with
hairs mainly present on the upper half, these being shorter than the ones in the receptacle.
Disc smooth, variable in color, concolorous with receptacle or lighter, when fresh pale
orange, to buff-orange to rose-orange, in old specimens nearly whitish, when rehydrated
light yellow. Margin enrolled in dry specimens, covered with abundant long conspicuous
hairs especially in young apothecia and by short hairs (tomentum). In young apothecia
the hairs form an in-curved border that close the apothecium. Hairs whitish (especially
in younger specimens) to brownish-yellow to brown, when dry cream-colored to beige,

166

fasciculate, darker at the base, covering all margin and receptacle, composed of septate
parallel hyphae 2-4 um wide, arising from the inner ectal excipulum and breaking though
the outer ectal excipulum at a right angle. Marginal hairs up to 7 mm long and up to 250
tum diam, twice as wide as the receptacle hairs, abundant, 2 per mm. Receptacle hairs
located on the upper 1/3 of the receptacle or covering it completely, 2-4 mm long and
64-90 um diam in the middle of the fascicles, widening up to 90-130 um diam at the
base. Hairs originate from the medullary excipulum and penetrate the ectal excipulum
extending obviously above the receptacle’s surface. Tomentum, of two types: 1) individual
monilioid processes that arise from the margin and also sparsely cover the receptacle,
these cells produce the pruinose appearance of the receptacle, these catenulate processes
composed of 3-5 short hyaline cells, cells 10-20 um diam, outermost cells with thick
and rugose brownish thick walls, hairs 40-80 x 7-10 um. 2) fused triangular-shaped
bundles of the catenulate (monilioid) cells present at the margin. Outer ectal excipulum
of a few layers of cells of textura globulosa to angularis, 10-72(-100) um wide, cells
arranged perpendicularly to the surface of the receptacle, cells 7-25 x (5.5—) 7-18(-20)
um. Outer cells with thick walls which are roughened become loose and grouped, giving
the receptacle a pruinose appearance. Inner ectal excipulum of loose textura intricata of
thin-walled hyphae oriented perpendicular to the receptacle’s surface, layer 30-60 um
wide, hyphae 2-4 um wide, no gel present. This layer is almost non-existent in wholly
mature specimens, but can be evident in young specimens, where some gelatinization of
this layer may be present as well. Medullary excipulum textura porrecta without gel of
160-200 um wide, parallel or seldom branching septate hyphae composed of long cells
with some spaces occasionally between them, hyphae of 2-7.5 um diam. Subhymenium
loose textura intricata, layer 40-60 um wide, hyphae up to 5-6 um diam. Hymenium
260-440 um thick. Asci cylindrical, with rounded blunt base, 255-390 x 10-30 um,
walls up to 2 um wide, connecting to short, narrow basal hyphae, 6-14(-30) x (1-)
4-6 um, with 8 ascospores. Ascospores uniseriate, elliptic-fusoid, apiculate at both
ends though one end frequently is more pointed than the other, subhyaline, (0-) 2 large
guttules and several smaller ones may be present as well; with an inner and outer wall,
at maturity distinct markings present, consisting of fine parallel longitudinal, low, ridges
which sometimes anastomose 1-2 per um, wall 1 um diam, 25-39 x 12-21 um, normally
restricted to the top 160-190 um of the ascus. The ornamentation is only seen in mature
spores. Paraphyses filiform, septate, hyaline, branched and frequent anastomosiing to
form a dense network, especially very profusely near the apex where they form short
erect branches and end in a compact layer, 1.5-4.5 um in the middle, enlarging at the
apex in a clavate shape to 2-6 ttm, exceeding the asci.

SUBSTRATE: On wood, on fallen logs, twigs or branches.

DisTRIBUTION: Throughout the lowland tropics, both new and old world. The species
has on occasion been collected in Florida.

ILLUSTRATIONS: Montagne (1834) as Peziza tricholoma, Plate 4, fig. 2; Cooke (1874)
as P. tricholoma, pl. 27, fig. 4, as P. hystrix pl. 27, fig. 12; Cooke (1879) as Peziza tricholoma
f. 202; Ferdinandsen & Winge (1910) fig. 4, page 218; Seaver (1913) fig. 1, 2; Seaver
(1928, 1942) pl. 18, fig. 2; Boedijn (1933) as C. tricholoma, fig. 2b, 3h, 4a, 4e; Le Gal
(1953) fig. 105-108; Dennis (1954) as C. tricholoma, fig. C; Gamundi (1959), fig. 1-8;
Denison (1967) fig. 3, 5-6; Rifai (1968) fig. 15-17; Dennis (1970) fig. 7U; Otani (1971)
plate 3 c, fig. 15, 16; Gamundi (1983) map 6, distribution map for neotropics; Weinstein

167

et al. (2002) fig. 3D; Vooren & Lopez (2002) fig. A; Melendez-Howell et al. (2003) fig
3e}7e—'g, 14.

NOTES ON TYPE SPECIMENS AND NOMENCLATURE: Montagne’s description of P
tricholoma is based on material from Brazil from the herbarium of Gaudichaud collected
in 1831/1832 around Rio de Janeiro and labeled no. 44. There are three collections at PC
that fit this information. All match the original description and all are labeled number
44, After examining the three collections we have selected one as lectotype because of its
good state of preservation and maturity.

Peziza tricholoma var. minor was described at the same time as P. tricholoma by
Montagne (1834), he mentioned that this variety was different from P. tricholoma
because it is almost glabrous with few setae “setis raris vel nullis” and that it is smaller.
From Montagne’ description, it is evident that 8 minor was collected in or at the vicinity
of Rio de Janeiro, Brazil. There is one collection in Montagne’s herbarium that does
not bear a collection number, collected by Gaudich, and it is from Rio de Janeiro. We
designate this collection as the lectotype of var. minor.

Peziza hystrix was erected by Berkeley (1852) in the belief that P tricholoma was a
smaller species, that the external surface was costate, and that the hairs in P. tricholoma
covered only the margin as shown in Montagne (1834) figure 2a (see list of illustrations
below). Montagne did mention that there were some hairs on the external surface, but
that these were mainly present, and in a higher number, at the margin. Cooke (1879)
examined Montagne’s specimen and found that the hairs covered the receptacle and
stipe. Having seen both Montagne’s and Berkeley's collections, Cooke concluding that P.
hystrix was a synonym of P. tricholoma.

Peziza (Pilocratera) medusina was considered to have smooth ascospores (Spegazzini
1902). We examined the type specimen of P. medusina and have observed striations
present on the ascospores. We conclude that this is a synonym of C. tricholoma, as
Gamundi (1959) had already stated.

GENERAL Notes: Cookeina tricholoma and C. speciosa are the commonest species of
Cookeina encountered. In parts of Mexico C. tricholoma is used as a food as summarized
by Villarreal & Pérez-Moreno (1989) and is listed among those fungi know and used by
indigenous people in Mexico (Chacon 1988). It is used medicinally in Cameroon, Africa
(Dijk et al. 2003). C. tricholoma can be easily distinguished by the more or less uniform
covering of hairs on the outer surface of the apothecium. Boedjin (1933) indicated that
ascospores are faintly rose in color, and that spore deposits of this species were pink.
Spore prints are not routinely made of discomycetes and so we do not have comparative
data on spore colors in other species. Alasoadura (1972) indicates that the hairs are
covering the “mouth” of the apothecium at night and early morning, that is, when
spore discharge is not appreciable, at other times the hairs point upwards leaving the
“mouth” of the cup open. Boedijn (1933) indicates that the ascospore has a thick inner
and a thinner outer wall; he observed that for a long time the outer spore wall remained
smooth, but when fully ripe, the outer wall shows a delicate longitudinal striation,
caused by low, sparingly anastomosing ridges. Melendez-Howell et al. (2003) have made
a comprehensive study of wall layers in asci, paraphyses and ascospores, as well as SEM
ascospore observations. They show that ascus walls in C. tricholoma are thick; that
there is a gel layer that covers the ascus, thinning out towards the apex, that there are
multiple randomly located germ pores on ascospores of C. tricholoma, and that the low

168

ridges that form the ascospore ornamentation have a slightly spinose surface (see list of
photographs below). They state that ascospores may be covered by the perispore, which
masks somewhat the ornamentation of the “paroi propre.’

SPECIMENS EXAMINED. AFRICA. CAMEROON: Sakbayene, 1926, Rev. Charles
Schwab (FH); June 1918, 28 (FH-Pat); Sur un bronc pourrissant dun Eryshrina
caralledenstrae, 1483 (FH-Pat); June 1918, 21 (FH-Pat); June 1918, 19 (FH-Pat).
CONGO: Nov 1893-Mar 1894, Dybowski (FH-Pat); LIBERIA: Gbanga, 20 Sept 1926, D.
H. Linder 727 (FH); Sept 1926, D. H. Linder 392 (FH). ARGENTINA. S/ramas muertas,
Misiones, Puerto Pampa, 8-4-1901, Leg. E. Kermes [holotype of Peziza medusina]
(Packet from LPS bears the number 28026) BRAZIL: Ad ligna, Rio de Janeiro, Brazil,
Gaudich. no 44 (PC), [lectotype of Peziza (Lachnea) tricholoma, designated by Iturriaga
& Pfister] (PC); Rio de Janeiro, 1831-33, 44, [isolectotype of Peziza (Lachnea) tricholoma,
designated by Iturriaga & Pfister] (PC); 1831-33, [isolectotype of Peziza (Lachnea)
tricholoma, designated by Iturriaga & Pfister] (PC); ad ligno, Rio de Janeiro, Exdono
Gaudichii, (as Peziza tricholoma) [lectotype of Peziza tricholoma var. { minor, designated
by Iturriaga & Pfister], Rio de Janeiro (PC), Crypt. Guyani 444, sur le petioles pourris de
P...carium vulgare, 890 (PC); Crypt. Guyani 444, 891 (PC); Guyani (PC); Amazonas,
Mowary, Jurua, auf vermodertom Hok, Sept 1900, 2812 (FH); Porto Novo, Sta. Catharina,
1978 (FH); on rotting log, bank of brook in shady gully, 5 Jan 1906, A. E. Wight 137 (FH);
St. Catharina, mar 1888 (FH). CHICALAPA. Sur le bois pourri dans les grandes foréts,
ils sous eouges ou violes et en forme de vase, Dec 1857, Sallé 303 (FH-Pat); JAVA: Iter
javanicum secundum, H. Zollinger 2042 (FH-Pat); Ile Sansos Hebrides, Jul 1906, Le Rat
12 (FH-Pat). CHINA. KWANGSI PROVINCE: Ta Chai Shan, 1933, S. Y. Cheo 2391
(FH); YUNNAN: Hsichuang Panna, Monlin, Calcareous Mountain, on rotten twigs, 3
Sept 1974, Zang Mu 1171 (FH); Mengla, on rotten wood, Zhuliang Yang 23238 ex HMAS
(FH); On wood, 1 Nov 1999, ex HMAS (FH). COSTA RICA. LIMON: Portete, 50ft, on
stick, 26 Aug 1964, Denison et al. 2112 (= OSC 67718); Guapiles, Finca Diamante, 700ft,
stick, 18 Sept 1964, Denison et al. 2387 (= OSC 67769); PUNTARENAS: Pan-American
Highway South of Buenos Aires, 430ft, in a ravine with waterfall, 29 Aug 1964, Denison
et al. 2160 (= OSC 67722); San Jose, 15 km. South of San Isidro del Gen., 1600ft, stick, 29
Aug 1964, Denison et al. 2159 (= OSC 67721); Guanacaste, El Silencio, 2500ft, on large
limbs, 15 Sept 1964, Denison et al. 2319 (= OSC 67751); San Vito, Oxan’s, 4000ft, on
sticks, 22 Oct 1964, W. C. Denison 2536, 2537 (= OSC 67794, 67795); Cartago, Turrialba,’
forest at Instituto, 1700ft, on wood, 17 Sept 1964, Denison et al. 2351 (= OSC 67754); as
above, Dead wood, 17 Sept 1964, Denison et al. 2352, 2357 (= OSC 67755, 67757);
Guanacaste, north of Puntarenas, 100ft, wood, 13 Sept 1964, Denison et al. 2285 (= OSC
67745); PanAm Highway, 100ft, on rotten wood, 13 Sept 1964, Denison et al. 2284 (=
OSC 67744); near Santa Cruz, 100ft, wood, 14 Sept 1964, Denison et al. 2295 (= OSC
67747); as above, Sticks, 14 Sept 1964, Denison et al. 2316 (= OSC 67750); Santa Cruz,
100ft, on rotten limbs, 14 Sept 1964, Denison et al. 2315 (= OSC 67749); Cana, 150ft, 13
Sept 1964, Denison et al. 2288 (= OSC 67746); Rio Pobrenos, 350ft, 13 Sept 1964, Denison
et al. 2306 (= OSC 67748); Alajuela, La Marina, Hot Springs, 1500ft, 11 Sept 1964,
Denison, Jiménez et al. 2256, 2261, 2264 (= OSC 67738, 67741, 67743); as above, On
stick, 11 Sept 1964, Denison, Jiménez et al. 2259 (= OSC 67740); as above, 1500ft, rotten
wood, 10 Sept 1964, Denison et al. 2252 (= OSC 67736); as above, On dead branch, 11
Sept 1964, Denison et al. 2255 (= OSC 67737); Alajuela, Buena Vista, Finca Ensayfa,
2800ft, 10 Sept 1964, Denison et al. 2246 (= OSC 67734); as above, On rotten wood, 10
Sept 1964, Denison, Jiménez, et al. 2247 (= OSC 67735); Gorge near Golfito, 150ft, on
sticks, 30 Aug 1964, Denison et al. 2163 (= OSC 67724); as above, 200ft, 30 Aug 1964,

169

Denison et al. 2183 (= OSC 67728); as above, 30 Aug 1964, Denison et al. 2168 (= OSC
67725); Golfito, near Hotel Balneario, 50ft, on rotten wood, 2 Oct 1964, Denison 2446 (=
OSC 67775); Ravine back of Balneario, 50ft, dead wood, 2 Oct 1964, Denison 2447 (=
OSC 67776); Coto, United Fruit Co., Finca 59, 75ft, wood, 3 Oct 1964, Denison 2451,
2455 (= OSC 67779, 67783); Palmar Norte, 175ft, 31 Aug 1964, Denison et al. 2192 (=
OSC 67730). CUBA. Trinidad Mountains, Sierra de San Juan, Mina Carlota, on log, 5 Jul
1941, W. L. White 722 (FH); Amazon Basin, 1000 ft, on old rotten log in forest, 19 Jan
1922, O. E. White 2358 (FH); C. Wright 664 (FH); C. Wright 665 (FH); C. Wright (FH-
Pat); C. Wright 657 (FH); C. Wright (FH); SANTA CLARA: Soledad, La Veguita de San
Antonio, 17-23 Aug 1935, D. H. Linder 72 (FH). DOMINICAN REPUBLIC. On dead
wood, Salle, no. 35, St. Domingo [holotype of Peziza hystrix] (K); Seibo, on humus in
deep woods, Nov 1946, R. A. & E. S. Howard (FH). FRENCH GUIANA. Vicinity of
Cayenne, on ground beneath trees, 6 Jul 1921, W. E. Broadway, 692 (FH). GUADELOUPE.
Capesterre, 100-250 m, on twig in banana plantation, 10 Jan 1974, D. H. Pfister, S.
Carpenter, M. Sherwood 1190 (FH); Pointe-Noire, sur les peliles branches pourries, 61
(FH-Pat); Sur un morcean bois pourri d'un Cheobroma Cacao, Duss 980 (FH-Pat); Sur
un branc pourri de Megrisleca moscati, Duss 998 (FH-Pat); Sur un éclas de bois
pourrissant, 1902, Duss 623 (FH-Pat). GUATEMALA. Alta Verapaz, on decaying fallen
log, 27 Jul 1936, Winslow Hatch 413 (FH); Los amates, ‘Alsacia’ Mountains, on decaying
wood, 17 Jul 1936, Winslow Hatch 412 (FH). GUINEE FRANCAISE. Simbaia, 20 Apr
1909, Duport (FH-Pat); St. Domingo, 58273 (K). GUYANA. Bartica, Dec 1923, D. H.
Linder (FH). INDIA. KERALA: Wynad, Periya Reserve Forest, on fallen twigs on forest
floor, 23 Aug 1984, P Manimohan (FH). INDONESIA. JAVA: Tjiboya 2042 (FH-Pat) [as
Peziza aurantia var. stipitata]; Iter javanicum secundum, H. Zollinger 2039 (FH-Pat).
JAMAICA. 1909, A. E. Wight (FH). MEXICO. Circa le Alagirines, S.L.P. 11 Aug 1891,
7084 (FH-Pat). VERACRUZ. Sur des branches de bois mort 4 terre dans la forét, Oct
1854, Sallé 50 (FH-Pat). OUBANGUI. 1891, Dybowski (FH-Pat); Bois mort, 1891,
Dybowski (FH-Pat). PANAMA. Canal Zone, on dead log, 8 Oct 1946, N. L. H. Krauss 76
(FH); Canal Zone, Las Cruces Trail, 7 Oct 1964, Denison 2475 (= OSC 67793); as above,
Dead wood, 400ft, 7 Oct 1964, Denison 2473 (= OSC 67791); Alahuela, Madden Dam,
Azote Caballo Road, 90-100m, 27 Nov 1934, C. W. Dodge 8952 (FH); Trail below
Madden Dam, 250ft, stick, 7 Oct 1964, Denison 2463, 2464 (= OSC 67785, 67786);
Madden Dam, 250ft, 7 Oct 1964, W. C. Denison 2467 ( = OSC67789); Sabanas near
Chepo, 30m, 20 Jan 1935, A. A. Hunter & P. H. Allen 8584 (FH); Barro Colorado Island,
Seephot 3385 (FH);. PHILIPPINES. RIZAI: Luzon, Aug 1913, M. Ramos 21945 (FH);
Luzon, Mt. Maguiling, on dead wood, 4 Oct 1920, Medina 10291 (FH-Pat); 26 Oct 1920,
R. Reyes 10408 (FH-Pat); 25 Oct 1920, P Malabassan 10444 (FH-Pat); 23 Sept 1917, S.
Marquez 3393 (FH-Pat); Oct 1920, O. A. Reinking 10269 (FH-Pat); 24 Oct 1920, F
Bernardo 10446 (FH-Pat); 20 Oct 1920, A. Abesamis 10417 (FH-Pat); 29 Aug 1917, R.
Reyes 3324 (FH-Pat); 30 Aug 1917, S. Marquez 3393 (FH-Pat); 25 Oct 1920, P Malabassan
10459 (FH-Pat); 11 Oct 1920, PR Lisou 10295 (FH-Pat); Mud Spring, along trail, 27 Aug
1966,. Denison 4728 (= OSC 28874); Mt. Mekiling, Decaying bark of palms, 8 Oct 1966,
B. D. Ona, Denison 3946 (= OSC 67797). PUERTO RICO. Rio Sabana, 65°43’30”W
- 18°21’N, on partially buried twigs, 17 Jan 1996, D. H. Pfister, FA. Harrington, D. J. Lodge
(FH); On decaying wood, 17 Jan 1996, D. H. Pfister & F. A. Harrington (FH); On decaying
wood, 17 Jan 1996, D. H. Pfister & FE. A. Harrington (FH); Rio Pedras, 19 Dec 1911, J. R.
Johnston 173 (FH). TRINIDAD. Port of Spain, on partly submerged wood, 8 Aug 1923,
D. H. Linder 32 (FH); Port of Spain, 1912-1913, R. Thaxter 3734 (FH); Port of Spain,
Maraval, 1912, R. Thaxter (FH); St. Anne's Valley, on dead wood, 22 Aug 1923, D. H.
Linder 106 (FH); R. Thaxter (FH); 1913, R. Thaxter 3802 (FH). USA. FLORIDA: Dade

170

County, Castellow County Park, on sticks, 10 Oct 1997, J. Trappe 19953 (= OSC 60205).
VENEZUELA. AMAZONAS: Yutajé, 5-7 Jul 1997, K. Samuels, 18 collections in USB;
Oeste del Cafio Yutajé, 1km NE del Campamento Yutajé, Bosque de las Ceibas, pie de
monte, 5°35’N, 66°10°O, rama Muerta, 21 Jun 1996, T: Iturriaga y colaboradores 2705
(USB); Madera en descomposicion, 21 Jun 1996, T. Iturriaga y colaboradores 2738 (USB);
21 Jun 1996, T. Iturriaga y colaboradores 2738 (USB); 21 Jun 1996, T. Iturriaga y
colaboradores 2705 (USB); SOLANO: San Carlos trail, 100-130 m, on dead branches,
1959, J. J. Wurdack & L. S. Adderley 43401 (FH); Tobagan de la Selva, Caho Coromoto,
75m, on a rotten trunk, 17 Oct 1988, G. A. Romero 1772 (FH); Entre Maypures et San
Fernando, sur branche pourrie, Aug 1887, 242 (FH-Pat); Entre Maypures et San
Fernando, 27 Aug 1887, Gaillard 243 (FH-Pat).

Cookeina venezuelae (Berk. & M.A. Curtis ex Cooke) Le Gal, Prodr. Flore Madagascar
4: 241. 1953. Figs. 1 F, 2,8
= Peziza venezuelae Berk. & M.A. Curtis ex Cooke, Mycographia p. 120. 1875! = Phillipsia
venezuelae (Berk. & M. A. Curtis ex Cooke) Massee, J. Linn. Soc. 31: 473. 1896.
= Discina pululahuana Pat., Bull. Soc. Mycol. France 9: 145. 1893!
= Discina epixyla Pat. in Duss, Enumération méthodique des champignons recueillis a la
Guadeloupe et a la Martinique p. 63. 1903!, !! (paratype)

Apothecia solitary to clustered, slightly to deeply cupulate, sessile to subsessile, when
fresh up to 30 mm diam, when dry up to 20 mm diam. Receptacle concolorous or slightly
lighter than the disc, frequently drying in a venose, convoluted-cerebriform ribbed
pattern, more evident at the base of the receptacle where it shows a ribbed or venose
pattern; apparently smooth but when closely examined minutely pubescent, and under
the dissecting scope one observes that it is covered by a fine tomentum. Stipe present or
lacking (sessile), when present central or slightly excentric, obconic, very short, 1-3 x 2
mm, concolorous to receptacle. Disc glabrous; when fresh, salmon to rose pinkish, when
dry, cream colored to beige to light yellowish to ochraceous to light brown. Margin with
1-4 low circumferential ridges, which become more evident when dry, when rehydrated
only uppermost ridge remains evident; under magnification appearing downy, and
under the compound microscope there are evident short bundles, each bundle 30-120
um long by 20-50 um wide at the base, by 10-20 um wide at the apex, each composed
of several monilioid processes that cluster together; each monilioid process is formed
by 4-5 round to ellipsoid cells in a filament, terminal cell of the filament round or
tapering to a blunt point, cell walls thick and rugose due to encrustation or deposition,
cells 60-70 x 10 um. These bundles are more evident on the uppermost ridge of the
margin. Outer ectal of the following: a) occasional groups of 5-12 thick-walled globose
or elongate cells which extend to form pustules b) 2-celled short hairlike processes with
globose, clavate or pyriform terminal cells c) monilioid filamentose hairlike processes
composed of 3-5 round to ellipsoid cells; the two last ones (b & c) extend to form short
hairs or “hairlike processes” as seen on the receptacle surface under a hand lens or
dissecting scope 2) Inner ectal excipulum gelatinized, 66-88 um thick, hyphae 1.5-4 um
in diameter, parallel to one another, but perpendicular to the outside of the apothecium
and surrounded by refractive gelatinous material, which does not stain in cotton-blue
lactophenol. Medullary excipulum 80-90 um thick of textura porrecta with hyphae
parallel to one another and also parallel to the outer surface of the apothecium, 3.0-

171

Figure 8. Cookeina venezuelae. A. Cross section showing outer layer of the excipulum, bar = 50 um.
B. Schematic representation of ascospores with longitudinal and transverse markings, bar = 10 um.
Haut Matouba, Guadeloupe, FWI; 9 Jan 1974, D. H. Pfister, S. Carpenter, M. Sherwood 1161 (FH).

3.5 um in diam. Subhymenium textura intricata to porrecta, not a well defined layer.
Asci cylindrical, base round to slightly tapering, 275-550 x (10—) 20-30 um, abruptly
rising from thin basal hyphae (8—)12-32(-38) x 2-6 um, 8 spores located at top 1/2 of
the ascus. Ascospores elliptic fusoid, apiculate at each end, bilaterally symmetrical or
asymmetrical, pale yellow, (24—)30-43 x (9.0—)14-18 um, ornamentation consisting of
few longitudinal ribs separated 3-4 um from each other, and these connected by many
fine transverse interconnecting ridges, (0-—)2(-3) large central guttules surrounded
by smaller ones towards both ends, uniseriate. Paraphyses filiform, septate, simple to
branching, highly anastomosing, forming an interconnecting network, 2-5 um diam in
the middle, sometimes slightly enlarging at apex to 5 um diam. Excipulum of textura
globulosa to angularis, 3-5 cells thick, cells 6-20(—24) um diam, radially arranged, outer
layer of cells giving rise to one or several

SUBSTRATE: On decorticated wood, on wood and branches.

DISTRIBUTION: Known from Central America, northern South America (Venezuela
is the type locality of P. venezuelae), Jamaica, Puerto Rico and Guadeloupe (type locality
of D. epixyla).

ILLUSTRATIONS: Cooke (1875) pl. 69, fig 305; Cooke (1879) tab. 69, fig. 305. Cooke
(1879) as Peziza venezuelae f.; Massee (1896) as Phillipsia venezuelae, tab. 16, fig. 4-5;
Seaver (1928, 1942) as Cookeina colensoi, pl. 17, fig. 3; Le Gal (1953) fig. 109; Dennis
(1954), fig. G; Gamundi (1957), Lam. H; Denison (1967) fig. 2, 4; Dennis (1970), fig.
7W; Pfister (1974), Fig. 1; fig. 9-11; Gamundi (1983) map 6, distribution in neotropics;
Weinstein et al. (2002), fig. 3C.

NOTES ON TYPE SPECIMENS AND NOMENCLATURE: Some apothecia of the holotype
of Peziza venezuelae (K) are sterile, but at least one of the apothecia is fertile, in good
condition and many ascospores were seen by Le Gal (1953) and by us. Several parts of
Fendler’s original collection exist. One in the Sprague Herbarium (FH) is immature, a
collection in the Ellis Herbarium (NY) is mature and these are assumed to be parts of
the same gathering and are presumed isotypes.

Some commentary on the names listed among the synonyms may aid further
investigators. The holotype material of Discina pululahuana is housed at FH but is

E72

in poor condition; therefore it is recommended that the slide that accompanies this
specimen be examined. We confirmed that tissues and striate ascospores are identical
to those of C. venezuelae as was suggested by Pfister (1974). Two specimen numbers are
mentioned in the original description of D. epixyla, 249 and 527 and both specimens
are in FH. We designate here specimen number 249 as the lectotype of D. epixyla,
since number 527 is immature. The designated lectotype has a drawing by Patouillard
of three ascospores on the packet. Patoulliard (in Duss 1903) noted that this species
was very close to D. pululahuana, mentioned above, the differences being that the latter
had larger ascomata and ascospores, as well as a reddish color. This was confirmed in
examination of material, our measurements of ascospores of D. pululahuana are 40 x 14
(though they are described as 35-42 x 12-16 um) and D. epixyla is reported as being
33 x 13-15 um. We consider these differences irrelevant. Dennis (1954) first suggested
that D. epixyla might be a synonym. Pfister (1974) examined Patouillard’s specimen and
proved that Dennis was correct.

GENERAL Notes: Seaver (1913,1928) treated this species as Cookeina colensoi.
Le Gal (1953) pointing out that the ascospores of C. colensoi are smooth whereas
those in C. venezuelae are distinctively marked with longitudinal ribs as Seaver has
described for West Indian collections. Korf (1971, 1973) placed C. colensoi in the genus
Boedijnopeziza, a previously monotypic genus. Based on a study of the specimens Korf
had at hand, Pfister (1974) determined that Korf, like Seaver had confused C. colensoi
and C. venezuelae. This is understandable since both species are hairless and have
stipes. Both also have gelatinous material in the inner ectal excipulum. ‘The recognition
of the genus Boedijnopeziza has not been accepted by Le Gal (1953), Denison (1967),
Pfister (1974), Pfister & Kaushal (1984) and Weinstein et al. (2002). Le Gal states that
the shape and size of ascospores in C. venezuelae and C. colensoi are similar, but there
are differences between them with regard to the ornamentation and appiculations. The
spores of C. colensoi are smooth and have apiculate ascospores; C. venezuelae has striate
non-apiculate ascospores. Le Gal illustrates C. venezuelae ascospores as narrowing at
the poles, but with no apiculum present, whereas her illustrations of C. sulcipes, and C.
colensoi show apiculi formed by a [stated by her as a mucilaginous] perispore. In some
cases the perispore layer is uniform as Le Gal states, but we disagree with her, since we
have observed that in other cases the perispore layer thickens clearly at the poles forming
apiculi (one at each end) which seem to be formed by wall material and not gel.

SPECIMENS EXAMINED. COLOMBIA: Trail between Hacienda Cincinnati and
Jamonical, 100-1250m, 12 Aug 1935, G. W. Martin 3312 (NY). ECUADOR. Sur la
terre [probably on buried wood or wood fragments], Cratére de Pululahua, Lagerheim,
Equador, Feb 1892 (holotype of Discina pululahuana) (FH-Pat). GUADELOUPE: Sur
loutes sartes de branches mortes, Bois de la Riviére Saint-Louis, Guadeloupe, Février
1901, Duss 249, [Lectotype of Discina epixyla] (FH-Pat); Camp Jacob, sur bois pourri
jeune coffee arabica, Fev 1902, 527 [paratype of Discina epixyla] (FH-Pat) [as Peziza
peut-étre Discina epixyla]; Haut Matouba, Victor Hughes Trail, 700-1071m, on twigs
and fallen branches, 9 Jan 1974, D. H. Pfister, S. Carpenter, M. Sherwood 1161 (FH);
Grand Matouba, Victor Hughes Trail, 700m, on twigs, 8 Jan 1974, D. H. Pfister, S.
Carpenter, M. Sherwood 1107 (FH); Saint Claude, Camp Jacob, 500-550m, on twigs and
larger pieces of wood, 7 Jan 1974, D. H. Pfister, S. Carpenter, M. Sherwood 1033 (FH);
Montagne de St. Louis, 1902, P Duss (NY). JAMAICA. Chester Vale, 3000-4000ft, 21-24
Dec 1908, W. A. Murrill & Edna L. Murrill 349 (NY); Chestervale, 3000ft, 7 Feb 1903,

173

L. M. Underwood 1160 (NY); Morce’s Gap, 5000ft, 29-30 Dec 1908, 2 Jan 1909, W. A. &
Edna L. Murrill 669 (NY), infertile but with asci; Rose Hill, 3500ft, on dead wood, 20
Oct-24 Nov 1902, E S. Earle 51 (NY); On wood, along trail between Woodcutter’s Gap
and ruins of Major Wallin’s House, vicinity of Newcastle, Portland, Parish, 9.1.1971, R.P.
Korf et al. (CUP-MJ-139); On twigs, along Lady’s Mile Trail to just south of Woodcutter’s
Gap, vicinity of Newcastle, border of St. Andrew and Portland Parishes, 9.1.1971, R.P
Korf et al. (CUP-MJ-146, CUP-MJ-176); along Ulster Road Trail, Newcastle, St. Andrew
Parish, 9.1.1971, R.PKorf et al. (CUP-MJ-197); On wood, Cecropia peltata and other
substrates, Chesterville Youth Development Camp, above Newcastle, St. Andrew Parish,
8.1.1971, R.PKorf et al. (CUP-MJ-1, OSC 30140); On wood, near Dick’s Pond, west
of Hardwar Gap, near Holywell Recreation Area, St. Andrew Parish, elev. 2800-3000;
11.1.1971, R.PKorf et al. (CUP-MJ-326); On twigs, Cinchona Botanical Gardens, St.
Andrew Parish, elev. 4750, 8.1.1971, R.PKorf et al. (CUP-MJ-53); On twigs, Cinchona
Botanical Gardens, St. Andrew Parish, elev. 4750; 8.1.1971, R.PKorf et al. (CUP-MJ-
47). PANAMA. CHIRIQUI: Llanos del Volcan, 1100-1200m, in forest, 13 Jul 1935, G.
W. Martin 2782 (FH). PUERTO RICO: Cordillera Central, Toro Negro, Mun. de Juan
Diaz, Long. 66°32’8” Lat. 18°9°10", on big log, 24 Jun 1996, S. A. Cantrell 3381 (FH).
VENEZUELA. On the ground, unlocalized, year 1855, Leg. A. Fendler 282, Venezuela
(holotype of Peziza venezuelae) (K); Venezuela, Fendler 282, (isotype of Peziza venezuelae)
Curtis Herbarium (FH); Fendler [probably an isotype of Peziza venezuelae, but with no
number, ], in an immature specimen with asci but no ascospores (Sprague Herbarium-
FH), ; Fendler (NY) [as Peziza venezuelae, Cookeina colensoi], [probably an isotype of
Peziza venezuelae, but with no number, ], Ellis (NY); AMAZONAS: Sobre ramita caida,
25 Oct 1997, T. Iturriaga 6065 (FH); ARAGUA: Maracay, Camino de Interpretacién de
la Naturaleza ‘Andy Fields, Parque Nacional Henry Pittier, Estacién Bioldgica Rancho
Grande, sobre corteza de madera, 24 Nov 1994, T! Iturriaga, L. Bracamonte, L. Ryvarden,
O. Holmquist 2257 (VEN); Maracay, Camino de Interpretacién de la Naturaleza ‘Andy
Fields, Estacién Biolégica Rancho Grande, Parque Nacional Henry Pittier. DISTRITO
FEDERAL: On unidentified mossy log, trail from Quebrada Mariperez, through Vivero
El Cuno and El Papelon to ca. 1 km. below Hotel Humboldt, El Avila, Parg. Nac. El
Avila, Dto. Fed., K.P Dumont (VE-6194), R.E Cain e& G.J. Samuels, 27.VI1.1972 (NY);
On unidentified wood, along trail 1-2 km above las [Los] Venados, El Avila, Parq.
Nac. El Avila, Dto. Fed., K.P Dumont (VE-5828), R.F. Cain, G.J. Samuels & B. Manara,
24.VII.1972 (NY); On unidentified wood, vicinity refugio “No te Apures’, south facing
slope of La Silla, Parg. Nac. El Avila, Edo. Miranda [Dto. Fed.], K.P Dumont (VE-3810),
GJ. Samuels & B. Manara, 30.V1.1972 (NY); On unidentified wood, between refugio
“No te Apures” and Quebrada Los Palos Grandes, south facing slope of La Silla, Parq.
Nac. El Avila, Edo. Miranda [Dto. Fed.], K.P Dumont (VE-3743), G.J. Samuels e& B.
Manara, 30.V1.1972 (NY). MIRANDA: Baruta, Sartenejas, sobre corteza rama caida,
Oct 1997, T. Iturriaga 6066 (immature), 6034 (FH); Baruta, Sartenejas, sobre corteza
rama caida, Oct 1997, O. del Guidice 6033 (FH).

174

Misapplied Names, Synonyms,
and Doubful or Excluded Species
GENERAL NOTE: There are many Trichoscypha species that are not accounted for in
this synonymy list. Most are combined in the genus Trichoscyphella, a genus of the
Hyaloscyphaceae.

abnormis - Pilocratera abnormis Peck, N. Y. St. Educ. Dept. Bull 495: 37. 1911.
This is on Betula in New York and is an inoperculate discomycete.
afzelii - Peziza afzelii Fr. = Cookeina speciosa
aluticolor — Peziza aluticolor Berk. = Cookiena colensoi
amoena — Peziza amoena Lév. = Cookeina speciosa
antillarum — Peziza venezuelae var. antillarum Pat. in Duss, Enum. Champ. Guadeloupe, p. 64.
1903. [sur le sol dans une caféyere FH) !
This is Phillipsia domingensis (Berk.) Berk.
beccariana — Peiza hindsii var. beccariana Ces. = Cookeina speciosa
argentinensis — Ciboria argentinensis Speg. = Cookeina colensoi
calyciformis — Trichoscypha calyciformis (Willd.) Grélet, Rev. Mycol. (Paris) (NS) 16: 87. 1951.
This is an inoperculate discomycete.
calycina - Trichoscypha calycina (Schumach.) Vuill., Bull. Soc. Mycol. Fr. 1: 117. 1885.
This is an inoperculate discomycete.
celebica — Pilocratera tricholoma var. celebica Henn. = Cookeina tricholoma
ciborioides — Geopyxis ciborioides Starback = Cookeina colensoi
colensoi — Cookeina colensoi (Berk.) Seaver sensu Seaver = Cookeina venezuelae
crocina — Peziza hindsii var. crocina (Mont. & Fr.) Cesati, Atti Reale Accad. Sci. Fis. 8: 11. 1878
[1879].
This small species, originally described from France as Peziza crocina is mostly likely
referable to a group of inoperculate discomycetes.
discifera — Cookeina discifera (Haszl.) Kuntze, Rev. gen. Pl. 849.1891 = Craterium disciferum
Hazsl., Verh. K.K. zool.- Bot. Ges. Wien 37: 167. 1887) = Trichoscypha discifera (Hazsl.)
Sacc., Syll. fung. 8:163. 1889 = Pilocratera discifera (Hazsl.) Sacc. & Traverso, Syll. fung. 20:
AZOLE ;
This is a species of Helvella judging by the illustration and since the material is from
Hungary, an unlikely location for a species of Cookeina to occur, it is excluded.
elata — Geoyxis elata Massee = Cookeina speciosa
engleriana — Pilcratera engleriana Henn. = Cookeina speciosa
epixyla - Discina epixyla Pat. = Cookeina venezuelae
fusca - Cookeina sulcipes var. fusca Alas. = Cookeina speciosa
fusispora - Sarcoscypha fusispora Sawada, Special Publication, College of Agriculture, National
Taiwan University 11: 49. 1959.
Published without a Latin description or diagnosis this is a nomen nudum that refers to
Cookeina insititia.
globosa — Cookeina globosa Douanla-Meli = Cookeina speciosa
This taxon was described and illustrated with a fringe of marginal hairs as in C. speciosa
but as having globose to subglobose ascospores. Our attempt to obtain the specimen
has been unsuccessful. Judging by the illustrations and descriptions it seems clear that
this species is based on immature specimens of C. speciosa. The spores are small 12-15 x

175

10-12 um and thin-walled. Since asci mature simultaneously it is often possible, with a
single collection as is the case here, to misjudge maturation. Without the specimen our
recourse has been to treat this as a synonym of C. speciosa.
hindsii - Peziza hindsii Berk. = Cookeina speciosa
hystrix - Peziza hystrix Berk. = Cookeina tricholoma
insititia — Peziza insititia = Cookeina insititia
javanica — Peziza javanica Nees ex Lév. = Cookeina speciosa
magnispora — Trichoscypha magnispora Lloyd = Cookeina insititia
maxima — Pilocratera maxima P. Syd. = Cookeina speciosa
minor — Peziza tricholoma var. minor Mont. = Cookeina tricholoma
medusina — Peziza medusina Speg. = Cookeina tricholoma
moelleriana — Geopyxis moelleriana Henn. = Cookeina colensoi
mundkurii — Cookeina mundkurii S. C. Kaushal, J. Indian Bot. Soc. 65: 405. 1986.
Specimens of this species have not been available to us for study. Based on the description
it is likely that this represents a collection of C. indica. It agrees with that species in
lacking obvious hairs, in the long ellipsoidal ascospores with longitudinal striations that
do not anastomose. The name C. indica (Pfister & Kaushal 1984) has priority and C.
mundkurii is considered a synonym.
notarisiana — Peziza notarisiana Bagnis, Atti Reale Accad. Lincei 8: 15. 1876- 1877. Trichoscypha
notarisiana (Bagnis) Sacc., Syll. fung. 8: 162. 1889. = Cookeina notarisiana (Bagnis) Kuntze,
Revis. gen. pl. 849. 1891. = Pilocratera notarisiana (Bagnis) Sacc. & Traverso, Syll. fung. 20:
413. 1910. ,
This is an inoperculate discomycete.
novoguianensis — Pilocratera novo-guianensis Ramsb. = Cookeina speciosa
pululahuana - Discina pululahuana Pat. = Cookeina venezuelae
sessilis — Ciboria sessilis Starback = Cookeina colensoi
sphaeroidospora - Boedijnopeziza sphaeroidospora Y. Otani = Cookeina insititia
striatospora — Geopyxis striatospora Maubl. & Roger
This is a nomen nudum; the description refers to Cookeina speciosa.
striispora — Peziza striispora Ellis & Everh. = Cookeina tricholoma
subfloccosa — Plectania subfloccosa Hazsl. Magyar. Discomyc., tab. 5 fig. 29 = Pilocratera subfloccosa
(Hazsl.) Sacc. & Traverso, Syll. fung. 20: 413. 1911.
sulcipes — Peziza sulcipes Berk. = Cookeina speciosa
sumatrana - Cookeina sumatrana Boedijn = Cookeina speciosa
tetraspora — Cookeina tetraspora Seaver, Mycologia 17: 45. 1925 = Phillipsia tetraspora (Seaver) Le
Gal, Prodr. Flore Mycol. Madagascar, 262. 1953. = Sarcoscypha tetraspora (Seaver) Denison,
Rev. Biol. Trop. 11: 107. 1963. = Nanoscypha tetraspora (Seaver) Denison, Mycologia 64:619.
‘72?
This species is the type species of Nanoscypha Denison (1972).
tricholoma — Peziza tricholoma Mont. = Cookeina tricholoma
viridirubescens — Trichoscypha viridirubescens (Bagnis) Sacc., Syll. fung. 8: 162. 1889. = Peziza
viridirubescens Bagnis, Atti Reale Accad. Lincei 8: 15. 1876-1877. = Cookeina viridirubescens
(Bagnis) Kuntze, Revis. gen. pl. 2: 849. 1891. = Pilocratera viridirubescens (Bagnis) Sacc. &
Traverso, Syll. fung. 20: 413. 1911.
This is an inoperculate discomycete.

176

Acknowledgments

This work was supported by NSF grants DEB-9521944 and DEB-0315940 to Donald Pfister and
by a grant from the David Rockefeller Center for Latin American Studies of Harvard University
which supported Teresa Iturriaga during an extended study leave at Harvard. We wish to thank
Richard N. Weinstein, for work done on the project during a post-doctoral fellowship, and Karen
Hansen, with whom we were able to discuss various aspects of the project. Richard Korf and Amy
Rossman reviewed a draft and Jack D. Rogers and Sharon Cantrell served as formal reviewers.
Shaun Pennycook provided us with valuable nomenclatural and technical advice. We thank Jens
Petersen, Thomas Lessge, and Roy Halling for photographs. We owe a debt to the curators of the
following herbaria who allowed access to specimens: B, BPI, CUP, K, NY, PC, OSC, PDD, S, USB,
VEN. The authors acknowledge the inspiration of Richard P. Korf, their professor at Cornell, to
whom they dedicate this paper.

Literature cited

Alexopoulos CJ, Butler EE. 1949. Conidia-like structures in Plectania coccinea. Mycologia 41:
180-182.

Alasoadudra SO. 1972. Studies in the higher fungi of Nigeria. IV. Some operculate discomycetes.
Nova Hedwigia 23: 767-780.

Arpin N. 1969. Les caroténoides d’Discomycétes: Essai chimiotaxinomique. Bull. Mens. Soc. Linn.
Lyon, Suppl. 38: 1-169

Bentham G, Hooker JD. 1862. Genera plantarum ad exemplaria imprimis in herbariis kewensibus
servata definita. Vol. 1(1). A. Black. London. Pp 1-434.

Berkeley MJ. 1852. Enumeration of some fungi from St. Domingo. Ann. Mag. Nat. Hist. series II.
9: 192-203.

Berkeley MJ, Broome CE. 1875. Enumeration of the fungi of Ceylon. J. Linn. Soc. 14: 29-140.

Berthet P. 1964. Essai Biotaxinomique sur les Discomycetes. Joanny Lorge. Lyon.

Bi Z-s, Zheng G-y, Li T-h. 1993. The Macrofungus Flora of China's Guangdong Province 734 p.
Hong Kong, Chinese University Press.

Boedijn KB. 1929. Beitrag zur Kenntnis der Pilzflora von Sumatra. Recueil. Trav. Bot. Néerl.
26: 396-439.

Boedijn KB. 1933. The genera Phillipsia and Cookeina in Netherlands India. Bull. Jard. Bot.
Buitenzorg. 13: 57-76

Boedijn KB. 1951. Some mycological notes. Sydowia 5: 211-229.

Boudier JLE. 1885. Nouvelle classification naturelle des discomycétes charnus connus généralement
sous le nom de pezizes. Bull Soc Mycol France 1: 91-120.

Cabello MN. 1988. Estudio sistematico del suborden Sarcoscyphineae (Pezizales, Ascomycotina)
empleando tecnicas numericas. Bol. Soc. Argent. Bot. 25: 395-413.

Calonge FD. 1986. Ilustraciones de hongos y liquenes de la expedicion botanica a Nueva Granada,
depositadas en le real Jardin Botanico de Madrid. Caldasia 15: 47-51.

Chacon, S. 1988. Conocimiento etnoecologico de los hongos en Plan de Palmar, Municipio de
Papantla, Veracruz, Mexico. Mic. Neotrop. Aplic. 1: 45-54.

Chacon, S, Medel R. 1990. Ascomycetes little known in Mexico V. Description of some Pezizales.
Revista Mex. Micol. 6: 199-206. |

Cooke MC. 1874. Carpology of Peziza. Grevillea 3: 30-31, pl. 27-30.
Cooke MC. 1875. Carpology of Peziza. Grevillea 3:186, pl. 43-44.

Cooke MC. 1879. Mycographia, seu Icones fungorum. I. Discomycetes. Part I. Williams & Norgate,
London.

177

Cooke MC. 1892. Handbook of Australian Fungi. William & Norgate. London. 456 pp.

Denison WC. 1963. A preliminary study of the operculate cup-fungi of Costa Rica. Rev. Biol. Trop.
Li) Ee EN Wide

Denison WC. 1967. Central American Pezizales. II. The genus Cookeina. Mycologia 59: 306-317.

Denison WC. 1972. Central American Pezizales. IV. The genera Sarcoscypha, Pithya, and
Nanoscypha. Mycologia 64: 609-623.

Dennis RWG. 1954. Operculate Discomycetes from Trinidad and Jamaica. Kew Bull. 9: 417-421.

Dennis RWG. 1970. Fungus flora of Venezuela and adjacent countries. Kew Bull. Additional Ser.
P55 Ppp.

Dennis RWG. 1994. Plumier’s Discomycetes. Mycotaxon 51: 237-239.

Dijk H van, Onguene NA, Kuyper TW. 2003. Knowledge and utilization of edible mushrooms by
local populations of the rain forest of south Cameroon. Ambio 32: 19-23.

Douanla-Meli, C. Langer E. 2005. Notes on discomycetes (Helotiales, Pezizales): New species and
new records from Cameroon. Mycotaxon 92: 223-237.

Durrieu G, He Q, Chaumeton J-P, Chauveau C. 1997. Cookeina insititia, a new Discomycetes from
China. Acta Bot. Yunnanica. 19: 128-120.

Duss A. 1903. Enumération méthodique des champignons recueillis a la Guadeloupe et a la
Martinique. Fungi by N. T. Patouillard. Lons-le-Saunier

Eckblad F-E. 1968. The genera of operculate discomycetes. A re-evaluation of their taxonomy,
phylogeny and nomenclature. Nytt Mag. Bot. 15: 1-191.

Ferdinandsen C, Winge @. 1910. Fungi from prof. Warmings expedition to Venezuela and the
West-Indies. Dansk Tidsskr. 30: 208-222.

Fries EM. 1822. Systema Mycologicum sistens fungorum ordines, genera et species huc usque
cognitas. 2 part 1. Griefswald.

Fries EM. 1860. Reliquiae Afzelianae, sistentes icons fungorum quos in Guinea collegit et in aere
incises excudi curavit Adamus Afzelius. Upsaliae. Edquist & Soc.

Gamundi JJ. 1957. El genero Cookeina en la Republica Argentina. Bol. Soc. Argent. Bot. 6:
212222.

Gamundi IJ. 1959. Addenda a las especies Argeninas de Cookeina Kuntze. Bol. Soc. Argent. Bot.
7: 201-204.

Gamundi JJ. 1971 Algunos discomycetes de Chile. Bol. Soc. Argent. Bot. 13: 260-289.

Gamundi IJ. 1983. Pezizales de America Tropical. Pp. 151-171 in Anais [Congresso Nacional de
Botanica] 34 congresso, v.1.

Hanlin RT. 1993. Cookeina sulcipes - an addendum. Mycotaxon. 46: 403-405.

Hanlin RT, Chien C-Y, Tortolero O. 1991. Icones Ascomycetum Venezuelae: Cookeina sulcipes.
Trans. Mycol. Soc. R. O. C. 6: 45-53

Harrington FA. 1990. Sarcoscypha in North America (Pezizales, Sarcoscyphaceae). Mycotaxon.
38: 417-458.

Harrington FA, Pfister DH, Potter D, Donoghue MJ. 1999. Phylogenetic studies within the Pezizales.
I. 18S rDNA sequence data and classification. Mycologia 91: 41-50.

Hennings P. 1892 [1891]. Fungi africani. Bot. Jaarb. Syst. 14: 337-373.

Hood IA. 1992. An Illustrated Guide to Fungi on Wood in New Zealand. Auckland University
Press. Aukland.

Hooker JD 1855. The botany of the Antarctic voyage...II. Flora novae-zelandiae. London. Authoriy
of the Lord Commissioners of the Admiralty.

Ito S, Imai S. 1937. Fungi of the Bonin Islands I]. Trans. Sapporo Nat. Hist. Soc. 15: 52-59.

178

Kaushal SC. 1986. A new species of Cookeina (Pezizales) from India. J. Indian Bot. Soc. 65: 404-
407.

Korf RP. 1951. A monograph of the Arachnopezizeae. Lloydia 14: 129-180.

Korf RP. 1970. Nomenclatural notes. VI. Family and tribe names in the Sarcoscyphineae
(Discomycetes) and a new taxonomic disposition of the genera. Taxon 19: 782 - 786.

Korf RP. 1971. Some new Discomycete names. Phytologia 21: 201-207.

Korf RP. 1972. A synoptic key to the genera of the Pezizales. Mycologia 64: 937-994.

Korf RP. 1973. Discomycetes and Tuberales. In: Ainsworth GC, Sparrow FK, Sussman AS, eds. The
fungi: an advanced treatise. Vol 4A. New York: Academic Press. p 249 - 319.

Kuntze O. 1891. Revisio Generum Plantarum 2: 375-1011.

Le Gal M. 1953. Le Discomyceétes de Madagascar. Prodr Flore Mycol Madagascar 4: 1-465.

Le Gal M. 1960. Flore iconographique des champignons du Congo dédiée a sa majesté Lépold III.
Illustrée en couleurs par Mme. M. Goossens-Fontana. 9: 167-183.

Le Gal M. 1969. Position taxinomique du genre Phaedropezia Le Gal et révision de la famille des
Humariaceae. Bull. Soc. Mycol. France. 85: 5-19.

Lloyd CG. 1921. Trichoscypha magnispora from Otto A. Reinking, Philippines.Mycological
Writings 6: 1050.

Maldonado Gonzalez S. 2000. El género Cookeina Kuntze (Ascomycota) en Cuba. Revista, Jard.
Bot. Nac. Univ Habana. 21: 305-307.

Massee G. 1896. Redescription of Berkeley’s types of fungi. J. Linn. Soc. Bot. 31: 462-525.

Massee G. 1898. Fungi exotici, I. Kew Bull. 1898: 113-136.

Melendez-Howell LM. 1986. Les champignons dans la degradation de la forét primaire de LArataye.
Mem. Mus. Nat. Hist. Nat. (Paris), A 132: 257-261.

Melendez-Howell LM, Mascarell G, Bellemere A. 2003. Etudes ultrastructurales dans le genre ~
Cookeina (Ascomycetes, Peizales, Sarcoscyphaceae). Mycotaxon 87: 53-80.

Montagne C. 1834. Nouvelles especes de cryptogames. Ann. Sci. Nat. Bot. ser. 2 2:77.

Moravec, J. 1997. Discomycetes of Madagascar - I. Phillipsia ranomafanensis sp. nov. and ascospore
sculpture of Cookeina colensoi proved by SEM (Discomycetes, Pezizales, Sarcoscyphaceae).
Czech Mycol. 50: 21 - 33.

Nagao H. 1997. Materials for the fungus flora of Japan (51). Mycoscience 38: 351-353.

Otani Y. 1971. Mycological reports from New Guinea and the Solomon Islands. 3. Enumeration of
the Sarcoscyphaceae and Scutellinia (Humariaceae). Bull. Nat. Sci. Mus., Tokyo 14: 401-422.
Otani Y. 1975. Discomycetes collected in Papua New Guinea pp. 5-41 in Reports on the cryptogams
in Papua New Guinea, The party 1973-’74, of The botanical expedition to Papua New Guinea.

The National Science Museum, Tokyo.

Paden JW. 1975. Ascospore germination, growth in culture, and imperfect spore formation in
Cookeina sulcipes and Phillipsia crispata. Canad. J. Bot. 53: 56-61.

Paden JW. 1984. A new genus of Hyphomycetes with teleomorphs in the Sarcoscyphaceae (Pezizales,
Sarcoscyphineae). Canad. J. Bot. 62: 211-218.

Pfister DH. 1973. Notes on Caribbean Discomycetes. III. Ascospore germination and growth in
culture of Nanoscypha tetraspora (Pezizales, Sarcoscyphineae). Mycologia 65: 952-956.

Pfister DH. 1974. Notes on Caribbean Discomycetes. IV. Cookeina venezuelae, C. colensoi and the
genus Boedijnopeziza. Phytologia 27: 55-62.

Pfister DH. 1978a. Apothecial development in Cookeina tricholoma with comments on some
related species. Mycologia 70: 1253-1257.

Pfister DH. 1978b. Cryptogams of the United States North Pacific Exploring Expedition, 1853-
1856. Farlow Reference Library and Herbarium. Cambridge, Ma

179

Pfister DH, Kaushal R. 1984. Cookeina indica, a new species from India with a key to the species of
Cookeina. Mycotaxon 20: 117-121.

Pfister DH, Kimbrough JW. 2001. Discomycetes pp. 257-281 in The Mycota, eds. McLaughlin,
McLaughlin & Lemke. Springer-Verlag, Berlin, Heidelberg.

Pfister DH, Kurogi S. 2004. A note on some morphological features of Chorioactis geaster (Pezizales,
Ascomycota). Mycotaxon 89: 277-281.

Plumier C. 1705. Traité des fougéres de [Amerique. Paris. 146 pp, 170 pl.

Rick J. 1931. Monographia Pezizinearum Riograndensium. Broteria Ser. Bot. 25: 77 - 98. 1931.

Rifai MA. 1968. The Australasian Pezizales in the herbarium of the Royal Botanic Gardens Kew.
Verh. Kon. Ned. Akad. Wetensch., Afd. Naturk. Tweede Sect. 57: 1-295.

Romero AI, Gamundi IJ. 1986. Algunos Discomycetes xilofilos del area subtropical de la Argentina.
Darwiniana 27: 43-63

Rosinski MA. 1953. Two types of spore germination in Sarcoscypha coccinea (Scop. ex Fr.) Lambotte.
Mycologia 45: 302-306.

Saccardo PA. 1889. Sylloge fungorum. Discomycetum et Phymatosphaeriacearum. Vol. 8. 1143 p.

Samuelson DA 1975. The apical apparatus of the suboperculate ascus. Canadian Journal of Botany
53: 2660-2679.

Sanchez AD, Chacon S, Sanchez JE. 1993. Produccion natural de Cookeina sulcipes (Ascomycotina,
Pezizales) en la region de Tapachula, Chiapas (México). Rev. Mex. Mic. 9: 47-56.

Sanchez Vazquez JE, Huerta Palacios G, Calvo Bado LA. 1995. Progress in the cultivation of the
edible mushroom Cookeina sulcipes. Pp. 857 — 862 in Science and Cultivation of Edible Fungi,
vol. 2, T. J. Elliott ed. Balkema, Rotterdam.

Spegazzini C. 1902. Mycetes Argentinensis. Anal. Mus. Nac. Buenos Aires, ser. 3 1902: 49 — 89.

Seaver FJ. 1913. Some tropical cup-fungi. Mycologia 5: 185-193.

Seaver FJ. 1925. Studies in Tropical Ascomycetes - III. Porto Rican cup-fungi. Mycologia 17:
45-50.

Seaver FJ. 1927. A tentative scheme for the treatment of the genera of Pezizaceae. Mycologia
19;30-89.

Seaver FJ. 1928. The North American cup-fungi (Operculates). Published by the author. New York

Seaver FJ. 1936. The genera Phillipsia and Cookeina. Mycologia 28: 90-92.

Seaver FJ. 1942. The North American cup-fungi (Operculates). Supplemented. Published by the
author. New York.

Starback K. 1904. Ascomyceten der ersten Regnellschen Expedition, III. Ark. Bot. 2: 1-22.

Teng SC. 1963. Fungi of China. Beijing pp. 277-279.

Tobon LE. 1991. Ascomicetos de Colombia: Discomicetos del departamento de Antioquia. Caldasia
16: 327-336.

Villarreal L, Perez-Moreno J. 1989. Los hongos comestibles silvestres de Mexico, un enfoque
integral. Micol. Neotrop. Apl. 2: 77-114.

Vooren N van. 2003. Deux discomycétes intéressants récoltés a La Martinique, note complémentaire.
Bull. Mens. Soc. Linn. Lyon 72: 156-157.

Vooren N van, Lopez F. 2002. Deux discomycétes intéressants récoltés a La Martinique. Bull. Mens.
Soc. Linn. Lyon 71: 152-156.

Wang Z. 1997. Taxonomy of Cookeina in China. Mycotaxon 62: 289-298.

Wang YZ. 2001. Discomycetes of the Sarcoscyphaceae in Taiwan. Mycotaxon 79: 329-336.

Weinstein RN, Pfister DH, Iturriaga T. 2002. A phylogenetic study of the genus Cookeina. Mycologia
94: 673-682.

180

Yang Z-Il. 1990. Several noteworthy higher fungi from southern Yunnan, China. Mycotaxon
38: 407-416.

Zoberi MH. 1973. Influence of water on spore release in Cookeina sulcipes. Mycologia 65:
155-160.

MYCOTAXON

Volume 95, pp. 181-184 January-March 2006
A new nematode-trapping hyphomycete of Arthrobotrys

WEIFENG Hu, YAN LI, MINGHE Mo & KEQIN ZHANG*

*kqzhang111@yahoo.com.cn
Laboratory for Conservation and Utilization of Bioresources
Yunnan University, Kunming 650091, PR. China

Abstract—Arthrobotrys multisecundaria, isolated from Yunnan, China, was illustrated
and described as a new nematode-trapping fungus, which captures nematodes by
means of adhesive three-dimensional networks. It is characterized mostly by one-
septate primary, elliptical conidia, which produce unicellular secondary conidia from
both distal and basal ends. The new species differs obviously from other related species
by producing up to four secondary catenulate conidia.

Keywords—Dactylella, Monacrosporium, predacious fungi, taxonomy

Introduction

Nematophagous fungi have been the subject of research for several decades in the
fundamental studies of microbiological ecology, distribution and systematics, and
potential biological control agents of nematode pests of plants and animals (Liu & Zhang
2003). These fungi usually can be categorized into four types: endoparasitic, nematode-
trapping, egg- and female-parasitizing, and toxin-producing fungi (Barron & Thorn
1987). Among the four types, nematode-trapping fungi (NTF) can produce various
trapping-devices to capture nematodes and other small animals (Duddington 1951,
Scholler et al. 1999, Ahrén et al. 2004). Traditionally, these predacious hyphomycetes
were assigned to three genera (Arthrobotrys, Dactylella, Monacrosporium) according to
the morphology of conidia (Cooke & Dickinson 1965). Trapping structures were used
to rationalize the classification of the nematode-trapping fungi with the molecular data
(Liou & Tzean 1997, Pfister 1997, Ahrén et al. 1998). Based on the analyses of partial
18S rDNA, ITS and 5.8S rDNA, Scholler et al. (1999) classified NTF into four genera:
Arthrobotrys, Dactylellina, Drechslerella and Gamsylella. Li et al. (2005) redefined the
systematic classification of nematode-trapping fungi based on phylogenies inferred
from molecular analyses of 28S rDNA, 5.8S rDNA and B-tubulin genes, which indicated
NTF should be divided into three genera: Arthrobotrys, Dactylellina and Drechslerella.

Materials and methods

Soil samples from Tengchong, Yunnan Province were sprinkled on corn meal agar
(CMA) plates inoculated with free-living nematodes, Panagrellus redivivus. After
approximately one month, a fungus forming adhesive three-dimensional networks was
isolated, and identified as a new taxon after a detailed morphological study.

182

Based on the classification of NTF by Li et al. (2005), we assigned this new taxon to
Arthrobotrys and here propose the name Arthrobotrys multisecundaria. Morphological
distinctions between the new species and similar species are discussed.

Taxonomic Description

Arthrobotrys multisecundaria W.F. Hu & K.Q. Zhang sp. nov. (Figs. 1-14)

Coloniae in agaro CMA albidae, post 5 dies 25°C 2.5 cm diam. Mycelium sparsum, hyphis
septatis, ramosis, 4-7.5 um latae. Conidiophora erecta, hyalina, simplicia, 200-365 um
longa, 2.5 um lata ad apicem. Conidia hyalina, ellipsoideas, 32.5-55x15-22.5um, 1 septata
vel non-septata. Conidia secundaria non-septata. Reticula tenacia quae vermiculos
nematodeos capiunt evolventibus.

Etymology: The species name refers to the formation of conidia in a catenulate array.

Holotype: YMF1.01821A, Tengchong, Yunnan Province, China, 2005, Weifeng Hu. The
holotype and its culture (YMF1.01821) are deposited in the Laboratory for Conservation
and Utilization of Bioresources, Yunnan University.

Colonies on CMA whitish, slowly-growing and extending a diameter of 2.5 cm at 25°
within 5 days. Mycelium hyaline, scanty, vegetative hyphae, septate, branched, 4-7.5 um
wide. Conidiophores (Fig. 1, 3, 4-5) erect, hyaline, septate, unbranched, 200-365 um
long, 5 um wide at the base, gradually tapering upward to a width of 2.5 um at the apex,
bearing one or two conidia. Conidia (Figs. 6-7) hyaline, ellipsoidal, 32.5-55 x 15-22.5
um, 1-septate (75%) or non-septate (25%). Secondary conidia (Figs. 3-5, 11-13) can be
produced from both distal and basal ends of primary conidia, non-septate, 32.5-55 x 15-
22.5 um. The predacious organ exhibits adhesive three-dimensional networks.

The single spore culture produced conidia after six days incubation on PDA at 25 °C.
Each conidiophore produced one to two conidia (Figs. 4, 5, 9, 10, 13) that proliferated
to form secondary conidia from both the distal and basal ends of primary conidia (Figs.
LyQke):

This process sometimes was repeated two to three times so that three to four conidia
could be produced on each conidiophore in catenulate arrangement (Fig. 3, 4, 11).
Sometimes up to three conidia were produced from the distal end of a conidium (Fig.
12i; :

An interesting process was observed during our study: primary conidia were
observed to dehisce at the septa to form germ tubes from the end of the distal cell (Figs.
7-8) while the basal cell remain attached to the distal cell (Fig. 10).

Comments-This species resembles Monacrosporium indicum (Chowdhry & Bahl) Xing
Z. Liu & K.Q. Zhang (1994) and M. janus S.D. Li & Xing Z. Liu (Li et al. 2003)
in conidial shape and number of septa but differs in conidial size and method
of conidial germination. Additionally, in M. indicum, conidia are elliptic, obovoid
or top-shaped, 22-30x14-20um, and mostly 2-septate with distinct hila. In M. janus,
conidia are broadly turbinate to napiform, 15-26 x 17.5-37.5 um, 1-2-septate (mostly
1 septa). A. multisecundaria is distinguished by the catenulate conidial arrangement and
germination that occurs from both basal and distal ends of conidia, characters that were
not observed in M. indicum, M. janus, or other related nematode-trapping fungi.

183

Figs. 1-14. Arthrobotrys multisecundaria. Figs. 1, 3-5, 10. Conidia on conidiophores. Figs. 2, 6-9,
11-13. Primary conidia with secondary conidia. Fig. 14. Adhesive three-dimensional networks.

Bars = 10 um

184
Acknowledgments

We wish to thank Dr Xingzhong Liu and Dr Shidong Li for their suggested revisions of the
manuscript. This work was supported by the project from the Department of Science and
Technology of Yunnan Province, P. R. China (2005NG05).

Literature Cited

Ahrén D, Faedo M, Rajashekar B, Tunlid A. 2004. Low genetic diversity among isolates of the
nematode-trapping fungus Duddingtonia flagrans: evidence for recent worldwide dispersion
from a single common ancestor. Mycol. Res. 108: 1205-1214.

Ahrén D, Ursing BM, Tunlid A. 1998. Phylogeny of nematode trapping fungi based on 18r DNA
sequences. FEMS Microbiology Letters 158: 179-184.

Barron GL, Thorn RG. 1987. Destruction of nematodes by species of Pleurotus. Can. J. Bot. 65:
774-778.

Cooke RC, Dickinson CH. 1965. Nematode-trapping species of Dactylella and Monacrosporium.
Trans. Br. Mycol. Soc. 48: 621-629.

Duddington CL. 1951. The ecology of predacious fungi. I. Preliminary survey. Trans. Br. Mycol.
Soc. 34: 322-331.

Li SD, Miao ZQ, Zhang YH, Liu XZ. 2003. Monacrosporium janus sp. nov. a new nematode-
trapping hyphomycete parasitizing sclerotia and hyphae of Sclerotinia sclerotiorum. Mycol. Res.
107: 888-894.

Li Y, Hyde KD, Jeewon R, Cai L, Vijaykrishna D, Zhang KQ. 2005. Phylogenetics and evolution
of nematode-trapping fungi estimated from nuclear & protein coding genes. Mycologia (in
press)

Liou GY, Tzean SS. 1997. Phylogeny of the genus Arthrobotrys and allied nematode-trapping fungi
based on rDNA sequences. Mycologia 89: 876-884.

Liu XE, Zhang KQ. 2003. Dactylella shizishanna sp. nov. from Shizi Mountain. China.Fungal
Diversity 14: 103-107.

Liu XZ, Zhang KQ. 1994. Nematode-trapping species of Monacrosporium with special reference to
two new species. Mycol. Res. 98: 862-868.

Pfister DH. 1997. Castor, Pollux and life histories of fungi. Mycologia 89: 1-23.

Scholler M, Hagedorn G, Rubner A. 1999. A reevaluation of predatory orbiliaceous fungi. II. A new
generic concept. Sydowia 51: 89-113.

MYCOTAXON

Volume 95, pp. 185-188 January-March 2006

Hyphodontia tubuliformis, anew species from Taiwan

SHENG-Hvua Wu

shwu@mail.nmns.edu.tw
Department of Botany, National Museum of Natural Science
Taichung, Taiwan 40419, Republic of China

Abstract—Hyphodontia tubuliformis, collected from Pinus sp. in subtropical northern
Taiwan, is described as new to science. This new species is characterized by having
tubular cystidia and cylindrical basidiospores. A description and line drawing are
provided for this new taxon.

Key words—Aphyllophorales, Basidiomycota, taxonomy, wood-decaying fungi

Introduction

The genus Hyphodontia J. Erikss. is a corticioid member of the Homobasidiomycetes,
with about one hundred species (including Alutaceodontia Hjortstam & Ryvarden and
Kneiffiella P. Karst.) known worldwide (Parmasto et al., 2004). Hyphodontia spp. are
wood-decaying saprobes, causing a white rot in wood. Molecular evidence (Larsson et
al., 2004; Binder et al., 2005) shows that Hyphodontia belongs to the hymenochaetoid
clade of Homobasidiomycetes. Previous surveys of Hyphodontia spp. include those of
Lin & Chen (1990), Wu (1990), Langer (1995), Wu (2000) and Wu (2001). This study
adds a new species of Hyphodontia collected from subtropical northern Taiwan.

Materials and Methods

Free-hand thin sections of the basidiocarp were prepared for microscopic studies. For
observations and measurements of microscopic characters, 5% KOH was used as a
mounting medium to ensure rehydration. Melzer’s reagent (IKI) was employed to detect
amyloidity and dextrinoidity. Cotton blue (CB) was used as a mounting medium to
determine cyanophily.

Taxonomy

Hyphodontia tubuliformis Sheng H. Wu, sp. nov. (Fig. 1)

Basidiocarpus effusus, submembranaceo-pelliculus, 80-200 um crassus; superficies
hymenialis grandinioideo-odontoidea. Systema hypharum monomiticum; hyphae
fibulatae. Cystidia tubuliformia. Basidia suburniformia, 7-13 x 3.3-4 um, 4 sterigmatibus.
Basidiosporae cylindricae, laeves, tenuitunicatae, 4.7-5.5 x 1.8-2.2 um, IKI-, CB-.

Etymology. From tubuliformis (= tubule-like), referring to the shape of cystidia in this
species.

186

Basidiocarp resupinate, effuse, submembranaceous-pellicular, fairly soft, 70-200 um
thick in section (aculei excluded). Hymenial surface cream, grandinioid-odontioid,
not cracking; margin thinning out, arachnoid, concolorous. Aculei separate or fused,
> 10 per mm, conical or subulate, up to ca. 120 um long and 60 um wide.Hyphal
system monomitic; hyphae nodose-septate. Subiculum with fairly loose texture;
hyphae moderately ramified, colorless, + vertically oriented, distinct and fairly straight,
2.5-4.5 um diam., hyphal walls from slightly thickened to 1.2 um thick. Hymenium
somewhat thickening, with dense texture; hyphae colorless, much narrower than those
of subiculum, thin-walled. Cystidia numerous, more concentrated in aculei, scattered
elsewhere, usually projecting, arising from subiculum, tubular, sometimes slightly
constricted near apices, colorless, 40-200 x 5-8 um, thick-walled (0.5-2.5 um thick)
except for the thin-walled apex. Basidia suburniform, 7-13 x 3.3-4 um, 4-sterigmate.
Basidiospores cylindrical, adaxially slightly concave, smooth, thin-walled, 4.7-5.5 x 1.8-
2.2 um, IKI-, CB-.

Distribution: Taiwan.

Holotype. Taiwan. Taipei: Kunliao, alt. 100 m, on branch of Pinus sp., leg. YE. Lin, 25 Jul
1991, Lin 591 (TNM F18973).

Remarks. This new species is similar to Hyphodontia microspora J. Erikss. & Hjortstam, but
has longer basidiospores. The spore measurements for H. microspora were respectively
given as 2.5-3.5 x 1.5-1.8 um (Eriksson & Ryvarden 1976), 3.8-4.5 x 1.8-2.2 um (Wu
1990), 3.7-4.3 x 1.8-2.1 um (holotype, Wu 1990) and 2.5-4.5 x 1.5-2.5 um (Langer 1994).
The feature of tubular and thick-walled cystidia in H. tubuliformis corresponds with
the concept of the H. barba-jovis group in Hyphodontia (Eriksson & Ryvarden 1976),
also equivalent to the generic concept of Kneiffiella proposed by Hjortstam & Ryvarden
(2002). The author accepts a broader view of the generic delimitation of Hyphodontia,
treating the new taxon in this genus.

Acknowledgements

This study was supported by the National Science Council of ROC (No. NSC 94-2621-B-178-002).
Mr. Y.F. Lin provided the specimen for this study. The author thanks Dr. Nils Hallenberg and Dr.
Peter Roberts for reviewing this paper.

Literature Cited

Binder M, Hibbett DS, Larsson K-H, Larsson E, Langer E, Langer G. 2005. The phylogenetic
distribution of resupinate forms across the major clades of mushroom-forming fungi
(Homobasidiomycetes). Systematics and Biodiversity 3: 113-157.

Eriksson J, Ryvarden L. 1976. The Corticiaceae of North Europe 4. Hyphodermella-Mycoacia. pp.
547-886. Fungiflora, Oslo.

Hjortstam K, Ryvarden L. 2002. Studies in tropical coticioid fungi (Basidiomycota, Aphyllophorales)
Alutaceodontia, Botryodontia, Hyphodontia s.s. and Kneiffiella. Synop. Fung. 15: 7-17.

Langer E. 1994. Die Gattung Hyphodontia John Eriksson. Biblioth. Mycol. 154: 1-298.

Larsson K-H, Larsson E, and Koljalg U. 2004. High phylogenetic diversity among corticioid
homobasidiomycetes. Mycol. Res. 108: 983-1002.

187

.% T Seas. ar ee
Car

age. F = as 2 sh if oe A Se
Be Si eee if ccunne Bet ao ee z

oo Uf ay 1p : ASS eo ee PS
eae cara vy te ~ ‘a

é Pie x fare € > < re.

Sey oe Se

10 um.

a
Ae,
Me

Fig. 1. Hyphodontia tubuliformis (holotype). A. Basidiocarp section. B. Cystidia. C. Basidia.
D. Basidiospores. Scale bars

188

Lin SH, Chen ZC. 1990. The Corticiaceae and the resupinate Hydnaceae of Taiwan. Taiwania 35:
69-111.

Parmasto E, Nilsson H, Larsson K-H. 2004. Cortbase version 2. Extensive updates ofa nomenclatural
database for corticioid fungi (Hymenomycetes). Phyloinformatics 1:5

Wu SH. 1990. The Corticiaceae (Basidiomycetes) subfamilies Phlebioideae, Phanerochaetoideae and
Hyphodermoideae in Taiwan. Acta Bot. Fennica 142: 1-123.

Wu SH. 2000. Studies on Schizopora flavipora s.1., with special emphasis on specimens from
Taiwan. Mycotaxon 76: 51-66.

Wu SH. 2001. Three new species of Hyphodontia with poroid hymenial surface. ranttaert Oe:
1019-1025.

MYCOTAXON

Volume 95, pp. 189-194 January-March 2006

Calculating minimum sample sizes
for taxonomic measurements:
examples using Gaumann’s Peronospora spore data

ANDREW J. HAMILTON’? & JAMES H. CUNNINGTON’

Andrew.Hamilton@deakin.edu.au James.Cunnington@dpi.vic.gov.au

‘Primary Industries Research Victoria—Knoxfield
Private Bag 15, Ferntree Gully Delivery Centre, Victoria 3156, Australia.

*School of Life & Environmental Science, Deakin University
PO. Box 423, Warrnambool, Victoria 3280, Australia.

Abstract—Methods are presented for calculating minimum sample sizes necessary to
obtain precise estimates of fungal spore dimensions. Using previously published spore-
length data sets for Peronospora species, we demonstrate that 41-71 spores need to be
measured to estimate the mean length with a reasonable level of statistical precision
and resolution. This is further progressed with examples for calculating the minimum
number of spore lengths to measure when matching an undetermined specimen to a
known species. Although applied only to spore-length data, all described methods can
be applied to any morphometric data that satisfy certain statistical assumptions.

Key word—spore size, spore diameter

Introduction

The question of selecting appropriate sample sizes for taxonomic measurements in
mycology is often discussed amongst individuals but rarely raised in the scientific
literature. One exception to this has concerned how many spore lengths and widths
to measure when undertaking taxonomic studies within the Peronosporales, and
Peronospora in particular (Gustavvson 1959). This arises from Gaumann’s (1923)
monograph of the genus Peronospora, in which he measured approximately 500 spores
from each species, believing that 500 measurements were required to produce sufficient
data for differentiating similar species.

Using examples from Gaumann’s Peronospora data, we present methods to address the
following two questions:

1. What is the minimum number of spores that need to be measured to
determine the mean spore length of a species?

2. What is the minimum number of spores that need to be measured to
match an undetermined specimen with a described species?

190

Methods and Results

Three phylogenetically distinct groups of Peronospora species were chosen to infer results
that could be applied to Peronospora species in general. Gdumann’s (1923) data for the
species groups on Vicia (p. 192), Stellaria (p. 48), and Potentilla (p. 292) were chosen
based on a recent phylogenetic study (Voglmayr 2003) which revealed these to be quite
unrelated groups of species. Gdumann used reference numbers to identify the species
in his analyses, and the same numbers are used here. The species to which they refer to
are: 1 through 4 on Potentilla are P. potentillae anserinae Gaum., P. potentiliae reptantis
Gaum., P. potentillae sterilis Gaum. and P. potentillae de Bary; 1 and 2 on Stellaria are P
parva Gaum. and P. media Gaum.; and 1 through 5 on Vicia are P. viciae (Berk.) Gaum.,
P. sepium Gaum., P. mayorii Gaum., P. viciae sativae (Thiim.) Syd., and P. narbonensis
Gaum.. Gaumann’s data were manually transcribed from his distribution graphs using
a ruler. It is interesting to note that he measured in 1.6 wm units, which is presumably
a function of the magnification and the resolution of the graticule he had available.
The spore-length ranges (and standard deviations), in wm, were as follows: 8.0-22.4
(2.31), 11.2-25.6 (2.23), 16.0-28.8 (2.15) and 19.2-35.2 (2.50) for species 1 through 4
on Potentilla; 9.6-24.0 (2.51) and 19.2-35.2 (3.01) for species 1 and 2 on Stellaria; and
9.6-27.2 (2.74), 11.2-30.4 (2.57), 16.0-33.6 (2.51), 19.2-36.8 (2.50) and 22.4-41.6 (2.89)
for species 1 through 5 on Vicia.

The methods and calculations below were applied to all species in these groups. The
methods described here are sensitive to two key assumptions: (i) that the distribution of
the measured variable can be closely approximated by the normal distribution, and (ii)
that the estimate of the standard deviation, s, of that normal distribution is close to the
true standard deviation, o (Sokal & Rohlf 1969, Zar 1984). Nonetheless, Gdumann’s data
sets were normal, and morphometric data would generally be expected to be normally
distributed.

1. Minimum sample size for estimating the mean spore lengths of Peronospora
species
The minimum sample size, n, necessary to gain an estimate (x, ) of the true mean spore-

length (u,) can be calculated as follows (Harris et al. 1948):
se) SE} Feats)
fe equation 1.

where s* is the sample variance (assumed to be a good estimate of the true population
variance, 0°), Lats the two-tailed critical value for Student’s ¢ distribution (with n-1
degrees of freedom, df), F,..),._,) is the one-tailed critical value for the F distribution
(with n-1 and v the numerator and denominator df respectively), and d is the half-width
of the nominal confidence interval (CI) (i.e. + distance from x). The confidence level
for the confidence interval equals 1-a and the assurance that the confidence interval
will be no larger than specified is 1-6 (1-6 = statistical power). An existing data-set is

needed to calculate s?.

191

A problem arises when trying to solve equation 1, as to obtain t,,...,_,, and Bey)
we need to know n, which by definition is unknown. This paradox can be resolved by
iteration: solving equation 1 for different values of n until the guess value approximates
the value calculated from the equation. The method is perhaps more clearly appreciated
in the example below.

Using measurements for Gdumann’s ‘species 1’ on Vicia (n = 424), we calculated s* to
be 7.513 (see any standard statistical text to calculate s*). Suppose we want to be 90%
certain that the 95% confidence interval (CI,,) is no wider than 1.6 um (the resolution
of Gaumann’s measurements), then d = 0.8 wm, 1-6 = 0.90, 6 = 0.10, 1-a = 0.95, and a
= 0.05.

We now need to solve for the minimum sample size by iteration. We can start by

guessing that n,,, = 50 spores. Thus, n—1 = 49 and v = 423, which gives f, ,.. »,= 2.010,
and F,..) |, 1») ~ 1.32. Substituting into equation 1:
2
pT OIE RL A as
0.87
Our guess was less than this estimate so we need to try a higher guess, say 61.
Thus, n-1 = 60 and v = 423, which give f, ...) 4,= 2-000, and F,.,. ,_)* 1.27. Substituting

into equation 1:
na/13 x 2.0007

0.87

Therefore, to obtain x, with a 90% probability that the 95% confidence interval will
be no wider than 1.6 um (i.e. + 0.8 wm), we need to measure more than 59 spores (i.e.
60). Note that there is no point continuing the iteration procedure until the guess and
estimate are exactly equal, since fractions of spores will not be counted. Iteration should
stop once the smallest integer that is greater than the estimate is reached, keeping in
mind that the relationship between the guess and the estimate is dynamic.

We used this procedure to determine the minimum sample size needed to estimate
mean spore-length for all the Peronospora species considered here. A 1.6 um CI,. was
used for all species. The selection of the size of the desired CI,. is somewhat subjective.
When describing a species for taxonomic purposes a relatively narrow CI,, is required,
as the estimate x, will be used as a standard by other researchers. We believe that 1.6
um is sufficiently small to meet this need, and it is also the resolution of Gdumann’s
measurements.

For the three species groups used in this study, 41 to 71 spores would need to be
measured to be 90% certain that the CI,. for x,was no wider than 1.6 wm (Table 1). The
Potentilla species group generally demanded the smaller sample sizes, 41-51, compared
to 52-67 for the Vicia group, and 52-71 for the Stellaria group.

192

Table 1. The minimum number of spores that need to be measured to be 90% certain
that the CI,. about x, is no wider than 1.6 um.

species group Gaumann’s species’ reference number
(by host plant) 1 2 3 4 5
Potentilla 45 42 4] 51
Stellaria 52 71
Vicia 60 hy) OZ 59 67

Therefore, inferring from these three phylogenetically distinct groups of species,
a conclusion may be drawn that to get an accurate estimate of mean spore length in
Peronospora species, between about 40 and 70 spores need to be measured.

2. Minimum sample size for estimating the mean spore length to match an
unknown specimen with a known species

In the example above we wished to obtain a very precise estimate of , so that this could
be used as a reference value. For routine diagnostic examination of specimens, however,
such precision is not necessary. Consequently, a wider CI,, can be accepted. Once again,
the appropriate width of the CI,, is somewhat subjective, but will largely depend on the
differences between the mean spore-lengths of the species within the group.

This is best illustrated with the two species on Stellaria which have mean spore-lengths
that differ by 11.07 um. Thus, in practice, you would only need to measure enough
spores to be within 5 ym of the true mean to indicate to which of these two species
an undetermined specimen on Stellaria would belong, presuming of course that the
unknown was one of these two. This value, however, shrinks to 1.7 wm for the species on
Potentilla, as the minimum difference between any two means is 3.47 wm. Considering
these values, we decided to calculate the minimum number of spores that would need
to be measured to determine x, with a CI,, of 2 um and 3 um for Potentilla, and 2 um,
3 um, 4 wm, and 5 um for Stellaria. The minimum difference between any two species
within the Vicia group was 0.75 zm, but most species were much farther apart, with the
next smallest difference being 2.78 um. Thus, we calculated minimum sample sizes to
obtain Cl,.s of 0.70 um, 2 um, and 3 wm.

The widening of the CI,.s for diagnostic measurements substantially reduced the
minimum sample-sizes required for all groups (Tables 2-4). Very large numbers of
spores would need to be measured if species 2 and 3 on Vicia were to be distinguished
with any confidence, as indicated by the values for the 0.7 um CI,, in Table 4. In contrast,
only 10 spores needed to be measured to differentiate the two species on Stellaria.

193

Table 2. For species found on Stellaria, the minimum number of spores that need to be
measured to be 90% certain that the CI,, about x, is no wider than specified.

nominal CI,. Gaumann’s species’ reference number
(um) 1 2

2 36 48

3 19 25

4 12 16

5 10 if

Table 3. For species found on Potentilla, the minimum number of spores that need to be
measured to be 90% certain that the CI,. about x, is no wider than specified.

nominal CI,. Gaumann’s species’ reference number
(um) 1 2 3 4
2 31 29 27, 36
3 16 16 Le 19

Table 4. For species found on Vicia, the minimum number of spores that need to be
measured to be 90% certain that the CI,, about x, is no wider than specified.

nominal CI,. Gaumann’s species’ reference number
(um) 1 2 3 4 5
0.7 281 272 239 270 312
2 41 40 36 39 45
3 | IA 19 BAI 25
Discussion

Gaumann measured around 500 spores for each of the various Peronospora species he
described, and for some species he measured around 1,000 spores. This is indeed an
admirable effort, but in many cases it would not be practicable to measure so many
spores. The general question that arises is how many spores need to be measured in
morphometric studies? Other studies of downy mildews have involved measuring
100 (Gustavvson 1959), 200 (Smith 1970), or 500 (Ling & Tai 1945) spores. None of
these studies described how they determined the number of spores to be measured.
Likewise, Hawksworth (1974) recommended making 50-250 spore measurements for
general fungal taxonomic studies, but gave no indication as to how he arrived at this
range. Furthermore, claims relating to the ‘reliability’ of particular methods have not
been rigorously justified and do not address type I and II error rates (Gustavsson 1959).
Presumably, the sample-sizes used in these studies were based on the intuitive notion
that more spores would need to be measured when there is large variability in length
among spores. While this concept is indeed correct, the subjective manner in which it
has been applied almost certainly explains the broad range of minimum sample-sizes
propounded. In this paper, more formal and objective approaches that used s* as the
measure of variability were presented. Also, the question of how many spores to measure
was considered more carefully than has been done in the past, with distinctions being
made between taxonomic/descriptive and diagnostic requirements.

194

Regardless of the specific question being addressed, the findings of our work tend to
support the general assertion made by others (Gustavsson 1959), namely, that there
is no need to measure 500 or 1,000 spores: much smaller sample sizes will suffice.
Fewer spores needed to be measured for diagnostic purposes because, compared to the
taxonomi¢ agendum, a relatively relaxed level of precision can be accepted. In situations —
where two or more species have very similar means, as was the case for the Vicia group,
large numbers of spores need to be measured to distinguish between species.

The techniques described in this paper can be readily applied to other groups of fungi
and other morphometric characteristics, such as width or the ratio of width to length,
providing such data satisfy the relevant statistical assumptions (i.e. normality and an
accurate estimation of s). Also, note that the methods described here assume that s?
is an adequate estimate of o*. This assumption adds further random variation into the
estimated. sample sizes, so the results should be interpreted conservatively. Where the
source data set is large, as was the case for each species here, then s’ is likely to be a sound
estimate of o°. But for small data sets, where s* may be a poor estimate of o°, particular
care should be taken in using and interpreting the methods. Caution is also warranted
when considering these methods for species where spore morphology is unstable and
dependent on environmental factors (Guarro et al. 1997, Arenal et al. 2004).

Acknowledgments
The authors thank Roger Shivas and Wayne Robinson for their expert review and useful

suggestions, which improved the quality and clarity of the manuscript. Helpful observations by
Shaun Pennycook and Chris Triggs are also appreciated.

Literature cited

Arenal F, Platas G, Pelaez, F. 2004. Variability of spore length in some species of the genus Preussia
(Sporormiella). Mycotaxon 89: 137-151.

Gaumann, E. 1923. Beitrage zu einer monograhpie der Gattung Peronospora Corda. Beitr. Krypt.-fl.
Schweiz 4. Ziirich.

Guarro J, Abdullah SK, Gené J, Al-Saadoon, AH. 1997. A new species of Preussia from submerged
plant debris. Mycol. Res. 101: 305-308.

Gustavsson A. 1959. Studies on Nordic peronosporas: II. General account. Opera Botanica 3:
5-61.

Harris M, Horvitz DG, Mood AM. 1948. On the determination of sample sizes in designing
experiments. J. Amer. Statist. Assoc. 43: 391-402.
Hawksworth DL. 1974. Mycologists’ Handbook. An introduction to the principles of taxonomy
and nomenclature in the fungi and lichens. Surrey, Commonwealth Mycological Institute.
Ling L, Tai MC. 1945. On the specialisation of Bremia lactucae on Compositae. Trans. Brit. Mycol.
Soc. 28: 16-25.

Smith A. 1970. Biometric studies on conidia of Peronospora tabacina. Trans. Brit. Mycol. Soc. 55:
59-66.

Sokal RR, Rohlf FJ. 1969. Biometry: the principles and practice of statistics in biological research.
San Francisco, WH Freeman and Company.

Voglmayr H. 2003. Phylogenetic relationships of Peronospora and related genera based on nuclear
ribosomal ITS sequences. Mycol. Res. 107: 1132-1142.

Zar JH. 1984. Biostatistical analysis (2™ edition). Englewood Cliffs, New Jersey, Prentice-Hall.

MYCOTAXON
Volume 95, pp. 195-200 January-March 2006

Tricholoma borgsjoeénse, a new species from a
boreal coniferous forest in Fennoscandia

S. JACOBSSON’, S. MuskKos? & E. LARSSON!

stig.jacobsson@botany.gu.se
'Dept. of Plant- and Environmental Sciences, Goteborg University
Box 461, SE 405 30 Goteborg, Sweden

*Klévervagen 13, SE 864 33 Matfors, Sweden

Abstract—Tricholoma borgsjoeénse, a species new to science, is described and illustrated.
Its systematic position was investigated by use of ITS and LSU nuclear rDNA sequence
data. The phylogenetic analysis indicates that the new species belongs in section Terrea
and is closely related to the American species Tricholoma atroviolaceum.

Key Words—Basidiomycotina, Agaricales, Tricholomataceae, taxonomy, phylogeny

Introduction

Tricholoma is a large genus with at least 50 species known in Fennoscandia. All of them
are ectomycorrhizal with various forest trees, and several well-known species occur in
the boreal coniferous forests. However, in some sections of the genus, morphological
differences are small and not always evident. One such section is Terrea Konrad & Maubl.,
which comprises a large number of rather similar taxa. This section is characterized by a
dry, brownish or greyish, more or less scaly or tomentose pileus surface.

Since 1988 we have observed a rather striking species of this complex in the province
of Medelpad, central Sweden that was not possible to identify. It is characterized by a
very dark, tomentose-fibrillose pileus, and grows in old, mossy forests with Norway
spruce (Picea abies). It soon became obvious that it represented an undescribed species,
in spite of its rather striking characters.

As the species is connected to old virgin forests, an environment strongly threatened
by modern forestry, it is important to have a name for it. The new species is here
described as Tricholoma borgsjoeénse.

Materials and methods

The complete internal transcribed spacer region (ITS1, 5.88, ITS2) and approximately
900 base pairs of LSU nuclear rDNA were sequenced for the designated type of the
new species T. borgsjoeénse SM05/024, T: borgsjoeénse SJ030827, T. orirubens Quél.,
RGC04-053, T. virgatum (Fr.) P.Kumm., SJ010927 and T: apium Jul.Schaff., EL37-99.
The sequenced collections are deposited at G6teborg University Herbarium (GB).

196

400 T. borgsjoeénse
74 T. atroviolaceum
| T. myomyces
65
63 T. imbricatum
97 T. vaccinum
100 | T. focale
T. orirubens
T. virgatum
65 99
T. portentosum
76 98
T. cf. flavovirens
T. apium

Lepista sordida

Leucopaxillus subzonalis

Fig. 1. The single most parsimonious tree from the phylogenetic analysis, showing the position of
T. borgsjoeénse. Bootstrap values above 50% are indicated on branches.

Sequences were obtained from fresh material or from herbarium specimens following
protocols described in Larsson & Jacobsson 2004. Sequences have been deposited
in GenBank (accession numbers DQ415731, DQ389733-DQ389736). Additional
sequences were taken from GenBank selected through blast search using the ITS2
region of T: borgsjoeénse as target (U7657, AY750166, AF319428, AF18660, U86443,
U76458, U76460, U76464, U86672). Leucopaxillus subzonalis (Peck) H.E.Bigelow and
Lepista sordida (Schumach.) Singer were used as the out group.

Sequences were aligned using the data editor in PAUP* (Swofford 2003). Gaps for
insertion-deletion events were introduced to aid in the alignment. Heuristic searches
for most parsimonious trees were performed using PAUP *. All transformations were
considered unordered and equally weighted. Variable regions with ambiguous alignment
were excluded, and gaps were treated as missing data. Heuristic searches with 1000
random-addition sequence replicates, TBR branch swapping, were performed. Relative
robustness of clades was assessed by the bootstrap method using 1000 heuristic search
replicates with 100 random taxon addition sequence replicates and TBR swapping.

197

Molecular results

The alignment of the 13 specimens was 2198 characters long. After exclusion of
ambiguous areas 1623 characters remained for the analysis, of which 1428 were constant,
95 were variable but parsimony uninformative, and 100 were parsimony informative.
The maximum parsimony analysis yielded one most parsimonious tree (length=217, CI=
0.7970, RI= 0.6893). Figure 1 shows the single most parsimonious tree presented as a
phylogram and bootstrap frequencies are shown on branches. In the tree T. borgsjoeénse
and T! atroviolaceum A.H.Sm. cluster with 100% bootstrap support, indicating a close
relationship. The two species further cluster with T. myomyces (Pers.) J.E.Lange with a
moderate support of 71%.

Taxonomy

Tricholoma borgsjoeénse Jacobsson & Muskos sp. nov. FIGURE 2

Pileus 35-88 mm latus, initio convexus, late planoconvexus vel subumbonatus, siccus,
tomentosus vel minute squamulosus, atrobrunneus - cinereobrunneus, margine pallidior.
Lamellae emarginatae, leviter latae, cineraceae. Stipes 55-105 mm longus, 10-17 mm
crassus, saepe flexus, fibrillus, radicans, basi flavida vel albido. Caro pallide cinerea, in
pileo atrocinerea, odore farinoso, sapore leviter amaro. Sporae ellipsoideae, 7.5-9 x 5-6 um,
leviae. Cystidia nulla. Hyphae defibulatae. Crescit in silvis abietis inter muscos.
Holotypus: Sweden, Medelpad Muskos 05-024: in herbarium GB concervatus est.
Additional material studied: Sweden, Medelpad, Borgsjé, Julasen 2005-08-26, leg. Siw
Muskos & Jan-Olof Tedebrand; Muskos 05-024 (Holotype, GB), 2003-08-27 (SJ03/012);
Mpd, Attmar, Sdrlindsj6, 2003-.09-12 (Muskos 03-009, GB); Mpd, Tuna, Kalberget,
1999-08-23 (Muskos 99-009).

Etymology: After the parish of Borgsj6 in the province of Medelpad, where several
specimens of the species, including the holotype, have been collected.

Pileus 35-88 mm broad when mature, at first obtusely conical with slightly incurved
margin, becoming planoconvex, generally without but sometimes with a blunt umbo,
dark greyish brown to blackish brown, with age or in dry condition somewhat paler,
especially towards the margin, surface dry, completely covered with a dark, blackish
tomentum or somewhat fibrillose scaly. Lamellae moderately crowded to somewhat
subdistant, 40-60 reaching the stipe, strongly emarginate, rather ventricose, up to 12
mm broad, greyish, the edge often becoming blackish spotted when injured. Stipe 55-
105 mm long and 10-17 mm wide, almost cylindrical or thickest in the middle part,
towards the base often curved and more or less rooting, greyish fibrillose but gradually
paler towards base and the base pale yellowish, especially when grown in deep moss. No
trace of a cortina seen. Context in cap thin towards the margin and dark grey marbled,
in the stipe dark grey in the upper part but gradually paler towards the base. Odour
more or less farinaceous, at least when freshly cut, taste mild or weakly bitter. Spores
(7-)7.5-9 x 5-6 um, Q = 1.4-1.8 (20 spores measured), broadly ellipsoid to ovoid with
a distinct hilar appendage, smooth, neither amyloid nor dextrinoid. Basidia slenderly
clavate, 36-48 x 8-10 um, 4-spored, without clamp connections.

198

O50

20 um,
' 2com

Fig. 2. Spores, basidia and basidiocarps of Tricholoma borgsjoeénse.

Lamellae edge fertile, only a few clavate basidioles seen. Pileipellis a cutis made up of
bundles of strongly septate hyphae, elements 15-30 x 8-20 um, thick-walled and very
dark colored by membranal and sometimes slightly incrusting pigments. Below is a
subpellis formed by more inflated and weaker pigmented hyphae, sometimes appearing
subcellular. Context of hyphae hyaline and of various thickness. Clamp connections
absent in all tissues.

Ecology and distribution—Tricholoma borgsjoeénse grows in small groups or rows in
boreal coniferous forests of a virgin character, on rather moist and mossy ground with
nutrient-rich soil. In all localities Norway spruce (Picea abies) was the only or dominant
tree, suggesting T. borgsjoeénse to form ectomycorrhiza associated with spruce. In
this region there is no indication that it could be connected with Pinus or any other
tree species. Hitherto the species is noted from at least 6 localities.in the province of
Medelpad, central Sweden.

In the type locality at Julasen it grows in a rather moist depression not far from a small
brook. Within a few meters some other rare agarics have been found as Hygrophorus
purpurascens (Alb. & Schwein.) Fr. Cortinarius serarius Fr., Limacella glioderma (Fr.)

Koo

Maire. Typical and common species in the same habitat are e.g. H. erubescens (Fr.) Fr.,
Lactarius scrobiculatus (Scop.:Fr.) Fr. and L. badiosanguineus Kihn. & Romagn. Various
ferns and herbs like Lactuca alpina are also present. In other localities the habitat is also
described as herb-rich spruce forest or in one case more ordinary blue-berry forest.
Fruiting time is August - September.

It is surprising that such a striking species has not been described before. To our
knowledge it has not yet been found in other parts of Sweden than in the rather small
province of Medelpad but it is likely to have a wider distribution. The explanation may
be that it is restricted to boreal forests of virgin character. Large areas of boreal forests in
the northern half of Sweden are rarely visited by mycologists and much research remains
to be done. It is also worth mention that the fruit bodies may often be difficult to discover
as a consequence of the dull colors and the growth deep in mosses. The species is found
in various parts of Finland according to I. Kyt6vuori (personal communication), which
suggests that it has a wider distribution.

Discussion

Both the macro- and micro-morphological characters of T: borgsjoeénse unambiguously
indicate that it belongs to section Terrea, a section characterized by a dry, woolly-
tomentose to squamulose pileus and absence of clamp-connections on the hyphae. Bon
(1984) made a subsection Terreina containing 13 species in Europe and Riva (1988)
included 12 species in the subsection. In Noordeloos & Christensen (1999) only 7 of
these taxa were included. Typical members of the subsection Terreina are T. terreum and
its relatives and the complex around T° orirubens, a group still poorly investigated and
in which the interpretation of some names is disputed.

T. borgsjoeénse clearly differs from the other known taxa belonging to section Terrea
by several characters: darker colours on pileus and stipe, tomentose rather than a
squamulose pileus surface, a fibrous, not squamulose stipe, larger spores and longer
basidia. The nature of the pileipellis and pigmentation seems to be rather uniform
within the section. Species belonging to the T: orirubens group have a strong tendency to
redden in parts of the basidiom with age, a character never observed in T: borgsjoeénse.

Bresadola (1927, pl. 79) described and depicted a species that shares some characters
with T. borgsjoeénse, viz. T; gausapatum (Fr.)Quel. It possesses large spores (7-9 x 4-
4.5 um), and also the tomentose pileus, somewhat rooting stipe and the occurrence in
coniferous forest are characters similar to T: borgsjoeénse. Thus T. gausapatum ss Bres.
may be related to or possibly identical with T. borgsjoeénse, but his interpretation deviates
in several respects from the original description by Fries (1821). Besides, Fries described
T. gausapatum as a species growing under deciduous trees in the southernmost part of
Sweden.

In the phylogenetic tree T. borgsjoeénse cluster with T. atroviolaceum, a species
described from coniferous forests in western United States (Oregon and California) by
Smith (1944). The description shows that T. atroviolaceum shares several morphological
characters with T: borgsjoeénse, e.g. a fibrous pileus surface, large spores and absence of
cheilocystidia. However, there are also differences such as the distinct violaceus shade
and a subbulbous stipe of T: atroviolaceum. No doubt the two species are closely related,
_ but yet distinct from each other.

200

T. borgsjoeénse and T. atroviolaceum form a clade with T: myomyces. In contrast, T.
orirubens and allied species fall in a different clade, in spite of similar morphological
characters. However, our dataset includes too few species to be able to infer subgenetic
classifications.

Old growth virgin spruce forests are strongly threatened by forestry and most areas
with such forest have been clear-cut during the last decades. T: borgsjoeénse grows
together with species that are on the Red List of Swedish species (Gardenfors 2005),
i.e. Hygrophorus purpurascens, H. inocybiformis A.H.Sm. and several species belonging
to Cortinarius subg. Phlegmacium. These species indicate areas of highly valuable
undisturbed forest that host many threatened species.

Acknowledgements

We gratefully acknowledge Gro Gulden, Natural History Museum, Oslo, Norway and Henning
Knudsen, Botanical Museum, Copenhagen, Denmark for critically reviewing and valuable
suggestions to improve the manuscript. Financial support was received from the Swedish species
initiative project (ArtDatabanken, SLU).

Literature cited

Bon M. 1984. Tricholomes de France et Eur. occ. 67-278. — Lechevalier, Paris.

Bresadola G. 1927. Iconographia micologica 1, Milan.

Fries E. 1821. Systema Mycologicum. 1. Stockholm.

Gardenfors U. 2005. The 2005 Redlist of Swedish species. ArtDatabanken, SLU, Sweden.

Larsson E, Jacobsson S. 2004. Controversy over Hygrophorus cossus settled using ITS sequence data
from 200 year-old type material. Mycological Research 108:781-786.

Noordeloos, M.E., Christensen, M. 1999. Tricholoma (Fr.:Fr.) Staude. In Bas, C., Kuyper, Th.,
Noordeloos, M.E., Vellinga, E. (eds), Flora Agaricina Neerlandica 4:107-152.

Riva, A. 1988. Tricholoma (Fr.) Staude. Fungi Europaei 3. Saronno.

Smith A.H. 1944. New North American Agarics. Mycologia 36:242-262.

Swofford D.L. 2003. PAUP*. Phylogenetic Analysis Using Parsimony (* and Other Methods).
Version 4. Sinauer Associates, Sunderland, MA.

MYCOTAXON

Volume 95, pp. 201-204 January-March 2006

A new variety of Meliola thalliformis from Brazil

DARTANHA J. SOARES,
DOUGLAS F. PARREIRA & ROBERT W. BARRETO

dartjs@yahoo.com.br
Departamento de Fitopatologia, Universidade Federal de Vicosa
Vicosa, Minas Gerais, 36570-00, Brazil

Abstract—Meliola thalliformis var. major var. nov., associated with leaf spots on Bathysa
australis (Rubiaceae), is described and illustrated.

Key words—tropical fungi, Meliolales, Meliolaceae, black mildew

Introduction

During fungal collections undertaken in a stretch of Atlantic tropical rainforest of the
nature reserve Parque Estadual da Serra do Brigadeiro in the state of Minas Gerais
(Brazil), leaves of the tree Bathysa australis (St. Hil.) Benth. & Hook. f. (Rubiaceae) were
found colonized by a black mildew. Besides the usual black superficial colonies of the
fungus, distinct leaf spots were also seen in close association with such colonies.

Bathysa australis is an endemic plant of the Brazilian Atlantic tropical rainforest and it
is distributed throughout the South and Southeastern states of Brazil (Germano Filho,
1999). The latter author considered that this species as not threatened with extinction in
a broad sense but in the state of Rio Grande do Sul it is considered to be endangered.

A literature survey yielded no fungal records on this host (Viégas, 1961; Minter & Silva,
1995; Mendes et al. 1998; Farr et al. 2005). The occurrence of this fungus represents
therefore, the first fungal record on this host which is presented below.

Material and Methods

Freshly collected samples were examined under a stereomicroscope. Hand free
sections and adhesive tape slides containing the fungal structures were mounted using
lactophenol. Observations, measurements and line drawings were prepared by using an
Olympus BX 50 light microscope fitted with a drawing tube. Representative specimens
of the fungi were deposited in the herbarium at the Universidade Federal de Vicosa
(Herbarium VIC).

202

Taxonomic Description

Meliola thalliformis var. major D.J. Soares & R.W. Barreto, var. nov.
MycoBank MB500734 (FIGS 1-2)

Differt a var. thalliformis cellulae myceliales longioris et ascosporis magnioris
Etymology: named in reference to its larger ascospore size.

Holotype: on Bathysa australis, Brazil, state of Minas Gerais, Araponga, Parque Estadual
da Serra do Brigadeiro, December 2003, D.J. Soares (VIC-29381).

Colonies on living leaves, predominantly hypophyllous, mostly on the leaf-veins,
crustose, to velvety, very densely thalliform, black, seemingly strongly parasitic, directly
associated with amphigenous pale brown circular to elliptical leaf spots, 5-40 mm
in diam. Hyphae slightly undulate, branching alternate or opposite at acute to wide
angle, closely reticulate and thalloid, cells 23-45 x 5.5-11 tm. Appressoria alternate to
unilateral, brown to dark brown, straight to slightly curved, 23.5—49 um long, stalk cells
cylindrical, 6.5-23 x 6-9 um, head cells subglobose to ovate, sometimes angulose, 13-
20.5 x 10-16 um. Phialides separate, on loosely radiating hyphae growing on a upper
level above the mycelial plate, opposite or alternate, brown, ampuliform, 14-25 x 7-9.5
tum. Mycelial setae very numerous, both scattered to and grouped around perithecia,
mostly widely curved, hooked, rarely substraight, up to 454 x 6—9.5 um long, dark brown,
smooth, tip simple, obtuse, entire, or rounded. Perithecia black, scattered, globose, with
crenate to crenulate surfaces, up to 260 um in diam. Ascospores brown, oblong, obtuse,
4-septate, slightly constricted at septa, 47-61.5 x 12—19.5 um, smooth.

Comments — 58 specific and 23 infraspecific Meliola epithets were included in
Hansford’s (1961) monograph having members of the family Rubiaceae as hosts.
None on these fungal taxa had a member of the genus Bathysa as a known host. The
general morphological characteristics of the fungus described above together with
its (uncommon for this group of fungi) evident pathogenic habit agreed well with
those described for the species Meliola thalliformis Deigthon and M. thalliformis var.
naucleae Deighton. Some biometric differences were nevertheless noted and considered
here as sufficient to justify its recognition as a new variety in the species, namely its
longer hyphal cells and its larger ascospores. Meliola canthii Hansf., another closely-
related species having Beeli formulae 3111.5222, is easily distinguishable by the mixed
appressoria and phialides and sometimes 2—4-lobate appressoria. Another aspect
worthy of consideration is its disjunct distribution as compared with other occurrences
of M. thalliformis - all recorded only from Africa (Table 1, p. 204).

Acknowledgments

The authors wish to thank the Departamento de Biologia Vegetal of the Universidade Federal
de Vicosa for providing support on plant identification, particularly to Michelia Soares, Amilcar
Saporetti and Wilson Marcelo. The authors also wish to thank Dr. Bin Song, Dr. Hosagoudar and
Dr. Harry Evans for reviewing the manuscript.

203

Fig 1. Leaf fragment showing the colonies of Meliola thalliformis var. major associated with the
spots on Bathysa australis (A) and transversal section of the perithecium showing the crenulate
surface (B). Scale Bar = 30 um

Fig 2. Line drawing of Meliola thalliformis var. major on Bathysa australis. Phialides (A), appressoria
(B), ascospores (C) and widely curved and hooked mycelial setae (D). A-C, Scale Bar = 10 um; D,
Scale Bar = 50 um

204

Table 1. Morphological features of Meliola thalliformis and its varieties.

Features

Beeli formula
Hypha cell
Mycelial setae
stalk cell
Appressoria

apical cell

Phialide

Ascoma

Ascospores

Host

Geographic range

M. thalliformis*

3121.4232

10-20 x 6-9 um

up to 350 x 8-9 um
3-14 um long
11-20 x 10-14 um

12-20,x16=6 um
up to 230 um diam

38-48 x 14-16 x
12-14 um

Mitragyna stipulosa
(DC.) Kuntze

Sierra Leone

* Hansford 1961; ** this publication.

M. thalliformis
var. naucleae*

3111.4232

11-20 x 8-10 um

up to 320 x 8-9.5
um

7-12 um long
15-22 x 11-16 um
16-20 xi7-9 1m

up to 220 um
diam

38-48 x 13-15 x
12-13 um

Nauclea diderrichii
(De Wild.) Merr.

Sierra Leone

Literature Cited

M. thalliformis
var. major**

3121.6237/,

23-45 x 5.5-11
um

up to 454 x 6-9.5
lum.

6.5-23 X69 Um

13-20.5 x 10-16
um.

14-25 x 7-9.5 um

up to 260 um
diam

47-61.5 x 12-19.5
uum.

Bathysa australis

Brazil

Farr DE, Rossman AY, Palm ME, & McCray EB. 2005. Fungal Databases, Systematic Botany &
Mycology Laboratory, ARS, USDA. Retrieved October 12, 2004, from http://nt.ars-grin.gov/

fungaldatabases/.

Germano Filho P. 1999. Estudos taxonémicos do género Bathysa C. Prels. (Rubiaceae, Rondeletieae),
no Brasil. Rodriguésia 50 (76/77): 49-75.
Hansford CG. 1961. The Meliolineae - A monograph. Sydowia Beihefte 2: 1-806.

Mendes MAS, Silva, VL, Dianese JC, Ferreira MASV, Santos CEN, Neto EG, Urben AF, Castro C. —

1998. Fungos em plantas no Brasil. Brasilia-DF, Embrapa.

Silva M, Minter DW. 1995. Fungi from Brazil recorded by Batista and co-workers. Mycological

Papers 169: 585 p.

Viégas AP. 1961. Indice de Fungos da América do Sul. Instituto Agronomico, Campinas-SP,

Siqueira.

MY COTA XON

Volume 95, pp. 205-215 January-March 2006

Russula in Himalaya 2: Four new taxa

KANAD Das', S.L. MILLER?
& J.R. SHARMA?

*daskanad@yahoo.co.in
"Mycology and Plant Pathology Group, Agharkar Research Institute
G.G. Agarkar Road, Pune 411004, India

“Botany Department, University of Wyoming
Laramie, Wyoming 82071 USA

*Botanical Survey of India, 192, Kaulagarh Road
Dehradun 248195, India

Abstract—Russula mayawatiana, R. dhakuriana, R. appendiculata and R. puellaris var.
atrii are proposed here as new taxa. Phylogenetic positions within the genus Russula
are supported by macroscopic and microscopic characters as well as rDNA sequences
in the ITS gene region.

Key words— Russulaceae, taxonomy, ribosomal DNA, phylogeny, India

Introduction

Critical taxonomic studies based on the morphological and anatomical characters of
the genus Russula from Himalaya have been carried out by different authors (Watling &
Gregory 1980, Saini et al. 1982, Atri & Saini 1989, Atri et al. 1991, Atri et al. 1992, Atri
et al. 1993, Saini et al. 1993, Atri et al. 1994, Shajahan & Samajpati 1995, Atri et al. 1997,
Rawla 2001, Das & Sharma 2003, Das 2005, Das et al. 2006) for the last twenty five years.
The flora of the large genus Russula from the world over is creating confusion among
taxonomists about the proper taxonomic circumscription of species and their placement
in the infrageneric classification schemes. Moreover, the morphological and anatomical
characters are sometimes not sufficient to comparatively analyse the taxa or establish
them as undescribed (new). To eliminate this confusion, efforts have been initiated by a
few workers (Miller et al. 2001, Miller & Buyck 2002) to use DNA sequencing to support
comparative taxonomic approaches. During a number of macrofungal surveys in Western
and North-western Himalaya, the authors gathered a large number of specimens which
after thorough morphological and microscopic studies revealed numerous undescribed
taxa. Further, DNA sequencing of five taxa also confirmed their status as new to science.
Four of them, viz., R. mayawatiana, R. dhakuriana, R. appendiculata and R. puellaris

_ var. atrii are described and illustrated below, whereas, the fifth one i.e. R. mukteshwarica

has been submitted (Das et al. 2006) for publication. The molecular tree supporting
circumscription of these taxa as new is also provided (Fig. 5, p. 214).

206

Materials and Methods

Morphological characters were recorded from fresh specimens in the field. Anatomical
characterization was done with dry samples by mounting free hand sections of basidiomes
in 5% KOH, Melzer’s reagent, Congo red, Lactophenol-cotton blue and carbol fuchsin. ©
Colour terms follow Kelly & Judd (1955). Microscopic line drawings were made with the
aid of a camera lucida at original magnification of 1500x for basidiospores and 1000x
for other microstructures. Density of lamellae (L/cm) was measured at the margin of
the pileus excluding lamellulae. Colour codeing used for spore prints is after Romagnesi
(1967). Basidiospore length excludes the length of ornamentation. Basidium length
excludes the length of sterigmata. Quotient (Q = L/W) was calculated considering the
mean value of length and width of 25 basidiospores. Herbarium names used follow
Holmgren et al. (1990). Materials and methods for rDNA sequencing were similar to
those used in Miller & Henkel (2004).

Description of the species

Russula mayawatiana K. Das, S.L. Mill. & J.R. Sharma sp. nov. Fig. 1.
Etymology: From Mayawati, referring to the type locality.

Pileus 40-65 mm diam., planoconvexus ad infundibuliformis, crustosus in centro, rufus
ad rutilus. Lamellae subdecurrentes, densae, luteae. Stipes 40-50 x 7-12 mm, cylindricus
ad subclavatus, luteoalbus. Sporae in cumulo luteae, 7.7-11.5 x 6.2- 9 um, globosae
vel ellipsoidae, amyloideae, verrucosae. Pleurocystidia 68-125 x 9-15 um, fusiformia.
Cheilocystidia 46-70 x 6-9 um, fusiformia. Pileocystidia cylindrica.

Holotypus: INDIA, Uttaranchal, Champawat, Mayawati, September 2002, leg. K. Das &
J.R. Sharma, KD4542 (HOLOTYPUS, BSD; ISOTYPUS, TUR-A).

Pileus 40-65 mm diam., convex, then planoconvex to infundibuliform with a depression
at maturity; pileipellis viscid when moist, often crustose (cracked) at the center, peeling
only at margin, deep yellowish pink to medium or deep red or yellowish red, medium
to dark or orange yellow at center; margin slightly sulcate. Lamellae adnexed to
subdecurrent, close (7-8 per cm), forked, pale to orange yellow. Stipe 40-50 x 7-12
mm, central, cylindric to subclavate, yellowish white. FeSO, (+). Taste acrid. Spore print
pale yellow. |

Basidiospores 7.7-11.5 x 6.2-9 um, globose, subglobose, broadly ellipsoid to ellipsoid
(Q = 1.05-1.4); ornamentation amyloid, composed of numerous conic warts, up to 1.75 —
tum high, rarely connected by fine ridges. Basidia 40-50 x 7-9 tm, subclavate to clavate,
4-spored; sterigma up to 6 tm long. Pleurocystidia 65-125 x 7.7-15 tum, emergent up
to 40 um, abundant, fusiform or with acute, acuminate to narrowly moniliform apex;
contents dense. Lamellae edge sterile with few cystidia. Cheilocystidia 46-70 x 6-9 um,
fusiform; contents dense. Subhymenium layer up to 20 um thick, cellular. Pileipellis
up to 100 um thick, composed of erect to suberect hyphae and abundant pileocystidia;
pileocystidia up to 12 um, broad, fusiform to cylindrical or acuminate-rostrate,
3-6 septate. Stipitipellis composed of mostly repent hyphae and abundant cystidia.
Caulocystidia up to 8 um broad, clavate, subclavate or fusoid; contents dense.

Ecology—Russula mayawatiana grows in close association with species of Quercus and
Rhododendron in moist mixed temperate forests.

207

“4

lyf
[25
pow |
4!
ij
ony

Fig. 1. Russula mayawatiana (from Holotype): a. Basidiomes b. Basidiospores c. Caulocystidia d.
Elements from pileipellis e. Pleurocystidia f. Cheilocystidia. Bars: a = 10 mm; b-f = 10 um.

OTHER SPECIMENS EXAMINED— INDIA, Utaaranchal NaINiTAL, Gagar, August 2002,
leg. K. Das, KD2149, KD2158 (BSD).

Notes: Bright reddish coloration of pileus, pale yellow spore print and multiseptate (3-
6 septate) pileocystidia firmly place R. mayawatiana in the subgenus Russula emend.

208

Sarnari. It is differentiated easily by its reddish pileus with yellowish center, distinctly
acrid taste, large basidiospores. The present taxon is close to R. maculata Quélet & Roze.
However, the presence of rusty spotted pileus and stipe surface, non-sulcate pileus
margin, non-septate pileocystidia in R. maculata separate it from R. mayawatiana.
Molecular analysis (fig. 5) clearly shows the closeness between these two taxa. Moreover,
Rayner (1970) reported spore size ranging from 8-10 x 7-9 um with wart size up to
1.25-1.5 um in R. maculata as compared to the spore size (7.7-11.5 x 6.2-8.3 um with
warts measuring up to 1.75 um) recorded for R. mayawatiana.

Russula dhakuriana K. Das, J.R. Sharma & S.L. Mill. sp. nov. Fig. 2.
Etymology: From Dhakuri, referring to the type locality.
Pileus 80-120 mm diam., planoconvexus, leviter depressus in centro, rufus. Lamellae
annexae ad subdecurrentes, densae, luteae. Stipes 50-125 x 20-28 mm, subclavatus ad
clavatus, roseus. Sporae 6.5-10.2 x 6 -7.7 um, globosae vel late ellipsoidae, amyloideae,
verrucosae. Pleurocystidia 60-115 x 7-12 um, cylindrica. Cheilocystidia 60-75 x 9-13
um,clavata ad fusiformia. Pileocystidia absentia

Holotypus: INDIA, Uttaranchal, Bageshwar, Dhakuri, September 2003, leg. K. Das & J.R.
Sharma, KD7029 (HOLOTYPUS, BSD; ISOTYPUS, GUH).

Pileus 80-120 mm diam., convex, planoconvex with depressed center to uplifted at
maturity; pileipellis dry, somewhat pruinose but never velvety or scurfy, soft to medium
to deep red, often with brilliant orange yellow areas; margin often tuberculately sulcate,
split. Lamellae adnexed to subdecurrent close to rather crowded (ca 8 per cm), often
forked from the stipe, brilliant to light orange yellow; lamellulae absent. Stipe 50-125 x
20-28 mm, central, subclavate to clavate, yellowish with deep pink to medium red areas,
white with tinge of deep pink, FeSO, (+); context pale yellow. Dried material (lamellae)
never red with sulfovanillin. Odour indistinct. Taste mild. Spore print not obtained.

Basidiospores 6.5-10.2 x 6-7.7 um, globose to broadly ellipsoid (Q = 1.03-1.26);
ornamentation amyloid, composed of isolated conic to spiny warts (up to 1.75
um). Basidia 40-60 x 9-14 um, subclavate, 4-spored; sterigmata up to 7.5 um long.
Pleurocystidia 60-115 x 7-12 um, emergent up to 45 um, abundant, cylindrical to
subfusoid, thick walled; wall up to 1.5 um thick; contents dense. Lamellae edge fertile
with basidia and cystidia. Cheilocystidia 60-75 x 9-13 um, clavate to fusoid, thick
walled; wall up to 1.75 um thick. Subpellis cellular. Pileipellis composed of erect to
suberect hyphae; hyphae up to 5 um broad, often with incrustations. Pileocystidia
absent. Pilear trama with abundant sphaerocytes. Stipitipellis composed of suberect to
repent hyphae and cystidia.

Ecology—Russula dhakuriana grows in close association with species of Rhododendron
in moist mixed temperate forests.

OTHER SPECIMENS EXAMINED—INDIA, Utaaranchal BaGesHwar, Dhakuri,
September 2003, leg. K. Das & J.R. Sharma, KD7092, KD7093 (BSD).

Notes: Morphologically, the bright coloration of pileipellis and microscopically, the
presence of incrusted hyphae and absence of pileocystidia in the pileipellis, undoubtedly
place these specimens under the subgenus Incrustatula. The characters recorded for these

209

Fig. 2. Russula dhakuriana (from Holotype): a. Basidiomes b. Basidiospores c. Basidia d.
Cheilocystidia e. Pleurocystidia f. Elements from pileipellis. Bars: a= 10 mm; b-f = 10 um.

specimens are quite close to those of Russula rosea Quél., as has also been confirmed by
the molecular analysis (Fig. 5). However, the smaller spores and cellular nature of the
subpellis are features enough to separate R. rosea from R. dhakuriana. Further, unlike
the present species, the dried lamellae of R. rosea stain carmine red in sulfovanillin.

210

Russula appendiculata K. Das, S.L. Mill. & J.R. Sharma sp. nov. Fig. 3.

Etymology: After the characteristic appendiculate pleurocystidia.

Pileus 60-90 mm diam., planoconvexus ad infundibuliformis, brunneolus. Lamellae
late annexae, luteae. Stipes 37-70 x 13-18 mm, cylindricus ad subclavatus, luteoalbus.
Sporae (6) 7-8.8 x 5.4-7.8 um, globosae vel late ellipsoidae, amyloideae, verrucosae.
Pleurocystidia 60-100 x 7.5-12 ym, fusiformia, appendiculata. Cheilocystidia 50-70 x
8-11 um, cylindrical ad clavata. Pileocystidia cylindrical ad clavata.

Holotypus: INDIA, Uttaranchal, Champawat, Mayawati,September 2002, leg. K. Das &
J.R. Sharma, KD4541 (HOLOTYPUS, BSD; ISOTYPUS, TUR-A).

Pileus 60-90 mm diam., convex, planoconvex to umbelliform with depressed center;
pileipellis gelatinous when young, dry at maturity, cracked to areolate towards margin,
brownish pink, light gray brown or gray yellowish brown with cream to pale yellow at the
center, gray yellow, medium yellow, dark yellow or dark grayish yellow at maturity, never
darkening with KOH; margin plane, nonstriate. Lamellae broadly adnexed, close (7-8
per cm), forked near the stipe or from the middle, pale yellow; lamellulae in two rows.
Stipe 37-70 x 13-18 mm, central, cylindric to subclavate, yellowish white, FeSO, (+);
context stuffed, white unchanging. Taste mild. Odor fruity. Spore print not obtained.

Basidiospores (6) 7-8.8 x 5.4-7.8 um, globose to broadly ellipsoid [Q = 0.95-1.2
(1.30)]; ornamentation amyloid, 0.2-0.4 um high, composed of irregular isolated
warts, few connected by isolated lines, never forming a reticulum. Basidia 38-50 x
8-12 um, clavate, 4-spored. Pleurocystidia 60-100 x 7.5-12 um, cylindric, fusoid or
ventricose with rounded, mucronate, appendiculate or narrowly lageniform (tailed)
apex, emergent up to 40 um. Cheilocystidia 50-70 x 8-11 um, cylindrical to clavate.
Pileipellis composed of suberect septate branched hyphae and cylindrical to clavate
pileocystidia with rounded to mucronate apices.

Ecology—Rare, grows in ectomycorrhizal association with species of Pinus in mixed
temperate forests.

OTHER SPECIMENS EXAMINED—INDIA, Utaaranchal, NarniTaL, Gagar, August
2002, leg. K. Das, KD2176 (BSD).

Notes: Based on the color of the pileus and nature of the pileipellis, the present
taxon appears to belong to the subgenus Heterophyllidia (Sect. Rigidae sensu
Singer, 1986) along with R. virescens (Schaeff.) Fr. However, the latter has a distinct
pseudoparenchymatous subpellis, absence of appendiculate (tailed) pleurocystidia and
larger spore ornamentation which clearly separate R. virescens from R. appendiculata.
The absence of any color change of pileipellis with KOH points towards inclusion of
R. appendiculata under the subgenus Ingratula Romagn. emend Sarnari alongwith R.
farinipes Romell as also supported strongly by molecular analysis (Fig. 5). However, R.
farinipes differs by having a distinctly nonareolate pileus, larger spore ornamentation
and above all lacks the lageniform to tailed pleurocystidia of R. appendiculata .

211

Fig. 3. Russula appendiculata (from Holotype): a. Basidiomes b. Basidiospores c. Cheilocystidia d.
Elements from pileipellis e. Pleurocystidia. Bars: a = 10 mm; b-e = 10 um.

Russula puellaris var. atrii K. Das, S.L. Mill. & J.R. Sharma var. nov. Fig. 4.
Etymology: In recognition of N.S. Atri for his contribution to the Russulaceae.

Pileus 20-35 mm diam., planoconvexus, leviter depressus in centro, atropurpureus
Lamellae annexae, luteae. Stipes 23-63 x 5-13 mm, cylindricus ad clavatus, luteoalbus.
Sporae in cumulo luteolae, 7.4-9.6 x 6-7.7 um, subglobosae vel ellipsoidae, amyloideae,
verrucosae et corrugatae. Pleurocystidia 50-74 x 9-12 um, fusiformia. Pileocystidia
subclavata ad clavata.

212

Fig. 4. Russula puellaris var. atrii (from Holotype): a. Basidiomes b. Basidia c. Basidiospores d.
Elements from pileipellis e. Pleurocystidia. Bars: a = 10 mm; b-e = 10 um.

Holotypus: INDIA, Uttaranchal, Bageshwar, Dhakuri, September 2003, leg. K. Das & J.R.
Sharma, KD7022 (HOLOTYPUS, BSD).

Pileus 20-35 mm diam., convex, planoconvex with slightly depressed center at maturity;
pileipellis viscid when moist, soft to dark reddish purple with blackish purple center,
light grayish or grayish to dark purplish red, slowly yellowish orange at maturity or after
bruishing, peeling up to % of the radius; margin plane, tuberculately striated. Lamellae
adnexed to subdecurrent, crowded (10-12 per cm), entire, forked from the stipe,

213

yellowish white, yellowish orange at maturity or after bruising. Stipe 23-63 x 5-13 mm,
central, cylindrical to clavate, yellowish white, distinctly yellowish orange after bruising
or at maturity FeSO, (+); context white, yellowing after bruising. Taste mild. Spore print
yellowish to buff.

Basidiospores 7.4—9.6 x 6—7.7 um, subglobose to ellipsoid (Q = 1.08-1.43); ornamentation
amyloid, up to 1.4 um high, composed of conic to spinose warts and ridges, aligned or
joined with few connectives to form broken reticulum. Basidia 26-45 x 7-11.5 um,
clavate, 4-spored; sterigma up to 6 um. Pleurocystidia 50-74 x 9-12 um, emergent up to
12 um, abundant, fusiform to cylindrical with capitate, or appendiculate apices; contents
dense. Lamellae edge fertile with basidia and few cystidia. Cheilocystidia same as
pleurocystidia. Subhymenium layer up to 28 um thick, cellular. Pileipellis composed of
upper erect to suberect hyphae up to 5 um broad and pileocystidia up to 10 um, broad,
subclavate to clavate, 1-2 septate, contents dense; below a layer of parallel compact
hyphae.

Ecology—Common, grows in ectomycorrhizal association with species of Quercus and
Rhododendron in temperate deciduous to mixed forests.

SPECIMENS EXAMINED — INDIA, UTTARANCHAL: Bageshwar, Dhakuri, September
2003, leg. K. Das & J.R. Sharma, KD7022 (HOLOTYPE, BSD); ibid., Pithoragarh, Dafia
Dhura, October 2001, leg. K. Das & J.R. Sharma, KD4063.

Notes: Russula puellaris var. atrii is differentiated in the field by the reddish purple
pileus with tuberculately striate margin and basidiomes which turn gradually yellow to
yellowish orange. The bright coloration of the pileus, septate pileocystidia and nature of
hymenial cystidia place the present taxon in the subgenus Russula. The morphological
and microscopic characters of specimens from Kumaon Himalaya match almost
completely those of R. puellaris Fr. except slight variation in the spore ornamentation.
Romagnesi (1967) reported the spore size ranging from 6.5 - 8.5 (9.5) x 5.5 — 7 um with
wart height extending up to 1.25 um for R. puellaris Fr. var. puellaris. Spores are smaller
in R. puellaris var. minutalis (Britzelm.) Singer, 6.5 - 7 (8) x 5 - 6.2 (6.5) um with warts up
to 1.25 um. The present taxon however, differs from both the above mentioned varieties
in having slightly larger spores. The proximity with R. puellaris in the parsimonious tree
justify the undescribed taxon R. puellaris var. atrii (Fig. 5).

Acknowledgements

We are thankful to Dr. M. Sanjappa, Director and Dr. D.K. Singh, Joint Director, Botanical Survey
of India, Kolkata and Dr. V.S. Rao, Director, Agharkar Research Institute, Pune for providing
facilities during the present study, to Dr. N.S. Atri, Punjabi University, Patiala (India) and Dr. Teresa
Lebel, Royal Botanical Gardens, Melbourne (Australia) for critically reviewing the manuscript and
checking the Latin diagnosis. Editorial assistance by Dr. L.L. Norvell, PNW Mycology Service,
Portland (USA) is also duly acknowledged. This research is partially supported by funding to S.L.
Miller from the National Science Foundation (DEB — 0315607), USDA (2003 - 01542) and EPSCoR
(04 - 47681). We gratefully acknowledge Terry McLean from the Nucleic Acid Exploration Facility
at the University of Wyoming for sequencing these specimens.

214

R. adulterina
R. cupre

R. nausso.

R R. cu ‘s ‘
con 4 S .
Bpsqudpintoara

R maculata,
e py aeaiene

R. yok ete
. viol;
OOP a kicshwarkca™
R. vi gens
R. mustelina
R. parazurea

R. amoeninae Russula sp, nov. 2
Russula sp. nov.
R. ciliata :

R. appendiculata*®
~ R. fa S

A. flettii
G. aculeatum

——~ 10 changes

Fig. 5. Best of 16 most parsimonious trees (1 In likelihood - 12607, 60827) of 2183 steps inferred

from equally weighted parsimony analysis of ITS1, 5.8S and ITS2 rDNA sequences depicted as a
phylogram. The CI was 0.285, the RI was 0.530 and the RC was 0.151.

Literature Cited

Atri NS, Saini SS. 1989. Family Russulaceae Roze — a review, in M.L. Trivedi, B.S. Gill, $.S. Saini
(eds.) 115-128. Plant science research in India, present status and future challenges. New Delhi,
India.

Atri NS, Saini SS, Mann DK. 1991. Genus Russula Pers. in Dalhousie, in N.C. Aery & B.L.
Choudhary (eds.) 92-99. Botanical researches in India. Udaipur, India.

Atri NS, Saini SS, Saini MK. 1993. Some Russulaceous fungi from Dalhousie (H.P.) - The genus
Russula Pers. Geobios New Reports 12: 137-140.

Atri NS, Saini MK, Saini SS. 1994. Indian Russulaceae Roze - A checklist, in T.A. Sharma, S.S.
Saini, M.L. Trivedi & M. Sharma (eds.) 81— 93. Current researches in Plant Science. Dehradun,
India.

Atri NS, Saini SS, Saini MK. 1997. Studies on genus Russula Pers. from north western Himalayas.
Mush. Res. 6 (1): 1-6.

Atri NS, Saini SS, Saini MK, Gupta AK. 1992. Two new records of genus Russula from India.
Geobios New Reports 11: 101-103.

Das K. 2005. Taxo-Ecological studies on the family Russulaceae of Kumaon Himalaya. Text, 179 pp,
31 pl., 75 fig., D. Phil. thesis.

Das K, Sharma JR. 2003. New records of Russula from Kumaon Himalaya. Indian Journal of
Forestry 26 (3): 320-326.

Das K, Miller SL, Sharma JR, Sharma P, Bhatt RP. (2005) 2006. Russula in Himalaya 1: A new
species of subgenus Amoenula. Mycotaxon 94: 85-88.

Holmgren PK, Holmgren NH, Barnett LC. 1990. Index Herbariorum. Part 1: Herbaria of the world,
86" ed. Brox: New York Botanical Garden.

Miller SL, Buyck B. 2002. Molecular phylogeny of the genus Russula in Europe with a comparison
of modern infrageneric classifications. Mycol. Res. 106 (3): 259-276.

Miller SL, Henkel TW. 2004. Biology and molecular ecology of subiculate Lactarius species from
Guyana, in C.L. Cripps (ed.). Fungi in forest ecosystems — systematics, diversity and ecology.
New York Botanic Garden, vol. 89, pp 297 - 313.

Miller SL, McClean TM, Walker JF, Buyck B. 2001. A molecular phylogeny of the Russulales
including agaricoid, gasteroid and pleurotoid taxa. Mycologia 93: 344-354.

Rawla GS. 2001. Himalayan species of Russula Pers. Ex S.F. Gray, in P.C. Pande & S.S. Samant (eds.)
1 - 48. Plant Diversity of the Himalaya. India.

Romagnesi H. 1967. Les Russules d'Europe et d'Afrique du nord. Bordas, Paris.

Saini SS, Atri NS, Singer R. 1982. North Indian Agaricales—II. Sydowia Annales Mycologici Ser I
35: 238-241.

Saini SS, Atri NS, Anjula, Saini MK. 1993. Studies on the Russulaceous fungi from Narkanda (H.P.)
~ The genus Russula Pers. J. Indian Bot. Soc. (suppl.) p 36.

Shajahan M, Samajpati N. 1995. Ectomycorrhizal fungi of Shorea robusta G.f. from West Bengal.
Ind. J. Mycol. Res. 33: 105-117.

Singer R. 1986. The Agaricales in modern taxonomy. 4" ed. Vaduz J. Cramer. Germany.

Watling R, Gregory NM. 1980. Larger fungi from Kashmir. Nova Hedwigia 26 (3): 320-326.

216 “vit

‘
If
:
{
: .
vA
{
7
-
; &
i
j
:
ne '
= '
- 1
1 ‘4
j
|
‘
1
- 1

MYCOTAXON

Volume 95, pp. 217-228 January-March 2006

The distinction between Menegazzia cincinnata and
M. valdiviensis (Parmeliaceae)

Monica T. ADLER

adler@bg.fcen.uba.ar
Departamento de Biodiversidad y Biologia Experimental
Facultad de Ciencias Exactas y Naturales
Universidad de Buenos Aires (Ciudad Universitaria)
1428 Buenos Aires, Argentina

SUSANA CALVELO

scalvelo@crub.uncoma.edu.ar
Centro Regional Universitario Bariloche
Universidad Nacional del Comahue
8400 Bariloche RN, Argentina

JOHN A. ELIx

John.Elix@anu.edu.au
Department of Chemistry, Faculty of Science
Australian National University, Canberra, ACT 0200, Australia

Abstract—The aim of the present investigation is to assess the status of Menegazzia
cincinnata and Menegazzia valdiviensis, two closely related species from southern South
America. The main characters used previously to segregate the two species are discussed
and evaluated. The main conclusions are that the presence/absence of thamnolic acid in
the thallus medulla correlates well with differences in ascospore length, which, therefore,
can be used in combination to propose a new delimitation of both species. In addition,
differences in geographic distribution are showed to be consistent with this distinction.
A complete chemical profile is detailed for each species, thus redefining, correcting and
complementing previously published data. Gyrophoric acid is reported for the first time
for the complex and is, with lecanoric acid, consistently present in both species. Other
secondary metabolites are reported for the first time for the species.

Key words— Patagonian lichenized Ascomycota, South American lichens.

Introduction

Prior to 1937, Parmelia cincinnata was the only known fertile species in subgenus
Menegazzia Vain. to have a greenish yellow thallus and lacking vegetative diaspores. In
1937 Rasanen described a second species with these features, Parmelia (Menegazzia)

218

valdiviensis, which reportedly differed from the former by its 2—spored asci, in contrast to
the mostly 8-spored asci of M. cincinnata. The distinction was subsequently maintained
by Santesson (1942), who placed M. cincinnata in subgenus Octospora R. Sant. and M.
valdiviensis in subgenus Dispora R. Sant. However, he used a second key character to
distinguish the two species; namely that the apothecial margin of M. cincinnata was
thick crenulate whereas M. valdiviensis had an entire, thin apothecial margin. At that
time, cortical and medullary chemistry were not used as taxonomic characters. Calvelo
& Adler (1994) and Bernasconi et al. (2002) subsequently utilized the same features to
distinguish the two species, because, at that time, the type material of M. valdiviensis
was unavailable. However, they did note a further possible distinguishing character,
the presence of medullary thamnolic acid in M. valdiviensis that was absent in M.
cincinnata. When the type material of M. valdiviensis was examined, it became evident
that the asci were not 2-spored but 8-spored, or rarely 6-spored as recently published
(Bjerke 2005). Consequently, the reported distinguishing characters were reduced to
“thalline exciples of young apothecia crenulate and slightly corrugate, lobes distinctly
yellow or yellow-green, asci well-developed” for M. valdiviensis and “thalline exciples
of young apothecia thin, smooth and not crenulate; lobes greenish or yellow-green;
asci often underdeveloped” for M. valdiviensis (Bjerke 2005). Given these characters,
the distinction of the two species is very difficult and they are therefore considered to
comprise a complex of two very closely related species.

The present investigation of M. cincinnata and M. valdiviensis is part of a more
extensive study of Menegazzia A. Massal. from southern South America (Adler &
Calvelo 1996; Calvelo & Adler 1994; Bernasconi et al. 2002). This paper discusses the
taxonomic characters used to segregate M. cincinnata from M. valdiviensis, reports
further characters previously overlooked, and proposes a new delimitation of, and
redescribes, both species.

Materials and Methods

Collection sites: Samples of Menegazzia collected from the western areas of Chubut,
Neuquén, Rio Negro and Tierra del Fuego provinces between 39° S and 55° S (Argentina),
from Chile near the border with Argentina between 36° S and 55° S, and from the
southern Chilean Pacific islands were studied. Phytogeographically, the area is quite
homogeneous; it belongs to the Antarctic Region, Sub-Antarctic Province (Cabrera
1994). Autochthonous species of Nothofagus occur as the principal forest cover, from
700 m to 1,800 m above sea level in the north, and from sea level to 600 m in the south.
However, there are important mean annual precipitation differences, varying from 3,000
mm in the north to 545 mm in the southernmost part of the study area (Conti 1998,
Tuhkanen 1992).

Specimens examined: ‘The studied material had the main following characteristics:
thallus with a grayish yellow, yellowish green to yellowish olive-green upper surface,
absence of vegetative propagules, frequently with apothecia, and presence of gyrophoric
and lecanoric acids as constant medullary substances. The study is based on Menegazzia
specimens collected by Adler and Calvelo and on herbarium material. The specimens
cited below were selected from a much larger number of collections studied and housed
in the following herbaria: BAFC, BCRU, H, S, TUR. Part of the authors’ personal

DLS

collections are kept in the Calvelo private herbarium (and cited as #). An “isolectotype” of
Parmelia cincinnata (S), previously labeled by Galloway “Cotypus ex herb. Acharius’, was
examined. A photograph of this specimen, collected by Archibald Menzies in February
1787, at New Year’s Harbour, Staten Island, is available online (http://linnaeus.nrm.se/
botany/kbo/ach/ps/L1196.html.en). This specimen had been previously cited as the type
material (Santesson 1942). An isotype of Parmelia valdivienis, collected by Hollermayer
(number 1146 H, ex herb. Rasadnen) at Cordillera Pelada, La Reina (Chile) was also
studied. So far it has not been possible to clarify whether this specimen is a duplicate
of that cited in the protologue (number 6883 of herbarium Gunkel and presumably
kept at VALD). We consider that the envelope at H labeled as TYPE (Hollermayer
1146) is the holotype and that a second specimen, lacking the type annotation, is an
isotype. The latter was examined during the present study and its identity as an isotype
was confirmed by Dr. Orvo Vitikainen (pers. comm.). The names of the herbaria are
abbreviated according to Holmgren & Holmgren (2001) and the names of the authors
according to Brummitt & Powell (1992).

Laboratory analysis: Thallus and apothecial morphology was examined with a Zeiss
Stemi SR dissecting microscope. Observations with the light microscope were performed
on hand made thin sections, after immersing the material in 10 % KOH for 1 minute,
washed with distilled water, and stained with lactophenol cotton blue. The largest
mature ascospores in each slide were chosen and measured to obtain the final size range.
For length and width the medial dimensions and standard deviation were calculated.
Ascospores measurements were then expressed as minimum value measured - medial
minus standard deviation —- medial plus standard deviation - maximum value.

Chemical Analysis: The identification of lichen substances present in each of the
specimens examined was performed by routine thin-layer chromatography (Culberson
& Ammann 1979) and by comparison with authentic samples. The methodology used
for high performance liquid chromatography has been described previously (Elix et al.
2003).

Results and Discussion
Species characters in the Menegazzia cincinnata-M. valdiviensis complex

During our study of the Menegazzia collections, it became obvious that some characters
commonly used to segregate M. cincinnata from M. valdiviensis were ambiguous because
intermediate forms were observed (e.g. the apothecial margin) and that the color of
the upper surface of freshly collected material was extremely variable. As the frequency
of intermediate forms often made it impossible to identify a significant proportion of
collections, we were compelled to review the taxonomic value of the characters used
previously. These characters are discussed and their use evaluated for consistently
separating the two species.

Thallus morphology

Lobe width. The lobe widths reported for M. cincinnata were 1.5-2 mm (Santesson
(1942), 1.5 mm (Calvelo & Adler 1994), 1.2-2.0 mm (Bjerke 2005) whereas for M.

220

valdiviensis they were 1.5-3.0 (Santesson 1942, Bjerke 2005) and 1-2 mm (Calvelo
& Adler 1994). Results from the present study indicate that the range of lobe width
throughout the complex is 0.5-2 (-3) mm. Differences observed in lobe width do not
correlate with the main differential characters observed in this study, and are therefore
not used to segregate the two species.

Branching pattern of the lobes. Previously this has been described as being irregular
for M. cincinnata (Santesson 1942, Calvelo & Adler 1994, Bjerke 2005), whereas for
M. valdiviensis it was characterized as being “irregularly dichotomously ramified”
(Santesson 1942), dichotomous at the periphery and subdichotomous to irregular at the
centre of the thallus (Calvelo & Adler 1994) and irregular (Bjerke 2005). Our present
observations show that most of the specimens had subdichotomously branched lobes,
more rarely dichotomously branched, and very rarely irregular branched lobes. As a
consequence this feature cannot be used to distinguish the two species.

Perforations. For M. cincinnata the perforations have been described as rather
numerous, small, usually less than 0.5 mm diam. (Santesson 1942), dispersed (sparse)
0.2-0.6 (—1.0) mm diam. (Calvelo & Adler 1994), scarce to numerous (Bernasconi et al.
2002), sparse to numerous 0.2-0.7 (—1.0) mm (Bjerke 2005) whereas for M. valdiviensis
they were described as sparse and up to 0.7 mm diam. (Santesson 1942), sparse and
up to 0.5 mm diam. (Calvelo & Adler 1994) and sparse to numerous, small 0.05-0.7
mm diam. (Bjerke 2005). Our present observations showed that the perforations exhibit
similar variation all over the whole complex. The smaller perforations, located at the
periphery of the thallus, are 0.05-0.8 mm diam., whereas the larger ones, situated at the
thallus centre, are 1-2 (-3) mm diam. Perforations are sparse, moderate or numerous
depending on the specimen and are not correlated with other characters. Consequently
this feature cannot be used to distinguish the two species.

Color of the upper surface. The upper surface of M. cincinnata has been described as
pale yellow or yellowish gray, sometimes greenish (Santesson 1942, Calvelo & Adler
1994) to greenish gray (Calvelo & Adler 1994), yellowish gray (Bernasconi et al. 2002) or
pale yellow or yellowish gray, often with a greenish tinge (Bjerke 2005) whereas the upper
surface of M. valdiviensis was described as pale grayish yellow or greenish straw-colored
(Santesson, 1942), yellowish green (Calvelo & Adler 1994, Bernasconi et al. 2002),
greenish gray or pale yellow green (Bjerke 2005). Only Bjerke (2005) segregated the two
species using the color of the lobes as a differential character in his key: M. cincinnata
characterized by “lobes distinctly yellow or yellow-green (paler in shade forms)” and
M. valdiviensis by “lobes greenish or yellow-green’. Our survey of numerous collections
has shown this to be an ambiguous character, since numerous intermediate colors can
be observed in the field, some even having an olive tinge and other specimens from
the north seem to be more yellowish. Further difficulties arise because the color varies
between fresh to dry specimens, making it impossible to compare herbarium material,
and type specimens in particular. Moreover, the chemical analysis of specimens with
different colored upper surface showed no correlating differences in cortical substances
or in their concentrations. The variations are probably due to environmental factors
yet to be established. For these reasons we consider that the color of the upper surface
cannot be used to segregate the two species.

Zoi

Fig. 1. Part of the isotype of Parmelia (Menegazzia) valdiviensis studied (Hollermayer 1146),
showing apothecia with slight to very crenulate (almost incised) apothecial margins.
Scale = 1 mm.

Apothecial morphology and anatomy

Morphology of the Apothecial Margin. The presence of a crenulated apothecial margin
was previously considered to be characteristic of M. cincinnata (Santesson 1942, Calvelo
& Adler 1994, Bernasconi et al. 2002, Bjerke 2005), whereas a thin, entire (smooth)
apothecial margin was considered typical of M. valdiviensis (Santesson 1942). Even
very recently when it was recognized that “the thickness and crenulation of the thalline
exciple of M. cincinnata is more variable than previously expected” the species were
still differentiated as follows: “thalline exciples of young apothecia crenulate and slightly
corrugate: M. cincinnata” and “thalline exciples of young apothecia thin, smooth and
not crenulated: M. valdiviensis” (Bjerke 2005). During the present survey, we frequently
observed that only one type of apothecial margin (crenulate or entire) commonly
develop in a particular specimen, but it was possible to find specimens with both types
of apothecia developing side by side, or other thalli with apothecia with slightly crenulate
margins among other apothecia with markedly crenulate margin, as is the case for the
type of M. valdiviensis (Hollermayer 1146, Fig. 1).

A study of numerous collections led us to conclude that this too is an ambiguous
character that does not clearly segregate the species. Nevertheless, there is some
correlation between the type of apothecial margin and the main differential characters
established in the present study, and this will be discussed below (under Relevant
taxonomic characters).

Ascospores. The type material of M. valdiviensis was recently reported to have mostly
8-spored asci (Bjerke 2005) so it does not belong to subgenus Dispora as was previously
reported. We have now confirmed that all specimens in the complex generally have asci

Dod,

with 8, sometimes with 6, or rarely with 4 ascospores, and very frequently have mature
apothecia with mature asci. Bjerke (2005) reported that M. valdiviensis was characterized
by the “frequency of underdeveloped asci” but we do not consider this to be a reliable
distinguishing character. According to our observations the mature ascospores in all the
specimens of the complex are hyaline, ellipsoidal and with smooth to granular inner
contents. Very mature (probably over mature) ascospores retained (not released) in the
asci are commonly brown to tan. The epispore is commonly rather thick (2-6 um) in
mature ascospores, but is sometimes thinner (1-1.5 um). The granulation of the inner
content, the color of the ascospores and the thickness of the epispore vary in a similar
way over all the specimens of the complex, and therefore cannot be used as differential
characters.

However, the measurement of a very large number of ascospores revealed the
presence of two discontinuous groups of specimens:

Group A, with small ascospores, mostly less than 30 um in length and in the range
[(16-)20-29(-30) x (11-)12.5-20(-22) um]; similar to that given for M. cincinnata by
other authors, Santesson (1942) [20-30(-35) x 12-20(-23) um], Bjerke (2005) [19-28
x 12-18 um].

Group B, with large ascospores, very frequently exceeding 30 um in length, and
in the range [(20-)26.5-35(-39) x (12-)15-23.5(-26) tum]; similar to that given for M.
valdiviensis by Santesson (1942): 21-34 x 11-19 um, but not by Bjerke (2005): 19.0-29.5
x11.0-18.0 um.

The possibility of segregating the collections in the complex by ascospores sizes into
two groups, and the coincidence of these groups with the two main chemical groups,
indicated that ascospores size is a good discriminator, which will be discussed below.

Conidiomata and conidia

In this complex, conidiomata (pycnidia) are frequently present on the thalli immersed
in the upper surface. They are globose, 100-200 um diam. and with a reddish to brown
ostiole. Pycnidia characteristics have not been used previously to distinguish M.
cincinnata and M. valdiviensis. We also observed that the conidia are similar throughout
the complex, being bacilliform frequently with acute ends to very weakly fusiform, (4-
)6-7(-8) um long. These observations are consistent with previous reports (Santesson
1942, Calvelo & Adler 1994, Bernasconi et al. 2002) and can not be used to segregate
the species.

Secondary Chemistry

Thallus chemistry. Previous studies reported that usnic and lecanoric acids were the
characteristic substances present in M. cincinnata (Calvelo & Adler 1994; Bernasconi
et al. 2002; Bjerke 2005). Two additional unidentified compounds were also reported:
unid. 1 (absent to minor), with UV spectrum similar to lecanoric acid, and unid 2 (trace
to minor), also probably similar to lecanoric acid; thamnolic acid was reported as an
accessory substance in some specimens (Bjerke 2005). Usnic, lecanoric and thamnolic
acids have been reported as being characteristic for M. valdiviensis (Calvelo & Adier 1994,
Bernasconi et al. 2002), but Bjerke (2005) reported the presence of usnic and lecanoric
acids as constant (characteristic) compounds, together with three other secondary
metabolites: thamnolic acid (absent to major), and the unidentified compounds unid. 1

223

(absent to trace) and unid. 2 (minor to major), the same two compounds reported for
M. cincinnata.

Our thallus TLC analyses (confirmed by HPLC) of the specimens in the complex led
to the identification of the following metabolites: usnic, lecanoric and thamnolic acids
(all reported previously), gyrophoric acid, 5-O-methylhiascic acid, decarboxythamnolic
acid, atranorin, hiascic acid, strepsilin, di-O-methylstrepsilin, alectosarmentosin,
norascomatic acid and secalonic acid A. More particularly, we established that the
medullary depsides gyrophoric and lecanoric acids were present in all specimens (albeit
in variable amounts). The third depside, 5-O-methylhiascic acid, was detected in the
large majority of specimens studied. Our second find concerned the occurrence of
thamnolic acid. Approximately half of the collections studied lacked thamnolic acid
whereas the remainder contained minor to major amounts of this compound. The
specimens could be segregated into two groups: Group A (chemistry): thamnolic acid
absent (including the type of M. cincinnata) and Group B (chemistry): thamnolic acid
present (including the type of M. valdiviensis).

Alectosarmentosin and norascomatic acid were detected in some specimens of
Group A whereas secalonic acid A was only detected in some specimens of Group B
which had yellow patches in the medulla. Traces of atranorin, hiascic acid, strepsilin
and di-O-methylstrepsilin were detected in some of the specimens in both groups A
and B.

In summary, the related depsides gyrophoric, lecanoric, 5-O-methylhiascic and
hiascic acids are common to all specimens in this complex, so the most important
species diagnostic compounds are the f-orcinol meta-depsides, thamnolic and
decarboxythamnolic acids.

Usnic acid was present in minor to submajor amounts in c. 70% of the specimens
of M. cincinnata, and c. 50% of the specimens of M. valdiviensis as delimited here. In
the remaining specimens of both species, usnic acid was present in trace amounts or it
was not detected (by TLC). Given this variation, the concentration of cortical usnic acid
cannot be used as a differential character in this species complex.

Apothecial chemistry. We observed that the apothecial medullary layer under the
hymenium was white except for very old herbarium collections, which frequently
have a yellow to orange medulla. Recently the yellow-orange color of the apothecial
medulla in this complex was attributed to the presence of anthraquinones (Bjerke 2005).
In our investigations the HPLC analysis of apothecia detached from recently collected
specimens could not detect anthraquinones and showed that apothecial chemistry was
identical to that of the corresponding thallus, apart from the concentration of usnic acid
(which was lower in the apothecia).

Ecology and Substratum

The majority of the specimens examined in the present study were collected in Nothofagus
forests between sea level and c. 1300 m. The specimens were usually corticolous growing
on the branches and/or trunks of various species of Nothofagus (N. alpina, N. antarctica,
N. betuloides, N. dombeyi, N. obliqua, N. pumilio) as well as on Fitzroya cupressoides,
_ Drimys winteri, and Lomatia hirsuta; rarely were they collected on rocks. Neither M.
_ cincinnata nor M. valdiviensis were substrate specific.

224

Distribution

In previous studies M. cincinnata was reported from Patagonia, Tierra del Fuego and
southern Chilean Pacific islands (Santesson 1942), southern South America, particularly
for the continental areas of Argentina (Calvelo & Adler 1994), Patagonia and Isla de los
Estados, Argentina and Chile (Bernasconi et al. 2002) and southernmost South America
from approximately 46° 00’ S (Laguna San Rafael) to the southernmost part of Tierra del
Fuego (Bjerke 2005). Menegazzia valdiviensis was previously reported from the Valdivian
region of Chile, Patagonia (area of Nahuel Huapi lake) and from one Pacific Chilean
island locality (Santesson 1942, Calvelo & Adler 1994), and Tierra del Fuego (Calvelo & ©
Adler 1994), Patagonia (Argentina and Chile, Bernasconi et al. 2002), southern South
America along the Cordillera de los Andes, 37° 40’S (Parque Nacional Nahuelbuta in
Chile) to southernmost South America (probably to 52° S, Bjerke 2005).

In the present study we found that the specimens studied corresponding to chemical
Group A, thamnolic acid absent, occurred mostly in the Andean and sub Andean
localities of Chile and Argentina, 88% at latitudes above 42° S and only 12% in southern
Andean localities below 50° S. In contrast, 91% of the examined specimens of chemical
Group B, thamnolic acid present, were from southermost localities below 50° S, and
only 9% from northern Andean areas of Chile and Argentina.

Relevant taxonomic characters and conclusions

The major result of this study was the discovery that there was a correlation between
the presence or absence of thamnolic acid in the thallus medulla and ascospores length.
We believe that these two characters should be used to segregate M. cincinnata from
M. valdiviensis. Those specimens with small ascospores (mostly less than 30 um long)
that lack thamnolic acid are considered to represent M. cincinnata, whereas those with
large ascospores (mostly longer than 30 um) and with thamnolic acid represent M.
valdiviensis. Only ca. 10 % of the specimens studied could not be segregated in this
manner because they contained thamnolic acid but had small ascospores. This could
possibly be explained by the fact that the ascospores were immature, or even that these
individuals represent hybrids of the two species.

We also found that M. cincinnata and M. valdiviensis as segregated here have disjunct
distribution in southern South America with the former exhibiting a more northerly
distribution (north of 42° S) and the latter with a preference for more southerly areas
(below 50° S).

In the case of M. cincinnata as defined above, we observed that 80% of specimens
had an entire apothecial margin, 8% had a crenulated apothecial margin, and 12%
had apothecia with both types of margin. In M. valdiviensis, on the other hand, 65%
of specimens had apothecia with a crenulated margin, 20% had apothecia with an
entire margin and 15% had apothecia with both types of margin. We conclude that the
characteristics of the apothecial margin and the color of the thallus can not be used
to distinguish the two species because they are too variable. Even so, we did observe
that M. valdiviensis was more likely to have apothecia with a crenulated margin and M.
cincinnata more likely to have apothecia with an entire margin, the opposite of what had
been accepted previously.

Zao

The species

Menegazzia cincinnata (Ach.) Bitter
In Hedwigia 40: 172 (1901).

Parmelia cincinnata Ach., Meth. Lich. 252 (1803). Type: ARGENTINA, Tierra del Fuego
Province, Staten Island (Isla de los Estados), New Year’s Harbour, II.1787, A. Menzies,
s.n. (E-lectotype fide Galloway 1995, p. 103, S-isolectotype! labeled by Galloway
“cotypus”).

Lichen cincinnatus Sm. ex Ach., Meth. Lich.: 252 (1803) nom. illeg. Art. 52.1.

Lichen bullatus Menzies ex Ach., Lich. Univ.: 495 (1810) nom. illeg. Art. 52.1.

Parmelia cincinnata Lam., Encycl. Method. Bot., Suppl. 3: 406 (1813) nom. illeg. Art.
Deus

Thallus foliose, mostly corticolous, up toc. 10 cm diam., tightly attached to the substratum.
Lobes narrow, 0.5-2 (-3) mm wide, straight or irregularly zigzagging, parallel and
contiguous at the margins, subdichotomously or dichotomously branched or rarely with
irregular branching, not parallel at the centre. Upper surface without soredia or isidia,
grayish yellow to greenish yellow, sometimes with olive tinge. Perforations circular to
elliptical, 0.05-2 (-3) mm diam., sparse or moderate, rarely numerous, always on the
median line of the lobes. Medulla white in the upper part of the cavity, black in the lower
part. Lower surface black, scrobiculate.

Apothecia common, adnate to shortly stipitate, disc imperforate, 1-4 (-10) mm
diam., pale to chestnut brown to dark brown; margin mostly entire, not crenulated, or
sometimes slightly crenulated, rarely markedly crenate, sometimes with both types of
margin in the same thallus. Asci elongated to subglobose, 100-120 x 50-60 um when
mature, usually with 8, sometimes with 6 or rarely with 4 ascospores. Ascospores hyaline,
ellipsoid, smooth to slightly granular (vacuolated) within when mature, with a brown
epispore when overmature, (16-—) 20-29 (-30) x (11-) 12.5-20 (-22) um, epispore (1-)
2-3 (-6) um thick.

Conidiomata (pycnidia) common, immersed, globose, up to 200 um diam. Conidia
bacilliform to weakly fusiform commonly with acute ends, (4.5—) 6-7.5 (—8) x 1-1.5
tum.

Chemistry: Upper surface K-; containing usnic acid (submajor to trace), tatranorin
(trace). Medulla K- or K+ pale yellow, sometimes orange in the algal layer, C- or C+
pink or red, sometimes red in the algal layer, KC- or KC+ pink, orange or red; containing
gyrophoric acid (major to minor), lecanoric acid (minor to trace), +5-O-methylhiascic
acid (minor to trace), hiascic acid (minor to trace), alectosarmentosin (minor to trace),
strepsilin (minor to trace), +3-O-methylstrepsilin (trace), +di-O-methylstrepsilin
(trace), +norascomatic acid (trace).

REPRESENTATIVE SPECIMENS EXAMINED— Argentina. Prov. de Chubut. Lago
Futalaufquen, E side, on Nothofagus. antarctica, 20 1 1938, A. Kalela 238a (H). Prov.
del Neuquén. Lago Aluminé, Angostura, c. 1400 m, Araucaria araucana-N. pumilio
forest, 24 XII 1937, A. Kalela 156d (H); 3 km SE of Angostura, 1120 m in heath, on N.
antarctica, 24 XII 1937, A. Kalela 165c (H). Paso Tromen, near Rio Malleo, on N. alpina,
15 II 1994, Messuti s.n. (Herb. Calvelo # 951). Lago Quillén, S side, on N. obliqua, 28
XII 1937, A. Kalela 179c (H). Lago Nahuel Huapi, San Leo, alt. 1100 m, on twigs of
Nothofagus, 1896, P. Dusén 165 (S). Provincia Rio Negro. Bariloche, Arroyo Casa de
Piedra, on N. dombeyi, alt. 800 m, 28 V 1995, Calvelo (# 990), 511995 Calvelo (# 992); E

226

side, alt. 850 m, on N. dombeyi, 7 II 1986, Calvelo (# 57); W side, 16 V 1988, Calvelo (#
749). Cerro Lopez, 1060 m, on N. pumilio, 4 1V 1987, Calvelo (# 48), 1300 m, 25 V 1999,
Calvelo (# 1614). Lago Gallardo, 5 III 1999, Calvelo (# 1618). Llao Llao, pathway Soria
Moria to Lago Escondido, on N. dombeyi, 7 X 1993, Calvelo (# 913). Cerro Bella Vista,
W slope, alt. 1350 m, on N. pumilio, 27 1 1990, Calvelo (Herb. C.-422). Cerro Catedral,
1300 m, on N. pumilio, 24 Il 1987, Calvelo (# 752, BCRU-000754). Cerro Chalhuaco,
31 X 1999, Bernasconi s. n. (# 1617). Cerro Tronador, pathway to Castafio Overa, 1150
m, on N. pumilio, 8 lV 1993, Calvelo (# 844), 1300 m, Calvelo (# 845). Puerto Blest, 14
VII 1897, Dusén 162a (S), Puerto Blest, pathway to Laguna Ortiz Basualdo, on Fitzroya
cupressoides, 1300 m, 12 III 1994, Calvelo (# 954). Villa Tacul, coast oflago Nahuel Huapi,
on Lomatia hirsuta, 7 X 1993, Calvelo (# 918). Provincia de Tierra del Fuego. Isla de los
Estados, Bahia Flinders, W part of bay, 54° 49’ S, 64° 36’ W, 120 m, on Nothofagus, 7 XI
1972, Imshaug 53457 (BCRU-01597). Isla Grande, Aguas Claras, Calvelo & Adler XI
1997 (BAFC-39218). Chile. Region de los Lagos, Prov. de Llanquihue. Parque Nacional
V. Pérez Rosales, mallin, III 1970, Red6n 02157 (TUR-12299).

Menegazzia valdiviensis (Rasanen) R. Sant.
In Ark. Bot. 30A(11):26 (1942).
Parmelia valdiviensis Rasénen, Revista Univ. (Santiago) 22: 197 (1937). Type: CHILE,
Provincia de Valdivia, Cordillera Pelada, la Reina, corticola, 900 m., 30.X1.1934, A.
Hollermayer 1146, ex herb. Rasanen (H-holotype, H-isotype!).

Thallus foliose, corticolous or rarely saxicolous, tightly attached, up to c. 10 cm diam.,
orbicular. Lobes narrow, 0.5-2 (-—3) mm wide, straight or irregularly zigzagging, mainly
parallel and contiguous, infrequently separated, subdichotomously to dichotomously
branched, not parallel at the centre of the thallus. Upper surface lacking isidia or soredia,
greenish yellow to grayish yellow, occasionally with olive tinge. Perforations circular to
elliptical, 0.1-2 (-3) mm diam., sparse to moderate, rarely numerous, occurring on the
median line of the lobes. Medulla white, rarely with yellow patches in the upper part of
thallus cavity, black in the lower part. Lower surface black, scrobiculate.

Apothecia adnate to shortly stipitate, disc imperforate, chestnut brown to tan, 1-4 (-
5) mm diam., margin usually crenulated, infrequently entire, sometimes apothecia with
both types of margin same thallus. Asci elongated to subglobose when mature, 100-150
x 50-70 um, mostly with 8, sometimes with 6, or rarely with 4 ascospores. Ascospores
hyaline, ellipsoid, smooth inside to somewhat granular when mature, with a brown to
tan epispore when over mature. Ascospores (20-) 26.5-35 (-39) x (12-) 15-23.5 (-26)
lum, epispore (1—) 2-3 (-6) um thick.

Conidiomata (pycnidia) frequent, globose, immersed, 85-120 um diam.; conidia
bacilliform to weakly fusiform, (5-) 6.5-7.5 (-8) x 1-1.5 um, commonly with acute
ends.

Chemistry: Upper cortex K-; containing usnic acid (submajor to trace), tatranorin
(trace). Medulla K+ yellow, C- or C+ pale pink, KC+ yellow turning reddish orange;
containing gyrophoric acid (major to minor), lecanoric acid (minor to trace), +5-O-
methylhiascicacid(minortotrace), thamnolicacid (majorto minor), decarboxythamnolic
acid (minor to trace), hiascic acid (trace), +secalonic acid A (minor), +strepsilin (trace),
+di-O-methylstrepsilin (trace), +alectosarmentosin (trace).

REPRESENTATIVE SPECIMENS EXAMINED— Argentina. Provincia de Neuquén.
Lago Traful, on slope, on N. pumilio, 19 XI 1937, A. Kalela 59:b (H). Provincia Rio

peg

Negro. Bariloche, Lago Nahuel Huapi, 5 XI 1896, P. Dusén 168 (S). Prov. de Tierra del
Fuego. Isla Grande, Cerro Cabras, on N. pumilio, 460 m, 28 XII 1986, S. Stenroos 2161
(H), Valle Carbajal, Sierra de Sorondo, Nothofagus forest, 54° 43’ S, 68° 07° W, 300 m,
28 XI 1971, Imshaug 55564 (BCRU-01683); N slope, on N. pumilio, 200 m, 6 I 1940,
Santesson 750 (UPS), Cerro Chennen, SE slope, alt. 200-250 m, 54° 21’ S, 67° 52’ W, N.
pumilio and N. antartica forest, 8 1 1989, Ahti (48163) & Stenroos (H), Rio Larsiparsalik,
on N. betuloides forest, XI 1997, Calvelo & Adler s. n. (BAFC-39172, 39173, 39174,
39175), Laguna Victoria, 70 m, on N. pumilio, Calvelo & Adler s. n. (BAFC-39168, 39169,
39170, 39171, 39176). Isla de los Estados, Port Cook, 18 XI 1902, C. Skottsberg s. n., ex
Herb. Erik P. Vrang (H), Puerto Parry, Nothofagus—Drimys, 54° 47° S, 64° 22’ W, near sea
level, 10 XI 1971, Imshaug 53906 (BCRU-01598). Chile. Region de Magallanes, Prov. de
Magallanes, Estrecho de Magallanes, NE side of Pto. Gallant, 53° 41’ S, 72° 00’ W, 6 X
1969, Imshaug 45104 (BCRU-01675. Isla Clarence. Southern peninsula, 40 m, 16 1 1987,
S. Stenroos 2583 (H); 110 m, on N. betuloides, 17 I 1987, S. Stenroos 2922b (H). Isla
Desolacion, Puerto Angosto, 12 IV 1896, P. Dusén s.n. (S); 16 IV 1896, P. Dusén s.n.(S);
12 IV 1896, P. Dusén 226 ex herb. Malme (S). Isla Furia, E part, alt. 100 m, on Drimys
winteri, 20 I 1987, S. Stenroos 2639 (H); on N. betuloides, 40 m, 20 I 1987, Stenroos 2633
(H); 100 m, on N. betuloides, 20 I 1987, S. Stenroos 2635 (H). Isla Newton, 30 V 1896, P.
Dusén 48 (S). Prov. Ultima Esperanza, Fjordo de Agostini, 54°26 ’S, 70°26 ‘W, 22 II 1929,
H. Roivainen s. n. (H). Fyjordo Almirante Martinez, 52°52’S, 73°28 ’'W, on N. betuloides,
21 II 1929, H. Roivainen s.n. (H).

Acknowledgements

We are grateful to the curators of the following herbaria for the loan of material which in some
cases included type specimens: BAFC, BCRU, H, S$, TUR and to Dr Orvo Vitikainen for the critical
information on collections. We thank Dr. Alan Fryday and Dra. Sionara Eliasaro for the revision
of the manuscript. The study was supported by Secretaria de Investigacién, Universidad Nacional
del Comahue (Project B04 122) and CONICET (Consejo Nacional de Investigaciones Cientificas y
Técnicas, Argentina), Programa de la Flora Criptogamica de Tierra del Fuego and Grant PIP 2268.
MTA is Member of the Research Career of CONICET (Argentina).

Literature Cited

Adler MT, Calvelo S. 1996. Two new species of the genus Menegazzia (Parmeliaceae sensu lato,
lichenized Ascomycotina) from Southern South America. Mycotaxon 59: 367-372.

Brummitt R, Powell C. 1992. Authors of Plant Names. Royal Botanical Garden, Kew.

Bernasconi E, Calvelo S, Adler MT. 2002. Menegazzia (Parmeliaceae: Ascomycota) and an
associated lichenicolous fungus, Abrothallus parmeliarum, from Patagonia, Argentina. Aust.
Syst. Bot. 15: 527-534.

Bjerke JW. 2005. Synopsis of the lichen genus Menegazzia (Parmeliaceae, Ascomycota) in South
America. Mycotaxon 91: 423-454.

Cabrera AL. 1994. Regiones Fitogeograficas Argentinas. Enciclopedia Argentina de Agricultura y
Jardineria: Tomo 2, Fasc. 1. lra. reimpresion, Acme. Buenos Aires.

Calvelo S, Adler MT. 1994. Menegazzia (Ascomycota, Liquenizado) en la Argentina. Bol. Soc.
Argent. Bot. 30: 119-125.

Conti HA. 1998. Caracteristicas climaticas de la Patagonia en Flora Patagénica. Parte 1, Coleccién
Cientifica del INTA, Buenos Aires, Correa, Director.

228

' Culberson CK. Ammann K. 1979. Standardmethode zur Diinnschichtchromatographie von
Flechtensubstanzen. Herzogia 5: 1-24.

Elix JA, Giralt M, Wardlaw JH. 2003. New chloro-depsides from the lichen Dimelaena radiata.
Biblioth. Lichenol. 86: 1-7.

Galloway DJ. 1995. The extra-European lichen collections of Archibald Menzies MD, FLS (1754-
1842). Edinb. J. Bot. 52: 95-139.

Holmgren P, Holmgren N. 2001. Index Herbariorum. Part 1. The Herbaria of the World, ed. 8.
Regnum Vegetabile 120. New York Botanical Garden, NY. |

Rasanen V. 1937. Liquenes Chilenos coleccionados por el R. P. Atanasio Hollermayer en 1927-36.
Rev. Univ. (Santiago). 22: 195-211.

Santesson R. 1942. The South American Menegazziae. Ark. Bot. 30A (11):1-35.

Tuhkanen S. 1992. The climate of Tierra del Fuego from a vegetation geographical point of view
and its ecoclimatic counterparts elsewhere. Acta Bot. Fennica 145: 1-64.

—— a

MYCOTAXON

Volume 95, pp. 229-240 January-March 2006

NATS truffle and truffle-like fungi 13:
Tuber quercicola and T. whetstonense, new species from Oregon,
and T. candidum redescribed

JONATHAN L. FRANK’, DARLENE SOUTHWORTH!
& JAMES M. TRAPPE?

frankjon@sou.edu
‘Department of Biology, Southern Oregon University
1250 Siskiyou Blvd. Ashland, OR 97520-5071, USA

*Department of Forest Science, Oregon State University
Corvallis, OR 97331-5752, USA

Abstract—Two new truffle species, Tuber quercicola and T. whetstonense (Tuberaceae,
Pezizales), are described from southern Oregon, USA. Tuber candidum is redescribed.
These hypogeous species are ectomycorrhizal with Quercus garryana. Descriptions of T.
whetstonense and T. candidum include ectomycorrhizal morphotypes.

Key words—hypogeous fungi, mycorrhizas, DNA

Introduction

Recent research on biodiversity of ectomycorrhizal fungi in oak woodlands included a
survey of hypogeous sporocarps at Whetstone Savanna Preserve in southern Oregon
(Valentine et al. 2004, Frank et al. 2004, Frank 2005). The site is a remnant woodland of
Quercus garryana Dougl. ex Hook. interspersed with Ceanothus cuneatus (Hook.) Nutt.
shrublands. Eighteen species of hypogeous fungi were collected for this survey (Frank
2005), of which three were in the genus Tuber: T. candidum, T. quercicola sp. nov. and
T. whetstonense sp. nov.

Molecular methods were used to compare field collections to hypogeous fungi in
GenBank and to match sporocarps to ectomycorrhizas (Gardes & Bruns 1993, Valentine
et al. 2004, Frank et al. 2004). Our molecular analysis supports the proposition that
spiny-spored and reticulate-spored Tuber species form distinct clades (Zobel 1854,
Frank 2005).

Tuber candidum, the most frequently collected hypogeous species at the study site, was
also among the more common ectomycorrhizal morphotypes collected, second only
in frequency to the ubiquitous Cenococcum geophilum Fr. (Valentine et al. 2004, Frank
2005). Spores from all three Tuber species were present in the fecal pellets of three
small mammals, Microtus californicus, Peromyscus maniculatus, and Reithrodontomys
megalotis, trapped at the research site (Frank 2005).

230
Materials and Methods

Whetstone Savanna Preserve (42°25’N, 122°54’W), owned by The Nature Conservancy,
is on an alluvial plain near the Rogue River in southern Oregon. Precipitation is 40-
50 cm of rainfall per year. Hypogeous sporocarps were collected by raking the ground
with a short-tined garden cultivator beneath and around Quercus garryana (Oregon
white oak, Garry oak) weekly from April through June, 2003 through 2005, and less
frequently in other months. Leaf litter and soil were examined for sequestrate fruiting
bodies. Specimens were described the same day (Weber et al. 1997). Sporocarps were
photographed in the field with a Canon EOS digital SLR camera and in the lab under
a Leica MZ75 dissecting microscope with a SPOT RT Color camera (Diagnostic
Instruments, Inc.) and under a Leica DMLB compound microscope with a SPOT QE
insight camera. Microscopic characters were described from razor-blade sections of
fresh specimens mounted in 5% aqueous KOH. Sections were stained with Melzer’s
reagent (Castellano et al. 1989), rinsed and mounted with polyvinyl lactic acid glycerol
(Brundrett et al. 1996) to make permanent slides for archiving with dried specimens.
Collections were deposited in the herbaria of Southern Oregon University (SOC) and
Oregon State University (OSC).

Mycorrhizas were obtained from soil cores taken under mature trees and seedlings
(Valentine et al. 2004). Roots were rinsed over sieves, examined and mycorrhizal
morphotypes photographed under the dissecting microscope. Ectomycorrhizal outer
mantles were peeled with a sharp needle, mounted in water, and photographed under the
compound microscope. Description of cell morphology of sporocarps and mycorrhizas
follows terminology in Goodman et al. (1996).

DNA was extracted from sporocarps and mycorrhizas with CTAB and amplified in
polymerase chain reactions (PCR) with fungal specific primers ITS1F and ITS4 (White
et al. 1990, Gardes & Bruns 1993). Molecular data were obtained by sequencing of
the internal transcribed spacer (ITS) region, including ITS1, the 5.88 ribosomal DNA
gene and ITS2. PCR products were cleaned in Montage PCR Centrifugal Filter Devices
(Millipore Corporation). Clean PCR products were prepared for sequencing’ with
BigDye Terminator Ready Reaction Mix and sequenced by an ABI 310 Genetic Analyzer
(Applied Biosystems). Sequences were edited with Chromas 1.45 (McCarthy 1998)
and compared to other fungal sequences in GenBank, the NCBI electronic database
(www.ncbi.nlm.nih.gov), with BLAST and to each other with ClustalX (Altschul et al.
1990, Thompson et al. 1997). Sequences were submitted to GenBank; accession numbers
are given with the collection numbers under each species description. Phylogenetic
alignments were generated and edited in ClustalX. Phylogenetic trees using maximum
parsimony and bootstrap values from 1000 replicates with full heuristic searches were
generated in PAUP* 4.0b 10 (Swofford 2002). All characters were equally weighted and
unordered. Gapped positions were treated as missing data (gap = missing).

Zot

Taxonomic Descriptions

Tuber candidum Harkn., Proc. Cal. Acad. Sci. Ser. 3 Bot. 1: 274, 1899.
Figures 1, 2, 4,5

= Tuber olivaceum Harkn., Proc. Cal. Acad. Sci. Ser. 3 Bot. 1: 275, 1899.

= Terfeziopsis lignaria Harkn., Proc. Cal. Acad. Sci. Ser. 3 Bot. 1: 279, 1899.

Ascomata globose to irregularly subglobose stereothecia, 1-4 cm x 1-5 cm. Peridium
smooth, light yellowish brown to reddish brown. Gleba firm, hard when dried, light tan
to dark reddish brown, intricately marbled with thin white sterile veins continuous with
the inner peridium. Odor mild to slightly earthy; taste bland.

Peridium 100-300 um thick with two layers: outer layer 30-100 um thick, light brown,
of irregularly compact to elongated cells 4-10 x 2-5 um; inner layer 70-200 um thick,
hyaline, of interwoven hyphae with irregularly elongated cells 5-15 x 2-3 um. Glebal
trama hyaline, of irregularly isodiametric to elongated cells 4-15 x 2-5 um, sometimes
with interhyphal spaces. Asci globose to subglobose, 60-85 x 45-70 um with a double wall
and a stem 15-50 um long with a forked base, 1-5 spored, hyaline, arranged randomly
throughout the glebal fertile tissues.

Spores light brown, subglobose to ellipsoid, 19-42 x 14-34 um excluding ornamentation
and depending on number of spores per ascus: in 1-spored asci 36-42 x 26-34 um, 2-
spored 28-36 x 22-30 um, 3-spored 23-31 x 18-25 um, and 4-5-spored 19-30 x 14-25 um;
ornamentation of curved spines 2-5 um long at maturity; spore walls 1-2 jm thick.

Habit, habitat and season hypogeous; associated with Quercus garryana in southern
Oregon, 400 m elevation, Mediterranean climate with dry summers and less than 50
cm annual precipitation; also associated with Quercus spp. from Washington and Idaho
south to southern California. Sporocarps fruit below leaf litter in top 2-7 cm of mineral
soil, March to August in our study area but year round over the entire range.

Ectomycorrhizal morphotype tan to brown with lighter tips, cystidia lacking; outer
mantle of interlocking irregular synenchyma to net synenchyma; inner mantle non-
interlocking irregular synenchyma to regular synenchyma.

Collections examined: HOLOTYPE — UNITED STATES. Catrrornia: Placer Co.
AUBURN, Harkness 195, May (BPI, isotype OSC). OTHER COLLECTIONS — UNITED
STATES. CALIFORNIA: Alameda Co. OAKLAND, Mountain View Cemetery, N. Gardner
133, 4 May 1903 (OSC 55902), Butte Co. MERRIMAC, T. Norman, 29 Nov 1933, Trappe
2567 (OSC 80591). Los Angeles Co. SAN GABRIEL Mtns., Evey Canyon, 4.5 mi N of
Claremont, R. Benjamin, 13 Oct 1955, Trappe 17610 (OSC 80596). Mariposa Co. Hwy
120 at Greeley Hill Road, M.A. Castellano, 27 Mar 1985, Trappe 8440 (OSC 46928).
Monterey Co. Hastings Natural History Reserve, Melin River, J.M. Linsdale, 53, 23 May
1945, (OSC 80617). Placer Co. Auburn, H. W. Harkness 197, May (Holotype of Tuber
olivaceum BPI, Isotype OSC); H. W. Harkness 206, June (Type of Terfeziopsis lignaria
BPI, Isotype OSC). Sacramento Co. SACRAMENTO, N. L. Gardner, undated, Gilkey 1149
(OSC 80615). San Mateo Co. PorTOLA VALLEY, S. Rutherford, 4 May 1975, Trappe 4089
(OSC 80592). IpaAHo: Ada Co. Boise, C. Baker, 1976, Trappe 4908 (OSC). OREGON:
Benton Co. 4.5 mi. W of Alpine, M. Hinds, 5 July 2004, Trappe 29542 (OSC). Douglas
Co. ELKTON, Phipps Nursery, G. Menser, 9 Apr 1986, Trappe 8879 (OSC). Jackson Co.

232

MEDFORD, Whetstone Savanna Preserve (42°25’N, 122°54’W). J. L. Frank, 30 Apr 2004,
727 (SOC, OSC 111407, GenBank AY830856); 27 May 2003, 500, 501, 502; 13 June 2003,
512; 8 July 2003, 516; 8 August 2003, 520; 17 March 2004, 608; 25 March 2004, 618,
619, 627; 6 April 2004, 657, 661, 663, 673; 15 April 2004, 675, 677, 678, 679, 681, 683;
23 April 2004, 693, 694, 695; 26 April 2004, 698; 27 April 2004, 703, 705, 708, 711, 715,
719, 721; 30 April 2004, 735; 25 May 2004, 739, 740, 743; 31 May 2004, 746, 748, 750,
752, 754 (OSC 111408), 755; 1 June 2004, 757, 758 (OSC 111409), 759 (OSC 111410);
3 June 2004, 768; 5 June 2004, 778; 6 June 2004, 783 (OSC 111411) (SOC). ASHLAND,
Emigrant Lake (42°08’N, 122°36’W). J. L. Frank, 2 April 2004, 645, 5 April 2004, 652
(SOC). Linn Co. near LEBANON, L. Taylor, 3 Dec 1959, Gilkey 948 (OSC 80599). Marion
Co. TURNER, Marion Hill, Otis Bynum, 20 June 1980, Trappe 5831 (OSC). Polk Co. 5 mi.
W. of MonmoutTH, J. Trappe 1604, 10 Sep 1968 (OSC 80590). Yamhill Co. CHEHALEM
Mrtn., S.M. Zeller, Gilkey 1144 (OSC 80613).

COMMENTS - Tuber candidum was given two other names by Harkness (1899): Tuber
olivaceum, a glebal color variant that is a slightly immature stage of T: candidum, and
Terfeziopsis lignaria, a very immature stage of T: candidum with a white gleba. The
anatomy of all three is identical except for developmental differences. T: candidum
is similar enough to the European T. nitidum Vittad. that the former was regarded
as synonymous with the latter by Lange (1956), Ceruti (1961) and Trappe (1968).
Although T. candidum and T. quercicola (below) are morphologically close to T. nitidum
and T: rufum respectively, DNA sequences indicate that the North American species are
distinct from the European species (Figure 7). Additionally, unlike the T’ rufum group,
including forma nitidum, forma ferrugineum, and variety rufum, the North American
species T: candidum and T. quercicola are morphologically and molecularly distinct
(Montecchi & Sarasini 2000, Ceruti et al. 2003). T’ candidum and T. quercicola are
distinctive among the Tuber species analyzed here; both have an 85-90 base pair insert
in ITS1. Whereas sequences of T’ rufum (AF106892) and T. ferrugineum (AF132506) are
nearly identical, sequences T. candidum and T. quercicola differ by over 10% in ITS1 and
ITS2. Accordingly, despite the lack of a sequence for T: nitidum, it seems appropriate to
retain the name T. candidum for the North American genotype.

The mycorrhizal status of Tuber candidum was confirmed by DNA sequences. ITS
sequence data from SOC727 (OSC 111407; GenBank AY830856) matched a mycorrhiza
(SAP0901; GenBank AY969005) collected from Quercus garryana roots at Whetstone
Savanna Preserve; the two sequences are greater than 97% similar.

Tuber quercicola J.L. Frank, Southworth & Trappe sp. nov. Figures 1, 3, 6

Ascomata globosa vel subglobosa, stereothecia, 1-3 cm lata. Peridium 250-500 um
crassum, verruculosum vel squamosumque rimosum, obscure rubrum vel rubiginosum,
stratis duobus: exteriore 20-100 um crasso, hyphis arcte intertextis; interiore 130-400 um
crasso, hyphis laxe vel arcte intertextis. Gleba firma, brunneola vel atroporphyrea, venis
angustis albis sterilibus intricate marmorata. Asci irregulariter globosi vel subglobosi,
62-80 x 40-55 um, parietibus duplicibus, stipite 10-35 um longa, sporis 1-5. Sporae
brunneolae, ellipsoideae, 20-45 x 15-35 um, spinis 2-5 um longis ornatae. Typus J. L. Frank
738 (SOC).

Etymology: Latin, querci- (oak) and -cola (dweller), “dweller with oaks.’

239

Figures 1-6. Comparison between Tuber candidum and T. quercicola sp. nov. Figure 1. External
surfaces: Tuber candidum (left) vs. T. quercicola (right). Figures 2-3. Cross-sections. Figure 2.
T candidum (SOC602). Figure 3. T. quercicola (SOC747). Figure 4. T. candidum mycorrhiza

(MATO0901). Figures 5-6. Ascospores. Figure 5. T. candidum (SOC512). Figure 6. T- quercicola
(SOC702).

234

Ascomata globose to subglobose stereothecia, 1-3 cm broad. Peridium minutely
verrucose to scaly and cracked, dark red to brownish red. Gleba firm, hard when
dried, light tan to dark reddish brown, intricately marbled with thin white sterile veins

continuous with inner peridium. Odor mild to slightly earthy or often of fresh green

beans. Taste bland.

Peridium 250-500 um with two layers: outer layer 20-100 um thick, rusty brown, of

loosely to tightly interwoven hyphae 3-6 um broad; inner layer 130-400 um thick, of

hyaline, loosely to tightly interwoven hyphae 2-4 um broad. Glebal trama of hyaline,
tightly interwoven hyphae 3-5 um broad. Asci irregularly globose to subglobose, 62-80
x 40-55 um, with a double wall and a stem 10-35 um long and with a forked base, 1-5
spored, hyaline, arranged randomly throughout the glebal fertile tissue.

Spores light brown, broadly to narrowly ellipsoid, 20-45 x 15-35 um _ excluding
ornamentation and depending on number of spores per ascus: in 1-spored asci 36-45
x 26-35 um, 2-spored 30-36 x 24-30 um, 3-spored 22-32 x 20-26 um, and 4-5-spored
20-28 x 15-20 um; ornamentation of curved spines 2-5 um long at maturity; spore walls
1-2 um thick. .

Habit, Habitat and Season: hypogeous; associated with Quercus garryana in southern
Oregon, 400 m elevation, Mediterranean climate with dry summers and less than 50 cm
annual precipitation; also occurring elsewhere in western Oregon to northern California.
Sporocarps fruit below leaf litter in top 2-7 cm of mineral soil, March to August.

Collections examined: HOLOTYPE— UNITED STATES. OrEGon: Jackson Co.
MEDFORD, Whetstone Savanna Preserve (42°25’N, 122°54’W), J. L. Frank, 25 May 2004,
738 (SOC, isotype OSC 111405, GenBank AY918956). PARATY PES: UNITED STATES.
CALIFORNIA: El Dorado Co. Above Hwy 49 S of American River Crossing, Trappe 3907,
18 May 1974 (OSC). Fresno Co. SIERRA NATIONAL Forest, Ross Creek drainage, Turtle
Cr., K. Pendleton, L. Baker, B. Oakley, 25 June 1997, Trappe 22599 (OSC). Sonoma Co.
Kelley Road, S. of Asti, R. Stone, 5 Nov 1976, Trappe 4912 (OSC). OREGON: Benton
Co. OAK CREEK, C. Wheeler, 18 Apr 1978, Trappe 5195 (OSC). Douglas Co. NorTH
Umpqua River, Oak Flat, L. & I. Spaulding 5 May 1984, Trappe 7881 (OSC). Jackson:
Co. MEDFORD, Whetstone Savanna Preserve (42°25’N, 122°54’W) north of Medford, J.
L. Frank 6 April 2004, 662 (SOC, OSC 111403); 15 April 2004, 682; 27 April 2004, 702
(SOC); 30 April 2004, 733 (SOC, OSC 111404); 31 May 2004, 747 (SOC, OSC 111406).
Linn Co. PETERSON’s BuTTeE, D. Wheeler, 21 June 1987, Trappe 9572 (OSC). Marion
Co. TuRNER, Marion Hill Road, O. Bynum, 28 June 1980, Trappe 5854 (OSC). Polk
Co. RICKREALL CREEK, W. Bushnell, 20 June 1987, Trappe 9559 (OSC). Yamhill Co.
CHAMPOEG STATE PaRK, A. Beyerle, 17 June 2000, Trappe 27170 (OSC 80215).

COMMENTS — Tuber quercicola is closely related to T. candidum and to the European
spiny-spored species, T: rufum Pico and T! ferrugineum Vittad. T: quercicola with a rough,
scaly, red peridium, and T. candidum with a smooth, tan peridium can fruit together
under the same tree. The ITS region of T. quercicola is distinct from that of T: candidum
with less than 90% of base pairs in common in the ITS1 and ITS2 regions. Molecular
data position T. quercicola with T. candidum in a different clade from T: rufum and T.
ferrugineum (Figure 7).

2 ka

ZOD

T.borchif
76
100 T.maculatum

99 T.puberulum

400 T.dryophilum

reticulate

T.foetidum
85

T.whetstonense

T.rufum
400

— 7 ferrugineum
100

spiny

T.quercicola
86

T.candidum

: Hydnotryopsis

Figure 7. Phylogenetic tree of ten species in the genus Tuber constructed using maximum
parsimony with bootstrap frequencies (values greater than 50%), comparing ITS sequences from
three southern Oregon species (T: candidum, T. quercicola and T. whetstonense) to sequences of
European species in GenBank, T: borchii (AF132505), T. maculatum (AF003909), T. puberulum
(AJ557534), T. dryophilum (AF003917), T. foetidum (AJ557544), T: rufum (AF106892), T.
ferrugineum (AF132506). Outgoup, Hydnotryopsis setchellii (AY927852).

Tuber whetstonense J.L. Frank, Southworth & Trappe sp. nov. Figures 8-13

Ascomata stereothecia hypogaea, globosa vel subglobosa, 5-15 mm lata, cartilaginea vel
firma. Peridium minute furfuraceum, saepe rimosum, brunneolum vel obscure castaneum;
suprapellis irregularis, cellulis versiformibus usque ad 4-8 (-10) um latis; pellis 30-60 um
crassa, cellulis irregularibus vel isodiametris, 3-7 (-12) um latis; subpellis 70-180 um
crassa, hyphis intertextis 2-4 (-6) um latis. Gleba fuscum, venis albis marmorata. hyphis
hyalinis intertextis 2-4 (-6) um latis. Asci globosi, ellipsoides vel ovoides, 50-80 x 40-60
um, sporis 1-5, maturitate parietes 1-2 um crassis. Sporae aureobrunneae, ellipsoideae,
in ascis unisporis 42-55 x 34-44 um sine ornamentato, in ascis bisporis 30-40 x 26-38
um, in ascis trisporis 24-34 x 20-30 um, in ascis quadri- vel quinquesporis 15-26 x 14-22
um; ornamentum reticulatum alveolatum 2-4 um altum, alveolis 9-12 secus longitudinem
sporarum. Holotypus J. L. Frank 756 (SOC).

Etymology: in reference to the type locality, Whetstone Savanna Preserve.

Ascomata globose to subglobose stereothecia 5-15 mm broad, rubbery to firm. Peridium
minutely scurfy and pubescent with cracks and depressions, often cracked along the
ascocarp perimeter, light brown to dark reddish brown. Gleba solid, with broad, dark
grayish brown fertile tissue marbled with narrow white veins. Odor mildly peppery.
Taste not recorded.

236

Peridium 180-240 um thick: suprapellis at maturity an irregular surface of versiform
cells 4-8 (-10) um broad and with golden brown walls 1-2 um thick; pellis 30-60 —
um thick, a pseudoparenchyma of irregular to isodiametric cells 3-7 (-12) um broad
with golden brown walls 1-2 um thick near the suprapellis grading to hyaline near
the subpellis; subpellis intergrading from the pellis, 70-180 tm thick, of hyaline,
thin-walled, interwoven hyphae 2-4 (-6) ttm broad, in places arranged parallel to the
ascomatal surface. Glebal trama of hyaline, thin-walled, interwoven hyphae 2-4 (-6) um
broad, the sterile veins of similar hyphae, mostly parallel to subparallel. Asci globose to
ellipsoid or ovoid 50-80 x 40-60 um, 1-5 spored, hyaline, lacking a stem or sometimes
with a stem up to 20 x 10 um, walls 1-2 um thick at maturity, embedded randomly
through the tramal tissue.

Spores golden brown, subglobose to ellipsoid, 15-55 x 14-44 um excluding ornamentation
and depending on number of spores per asci: in 1-spored asci 42-55 x 34-44 um, 2-
spored 30-40 x 26-38 um, 3-spored 24-34 x 20-30 um, and 4-5-spored 15-26 x 14-22
um; ornamentation an alveolate reticulum 2-4 um tall with 9-12 meshes along the spore
length; spore walls 3-5 um thick.

Ectomycorrhizal morphotype tan to brown with lighter tips, the surface with septate
cystidia 50-60 um long. Outer mantle an interlocking irregular synenchyma to net
synenchyma. Inner mantle a non-interlocking irregular synenchyma to regular
synenchyma.

Collections examined: HOLOTYPE — UNITED STATES. OreEGon: Jackson Co.,
MEDFORD, Whetstone Savanna Preserve (42°25’N, 122°54’W) 1 June, 2004. J. L. Frank
756 (SOC, isotype, OSC 111412, GenBank AY830855). PARATYPES: UNITED
STATES. OREGON: Jackson Co., MEDFORD Whetstone Savanna Preserve (42°25’N,
122°54’W). J. L. Frank, 3 June 2004, 762 (SOC, OSC 111413), D. Southworth, 17 May
2000, 40; 13 April 2001, 148 (SOC).

COMMENTS - The distinctive morphological characters of T. whetstonense are its fine-
meshed spore reticulum (9-12 meshes along the spore length) in combination with a
brown, pseudoparenchymatic peridiopellis, relatively thick-walled asci, and association
with Quercus garryana in xeric habitats. It resembles Tuber anniae Colgan & Trappe,
but the latter species has smaller, globose to subglobose spores, a glabrous, yellow to
dark olive brown peridium, and a peridiopellis with scattered cells inflated up to 20 um
broad. Moreover, T: anniae inhabits mesic conifer forests in contrast to T. whetstonense,
an inhabitant of xeric oak communities. Tuber pacificum Trappe et al. also has spores
with a fine-meshed reticulum and thick-walled asci, but its peridium has a suprapellis of
appressed to tangled hyphae, and it occurs in mesic conifer forests. A number of other
small and not very distinctive Tuber collections at OSC are similar to the species noted
above but differ in various respects. Evidently, these small species comprise a complex as
morphologically vexing as that found for similar species in Europe (Halasz et al. 2005).

Of the Tuber species in Oregon oak woodlands, T. whetstonense is morphologically and
molecularly distinct from the more common, spiny-spored species T: candidum and
T. quercicola. ‘The length of its ITS region is shorter than 600 bp, whereas those of T:
candidum and T: quercicola are longer than 700 bp. Molecular analysis with ITS data

pha!

Figures 8-13. Tuber whetstonense sp. nov. Figure 8. Cross-section (SOC756). Figure 9. External
surface. Figures 10-11. Ascospores stained with Melzer’s reagent. (SOC756). Figure 12. Mycorrhiza

(MAT0502) showing light tip. Figure 13. Mycorrhiza (MAT0502) showing cystidia.

238

separates the spiny-spored species from the reticulate-spored species, indicating two
major clades within the genus Tuber (Figure 7). T. whetstonense fruited rarely: in five
years, 4 sporocarps were collected, compared with over 200 for T: candidum and 32 for
T. quercicola.

The mycorrhizal status of Tuber whetstonense was confirmed by DNA sequences.
ITS sequence data from the holotype (J. L. Frank 756 [SOC]; OSC 111412; GenBank
AY830855) matched a mycorrhiza (MAT0502; GenBank AY969006) collected from
Quercus garryana roots at Whetstone Savanna Preserve; the two sequences are greater
than 98% similar.

Ecology

Hypogeous fungi are common in Mediterranean climates, having evolved under
selection pressures for survival in warm, dry climates (Montecchi & Sarasini 2000,
Trappe & Claridge 2005). Subterranean fruiting strategies to conserve moisture require
alternatives to the aerial spore dispersal mechanism common to epigeous mushrooms.
Animals, attracted by volatile aromatics produced by the hypogeous fruiting bodies at
maturity, dig them up, consume them, and disperse the spores in their feces (Claridge
& Trappe 2005).

Analysis of fecal pellets of three small mammals, Microtus californicus, Peromyscus
maniculatus, and Reithrodontomys megalotis, revealed that the distinctive, large, spiny
spores of T. candidum were among the more frequently observed fungal spores in fecal
pellets. Spores from T. quercicola and T. whetstonense were also present in pellets (Frank
et al. 2004; Frank 2005).

Acknowledgements

Seth Barry and Lori Valentine provided mycorrhizal data from Whetstone Savanna Preserve.
David Oline and Kathleen Page, Southerrn Oregon University, and Peter Kennedy, University of
California, Berkeley, assisted with molecular analysis. Matthew E. Smith, University of California,
Davis, assisted with molecular analysis and shared data from collections at the Sierra Nevada
Research site. Karen Hansen, Harvard University Herbaria, made useful suggestions about the
manuscript, in particular regarding molecular methods and phylogenetic analysis. Greg Bonito,
Duke University, discovered in his sequences of North American Tuber species that a collection
identified as Tuber anniae had a sequence identical to that of T: whetstonense. We rechecked the
specimen and found it to be, in fact, T: whetstonense. He also made helpful suggestions about the
manuscript.

We thank The Nature Conservancy for access to the study site. This material is based upon work
supported by the National Science Foundation under Grants No. 9981337, DEB-0516229 and DBI-
0115892, and by NATS, the North American Truffling Society (to JLF). Dr. Trappe’s participation in
the research was supported in part by the USDA Forest Service Pacific Northwest Research Station,
Forestry Sciences Laboratory, Corvallis, Oregon.

pie %)

Literature Cited

Altschul SE, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment search tool.
J Mol Biol 215: 403-410.

Brundrett M, Bougher N, Dell B, Grove T, Malajczuk N. 1996. Working with mycorrhizas in
forestry and agriculture. ACIAR Monograph 32. Pirie Printers. Canberra, Australia.

Castellano MA, Trappe JM, Maser Z, Maser C. 1989. Key to spores of the genera of hypogeous
fungi of north temperate forests with special reference to animal mycophagy. Mad River Press,
Eureka, California.

Ceruti A. 1961. Revisione di alcune specie di Elafomicetale e di Tuberali del/America del Nord.
Allionia 7: 1-25.

Ceruti A, Fontana A, Nosenzo C. 2003. Le specie europee del genere Tuber-Una revisione storica.
Museo Regionale di Scienze Naturali, Torino.

Claridge AW, Trappe JM. 2005. Sporocarp mycophagy: nutritional, behavioral, evolutionary
and physiological aspects. In J Dighton, JF White & P Oudemans (eds), The Fungal
Community—Its Organization and Role in the Ecosystem, Taylor & Francis, Boca Raton,
Florida. pp. 599-611.

Frank J, Petersen C, Berninghausen H, Southworth D. 2004. Oaks, hypogeous fungi and mammal
mycophagy: complex mutualism. Abstract, 89th Annual Meeting of the Ecology Society of
America. Portland, Oregon.

Frank JL. 2005. Complex mutualism in an Oregon white oak woodland: hypogeous fungi,
mycorrhizas and small mammal mycophagy. Masters Thesis, Southern Oregon University,
Ashland, Oregon.

Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycetes- application
to the identification of mycorrhizae and rusts. Mol Ecol 2: 113-118.

Goodman DM, Durall DM, Trofymow JA, Berch SM. 1996. A manual of concise descriptions of
North American ectomycorrhizae. Mycologue Publications Sydney, Australia.

Haldsz KZ, Bratek D, Szeg S, Rudndy I, Racz D, Lasztity, Trappe JM. 2005. Tests of species concepts
of the small, white, European group of Tuber species based on morphology and rDNA sequences
with special reference to Tuber rapaeodorum. Mycological Progress 4: 291-298.

Harkness HW. 1899. California hypogeous fungi. Proc. Calif. Acad. Sci. Ser. 3 Bot. 1: 241-292.

Lange M. 1956. Danish hypogeous macromycetes. Dansk Bot Ark 16: 1-84.

McCarthy C. 1998. Chromas 1.45. School of Health Science, Griffith University, Southport,
Queensland, Australia.

Montecchi A, Sarasini M. 2000. Funghi ipogei d’ Europa. Fondazione Centro Studi Micologie dell'A.
M.B., Vicenza, Italy.

Swofford, DL. 2001. PAUP*: Phylogenetic analysis using parsimony and
other methods, 4.0 10 ed. Sinauer Associates, Sunderland, Massachusetts.

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin FE, Higgins DG. 1997. The Clustal X windows
interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Res 24: 4876-4882.

Trappe JM. 1968. Relazioni fra le specie di tartufi europee e nord-americane. Ati Congresso
Internazionale sul Tartufo, Spoleto. pp. 134-137.

Trappe JM, Claridge AW. 2005. Hypogeous fungi: evolution of reproductive and dispersal
strategies through interactions with animals and mycorrhizal plants. In J Dighton, JF White
& P Oudemans (eds), The Fungal Community—Its Organization and Role in the Ecosystem.
Taylor & Francis, Boca Raton, Florida. pp. 613-623.

240

Valentine LL, Fiedler TL, Hart AN, Peterson CA, Berninghausen HK, Southworth D. 2004.
Diversity of ectomycorrhizas associated with Quercus garryana in southern Oregon. Can J Bot
82: 123-135.

Weber NS, Trappe JM, Denison WC. 1997. Studies on western American Pezizales. Collecting and
describing ascomata—macroscopic features. Mycotaxon 61: 153-176.

White TY, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. In: MA Innis, DH Gelfand, JJ Sninsky, TJ White (eds).
PCR Protocols: a guide to methods and applications, pp. 315-322. Academic Press, New York.

Zobel JG. 1854. Augusti Car. Jos. Corda, Iconum Fungorum Hucusque Cogitorum Tomus VI.
(Ultimus). Libraria Friderici Ehrlich, Prague.

MYCOTAXON

Volume 95, pp. 241-245 January-March 2006

Two new species of Parmotrema (Parmeliaceae, Lichenized
Ascomycota) from Brazil

CRISTINE G. DONHA & SIONARA ELIASARO

sionara@ufpr.br
Depto. Botanica, Bioldgicas, Universidade Federal do Parana
Cx. P. 19031, 81531-970, Curitiba, PR - Brazil

Abstract—Parmotrema_ sorediosulphuratum and Parmotrema superaguiense are
described as new. Both species were collected in Guaraquecaba Environmental
Protection Area, located in the northern coast of the Parana State, southern Brazil.
The former species was found in areas of the atlantic rain forest at 40 m altitude
and the latter one was found only in the Parque Nacional do Superagiii in restinga,
a characteristic type of vegetation occurring on nutrient-poor sandy soils along the
Brazilian coastline. The species are morphologically and chemically characterized and
illustrated. Comments with related species are also presented.

Key words—eumitrin, lichens, pigments

Introduction

Parmotrema A. Massal. is one of the most prominent group of foliose lichens in Brazil,
and is mainly characterized by the large thallus with broad lobes, broad naked marginal
zone on the lower surface, simple to rarely branched rhizines and sublageniform to
filiform conidia (Elix 1993). The medulla in the majority of the species is totally white or
sometimes with an orange to orange-red coloration mainly near the lower cortex, due to
the presence of anthraquinones and related substances that react K+ purple. However,
there are 34 species with a totally or partially yellow or yellow-orange pigmented medulla
that contain pigments such as pulvinic acid and its derivatives and the ergochromes
that do not react with K (Hale 1965, 1974, 1977, 1986, Kurokawa 1974, 1984, Krog &
Swinscow 1981, 1983, Louwhoff & Elix 1999, 2002, Nash III & Elix 2002). These species
of Parmotrema with a yellow medulla form a heterogeneous group that belongs to
several different phylogenetic lines (Hale 1974).

During an extensive study of the taxonomy and distribution of the family Parmeliaceae
in Parana State, two new species of Parmotrema with yellow pigments in the medulla
were discovered. These species are described as new based upon their morphological
and chemical characteristics.

Materials and Methods

The two new species were described from specimens collected in Guaraquecaba
Environmental Protection Area (24°45’-25°30’S and 48°00’-48°45’'W), located on the

242

northern coast of the Parana State, southern Brazil. This region represents the best-
preserved area of continuous Atlantic forest left in Brazil. The different types of habitats
in the area include mangroves, restinga (a characteristic type of vegetation occurring on
nutrient-poor sandy soils along the Brazilian coastline), lowland forest, submontane,
montane, and upper montane forests. The climate of the region is humid subtropical
(IPARDES 1990).

Collections of the new species were deposited in UPCB. Specimens of related species
borrowed from S were examined for comparison. The specimens were examined with a
dissecting microscope for morphological characterization. Apothecia and pycnidia were
cut by hand with a razor blade and observed under a light microscope to examine the
anatomical characters. Lichen substances were identified by thin layer chromatography
according to the methods standardized for lichen products (Culberson & Ammann
1979, Elix & Ernst-Russell 1993) and comparison with authentic samples.

Taxonomic Description

Parmotrema sorediosulphuratum Eliasaro & Donha sp. nov. Fig. 1

Thallus membranaceus ad subcoriaceum, adnatus, usque 14 cm lati. Lobi subirregulares
ad sublineares, marginibus crenatis ad fortitutos sublaciniatus, moderatis ad densos
ciliatis; cilia maxime simplicia. Superficies supra viridis cineracea, immaculata. Soralia
marginalia et submarginalia. Medulla flava sulphurea. Superficies infra nigra cum
marginibus brunneis atris ad claros; rhizinae simplices ad furcatas. Apothecia et pycnidia
ignota. Atranorinam, acidum vulpinicum et pigmenta flava ignota continens.

Type: BRAZIL. PARANA: Antonina. CHACARA DONHA (25°14°31"S 48°44’49"W) -
29.1X.2004, C G Donha 1808 (HOLOTYPE-UPCB).

Thallus corticolous, membranaceous to subcoriaceous, adnate, up to 14 cm wide. Lobes
subirregular to somewhat sublinear, plane or ascending, 4-10 mm wide, with rotund
apices, margins crenate to sublaciniate, moderate to densely ciliate; cilia black, mainly
simple or bifurcate, rarely trifurcate, 1.0-3.5 mm long. Upper surface grey green,
emaculate, smooth, becoming rugose and irregularly cracked towards the center. Soralia
marginal and submarginal, soredia granular to subgranular. Medulla bright sulphur-
yellow. Lower surface black with a dark to pale brown margins, smooth to rugose,
moderately rhizinate with a narrow bare marginal zone, 1.0-4.5 mm wide; rhizines
black, in scattered groups, simple to furcate, 0.5-1.0 (-2.0) mm long. Apothecia and
pycnidia not seen.

Chemistry: cortex: K+ yellow (atranorin); medulla: K-, C-, KC-, UV- (vulpinic acid, two
undetermined yellow pigments).

Ecology, Range and Distribution - Parmotrema sorediosulphuratum is known only
from the type locality, where it grows on tree trunks in areas of atlantic rainforest at 40
m altitude.

REPRESENTATIVE SPECIMENS EXAMINED - BRAZIL. PARANA: Antonina. CHACARA
DONHA (25°14’31”S 48°44’49”W) — 03.VII.2003, C G Donha 972 (UPCB). Specimen
examined for comparison: BRAZIL. MATo Grosso: Jangada. FAZENDA SANTA ELINA
~ VII.2000, G Ceccantini s.n. (Parmotrema cornutum (Lynge) Hale-UPCB).

243

Comments - Parmotrema sorediosulphuratum is characterized by the ciliate lobes, the
marginal and submarginal soralia and by the intensely sulphur yellow medulla due
to the production of vulpinic acid. The occurrence of vulpinic acid in Parmotrema
species is rare and known only in two another species, P. cornutum (Lynge) Hale and
P. sulphuratum (Nees & Flot) Hale. Parmotrema sorediosulphuratum differs from both
by the production of soredia and may be considered the sorediate counterpart of P
cornutum.

Parmotrema superaguiense Donha & Eliasaro sp. nov. Fig. 2

Thallus membranaceus, laxe adnatus, usque 16 cm lati. Lobi irregulares 10-20 mm lati,
marginibus moderatis ciliatis; cilia maxime simplicia. Lacinulae frequentes, maxime in
centrum thalli, simplices ad irregulares ramosas. Superficies supra viridis cineracea,
immaculata. Isidia et soredia absentes. Medulla flava. Superficies infra nigra cum
marginem brunneum clarum ad brunneum flavum; rhizinae simplices. Apothecia in
laminatiam, pedicellata ad subpedicellata, discus imperforatus, margo thallinus eciliatus
fortuitus laciniatus, spori 20,0-27,5 (-32,5) x 10,0-15,0 um. Pycnidia frequentia, conidia
sublageniformia 6-8 x 1 um. Atranorinam, acidum graxum et duo pigmenta flava
continens.

Type: BRAZIL. PARANA: Guaraquecaba. PARQUE NACIONAL DO SUPERAGUI, ILHA DAS
PEGAS (25°28'20"S 48°17°58”W) — 24.1V.2004, S Eliasaro 2755 (HOLOTYPE-UPCB).

Thallus corticolous, membranaceous to subcoriaceous, loosely adnate, 12-16 cm broad.
Lobes irregular, plane to ascending, 10-20 mm wide, with rotund apices, margins entire
to laciniate toward the center of the thallus, laciniae 0.5-1.5 mm wide, moderately ciliate;
cilia black, mainly simple, rarely furcate, robust, 0.5-2.0 mm long, mainly in lobes axils.
Upper surface greenish gray, entire, smooth to rugose on older lobes. Isidia and soredia
lacking. Medulla deep yellow. Lower surface black with a yellowish brown margin,
smooth to rugose, sparsely rhizinate with a broad, bare marginal zone, up to 10 mm
wide; rhizines black, in scattered groups, simple, up to 1 mm long. Apothecia common,
laminal, stiptate to substiptate, disc imperforate, 2-10 mm in diameter, thalline margin
eciliate, entire to rarely laciniate, laciniae often pycnidiate; amphithecium maculate,
sometimes rugose veined; spores 20.0-27.5 (-32.5) x 10.0-15.0 um. Pycnidia common,
submarginal on lobes and lacinulae; conidia sublageniform, 6-8 x 1 um.

Chemistry: cortex K+ yellow (atranorin); medulla K-, C-, KC-, UV- (fatty acid, eumitrin
B and eumitrin A group of pigments).

Ecology, Range and Distribution - Parmotrema superaguiense is so far only known
from the Parque Nacional de Superagiii, in restinga.

REPRESENTATIVE SPECIMENS EXAMINED - BRAZIL. PARANA: Guaraquecaba. PARQUE
NACIONAL DO SUPERAGUI, ILHA DAS PEGAS (25°28'20"S 48°17'58°W) -24.IV.2004, S
Eliasaro 2748 (UPCB); ILHA DE SUPERAGUI (25°27’S 48°14’W) — 8.IV.2003, S Eliasaro
& CG Donha 2589 (UPCB); 10.IV.2003, S Eliasaro & C G Donha 2706 (UPCB);
15.VIII.2004, C G Donha 1832 (UPCB). Specimens examined for comparison: BRAZIL.
Mato Grosso: Coxipé, NEAR CuIABA — Malme 2198B (holotype-S, Parmelia lyngeana
Zahlbr.: based on Parmelia merrillii Lynge, 1914, non Parmelia merrillii Vain., 1909);
Santa Anna da Chapada - Malme 2477 (holotype-S, Parmelia cornuta var. crocea

Lynge).

244

Figures 1-2. New species of Parmotrema: 1. Parmotrema sorediosulphuratum (holotype in UPCB).
2. Parmotrema superaguiense (holotype in UPCB). Bars = 10 mm.

Comments - Parmotrema superaguiense is characterized by the yellow medulla, the
ciliate lobe margins, the presence of laciniae and the imperforate apothecial disc. It is
superficially similar to P lyngeanum (Zahlbr.) Hale, which has narrow lobes (5-10 mm
wide) and the holotype produces protocetraric acid and skyrin. Other ciliate Parmotrema
species that lack vegetative propagules and have a distinctly yellow to orange yellow
medulla differ from P. superaguiense in chemical properties and other characters: P
lopezii Hale has a yellowish green thallus with usnic acid and atranorin in the upper
cortex and protocetraric acid and secalonic acid A in medulla. P cristatum (Nyl.) Hale
contains protocetraric acid in medulla. P appendiculatum (Fée) Hale produces barbatic
acid in the medulla and, according to Krog & Swinscow (1983), a pigment restricted to
the vicinity of the apothecia and the thalline exciple.

245

Acknowledgements

The authors wish to thank the curator of S herbarium for the loan of specimens, Prof. Nasser K.
Hammad for checking the Latin descriptions; Dr. John A Elix and Dr. Susana Calvelo for the critical
revision of the manuscript and “Instituto Brasileiro do Meio Ambiente e dos Recursos Naturais
Renovaveis” (IBAMA) for collection permission n° 118/2002 and 133/2003. Cristine G. Donha is
grateful to “Coordenacao de Aperfeicoamento de Pessoal de Nivel Superior” (CAPES) for a master
fellowship. ?

Literature Cited

Culberson CFE, Ammann K. 1979. Standarmethode zur Diinnschicht-chromatographie von
Flechtensubstanzen. Herzogia 5: 1-24.

Elix JA. 1993. Progress in the generic delimitation of Parmelia sensu lato lichens (Ascomycotina:
Parmeliaceae) and a synoptic key to the Parmeliaceae. Bryologist 96: 359-383.
Elix JA, Ernst-Russell KD. 1993. A catalogue of standardized thin layer chromatographic data and
biosynthetic relationships for lichen substances. Australian National University, Canberra.
Hale ME. 1965. A monograph of the Parmelia subgenus Amphigymnia. Contributions from the
United States National Herbarium 36: 193-358.

Hale ME. 1974. Notes on species of Parmotrema (Lichenes: Parmeliaceae) containing yellow
pigments. Mycotaxon 1: 105-116.

Hale ME. 1977. New species in the lichen genus Parmotrema Mass. Mycotaxon 5: 432-448.

Hale ME. 1986. New species in the lichen family Parmeliaceae (Ascomycotina). Mycotaxon 25:
S5203.

[IPARDES] Instituto Paranaense de Desenvolvimento Econémico e Social. 1990. Macrozoneamento
da Area de Protecéo Ambiental de Guaraquegaba. Curitiba.

Krog H, Swinscow TDV. 1981. Parmelia subgenus Amphigymnia (Lichenes) in East Africa. Bulletin
of British Museum of Natural History (Bot.) 9: 143-231.

Krog H, Swinscow TDV. 1983. A new species and new combinations in Parmotrema (Parmeliacae).
Lichenologist 15: 127-130.

Kurokawa S. 1974. Four new species of Parmelia from Brazil. Bulletin of the National Science
Museum (Tokyo) 17: 297-300.

Kurokawa S. 1984. Joint occurrence of diffractaic and barbatic acids in Parmelia, subgenus
Amphigymnia (Lichenes). Journal of Japanese Botany 59: 193-198.

Louwhoff SHJJ, Elix JA. 1999. Parmotrema and allied lichen genera in Papua New Guinea.
Bibliotheca Lichenologica 73.

Louwhoff SHJJ, Elix JA. 2002. The Parmeliaceae (lichenized Ascomycota) of New Caledonia.
Lichenologist 34: 373-394.

Nash III TH, Elix JA. 2002. Parmotrema. In: Lichen Flora of the Greater Sonoran Desert Region
(TH Nash III, BD Ryan, C Gries, F Bungartz, eds.). ASU Lichen Herbarium, Tempe, v.1, p.318-
229)

246 |

; :
r
i
'
i
, ' i
; ,
u Ve
f
1 met
‘
i
: | d A
i
P
’ \
> |
i 4 .
'
—- i }
|
Q
\ i
4 1
Mh }
] Lae
lL - j
y 4
x :
}
c
a ' !
'
=F
;
’ -
'
'

MY COTAXON

Volume 95, pp. 247-254 January-March 2006

Russula siamensis:
a new species of annulate Russula from Thailand

S. YOMYART’, J. PIAPUKIEW?, R. WATLING?,
A. J. S. WHALLEY‘ & P. SIHANONTH®”

* sprakits@chula.ac.th
Program of Biotechnology, Faculty of Science, Chulalongkorn University
Bangkok 10330, Thailand

"Department of Botany, Faculty of Science, Chulalongkorn University
Bangkok 10330, Thailand

°Caledonian Mycological Enterprises, Crelah
26 Blinkbonny Ave, Edinburgh EH4 3HU. Scotland, U.K.

‘School of Biomolecular Science, Liverpool John Moores University
Byrom Street, Liverpool, L3 3AF, U.K.

*Department of Microbiology, Faculty of Science, Chulalongkorn University
Bangkok 10330, Thailand

Abstract —Russula siamensis, associated with Dipterocarpus alatus, is described as new.
An annulate Russula is unique in the Thai mycota.

Key words—Pelliculariae, Ingratae, Pectinatae

Introduction

Annulate species of Russula Pers. are totally unfamiliar to European field mycologists
except for a privileged few who can collect in the tropics, yet Europe was the continent
that spawned the basic classification of the genus. Studies there attempted to organize,
in what was thought to be a natural way, those species found in the temperate areas of
the world; for a recent account see Romagnesi (1967). As exploration was made more
distant from Europe collections were made which stretched this classification to breaking
point. No more so when Heim (1938ab) described material from Madagascar when
it soon became clear that all was not well with the previously held, rather simplified,
views. Heim described a range of species of Russula which possessed rings and which
he clustered around his names ‘Russula annulata, R. heliochroma & R. parasitica. Even .
then he adopted a rather cautious approach in dealing with these fungi, although Heim
was often prepared to accept rather unorthodox and controversial views (Heim 1948,
1971). Species with an annulus were even a novelty to him and he created the new Sect.
Pelliculariae to house the species he studied emphasising the thin-flesh, pectinate pileus-
margin and an annulus, which could be very fugitive indeed.

248

The next stage in the development of this saga was the description from South America
of Russula brasiliensis Singer, a fungus later found by to be the same as Clitocybe puiggarii
Speg. and subsequently the epithet was transferred to Russula by Singer, similarities in
structure lying with other Pelliculariae; see Singer (1986). There is little doubt that Mme.
Goossens-Fontana when resident in the then Belgian Congo had been familiar with
annulate russules and had illustrated them, the description of R. xylophila Beeli and
its allies resulting from these observations (Beeli 1928, 1936). It was not until one of

us (RW) visited the Cameroon, West Africa, and Buyck published on the East African

and Congo Russula mycota (Buyck 1993, 1994) that the number of annulate Russula
species became awe-inspiring. Thirteen annulate species have now been formally
described from Africa and several more are known from field notes. Subsequently
Russula puiggarii was collected in the Caribbean by Pegler (1983), along with a second
new species, R. hygrophytica Pegler (Pegler & Singer 1980). Buyck & Ovrebo (2002) in
their study of Russula species from Panama considered R. puiggarii and R. hygrophytica
to be conspecific but Pegler (pers. comm.) maintains that they are distinct taxa. A whole
raft of S. American taxa all attributed to Sect. Pelliculariae, some with rings and others
closely related lacking such a structures, are now known.

In the Pelliculariae Singer (1986) recognized eight subsections, viz. Epitheliosae Singer,
Guayarenses Singer, Radicantes R. Heim, Heliochrominae R. Heim, Discopodinae R. Heim,
Diversicolores Singer, Pluviales Singer and Batistae Singer. Subsections Heliochrominae
and Discopodinae and possibly Pluviales contain representatives from both Africa
and from South America, whilst the others are based on S. American elements—
except subsect. Guayarenses, which includes a single species from Australasia, viz. R.
eburneoareolata Hongo. ‘Thus this last taxon was the only Asiatic species then known in
the group. Since Singer’s summary, Buyck & Horak (1999) have described R. cingulata
from Papua New Guinea, and although it would have been placed within Heim’s concept
of Sect. Pelliculariae, these authors placed their new taxon in Sect. Fistulosae subsect.
Meleagrinae in keeping with the re-evaluation of pellicularioid Russula spp. The species
are distributed, as Buyck has eloquently demonstrated, not just in one section, viz.
Pelliculariae, but in several sections of Russula indicating that the annulate/thin-fleshed
morphotype had evolved several times, probably in response to environmental factors
(Buyck 1988ab).

The present article reports for the first time on an annulate Russula from Thailand
indicating that the annulate feature is a more widely distributed phenomenon than first
thought, exposing still further the inadequacies of our present approach to understanding
the genus Russula based on European taxa alone. The finding of such a fungus was in
the opinion of one of us inevitable, as elements had already been found amongst the
Malaysian Russula mycota that demonstrated copious veil production attached to the
pileus-surface in much the same way as the recently described R. messapica Sarnari
from Italy.

Materials and Methods

During collecting trips to plantations of Dipterocarpus alatus Roxb. (Dipterocarpaceae)
in eastern Thailand, several interesting mycorrhizal fungi have been collected. One
of these was a species of Russula characterised by a distinctly annulate stipe. Its basic

249

appearance was one of a thin-capped pileus with pectinate-striate margin, slender
stature and isolated spines on the basidiospores. These fundamental characters agree
in all ways with the Neotropical members of the Sect. Pelliculariae, but further analysis
was necessary for placement in the scheme proposed by Buyck et al. (1986). The present
species grows on bare sandy loam soil with D. alatus which prefers moist soils, and with
ground cover of Malaysian grass.

DNA analysis

Genomic DNA was prepared from the fresh stipe tissue and extracted with
cetyltrimethylammonium bromide (CTAB) as described in Zhou et al. (1999). PCR
amplification of the internal transcribed spacer (ITS) was performed in a total volume of
50 wl which comprised approx. 100 ng genomic DNA, 1x PCR Master Mix (Fermentas,
California, USA), and the primer ITS1f (Gardes & Bruns 1993) and ITS4 (White et
al. 1990). The amplification was performed in a thermocycler (TGradient; Biometra,
Germany) with 94 °C for 5 min , followed by 38 cycles of 94 C for 1 min, 51 C for 1 min
and 72 C for 1 min, with a final extension of 72 C for 5 min. PCR product was purified
using the NucleoSpin’ (Macherey-Nagel Inc., Easton, USA) and sequenced externally by
Macrogen (Seoul, Korea) using the same primers as for amplification. The ITS sequence
of R. siamensis was submitted to GenBank with accession number AB206535.

Taxonomic Description

Russula siamensis Yomyart, Piapukiew, Watling, Whalley & Sihan. sp. nov.

Figs. 1-2
Pileus 28 mm, convexus dein depresso-explanatus, centro glabro sed conspicue sulcato
marginum versus griseo-brunneus vel pallide fuscus, subviscidus. Stipes 18 x 7mm,
cylindricus, lamellis concoloris, siccus, fragile, annulo distincto membranaceo mobili
concolore instructis vel pileis-concolores. Lamellae adnatae - adnexae, subdensae, primo
albidae dein pallide. Caro albida, tenua. Sapore leviter acri; Odore leviter frugose. Sporae
albidae in cumulo 8 -9 x 6 -7 um subglobosae vel ovoideae verruculosis cylindricis isolatis
amyloideis suprahilaris inamyloidea. Basidia 4-sporigera. Cystidia cylindrica vel fusoideo-
mucronata numerosa. Holotypus: Thailand, Khao Hin Sorn, Chacherngsoa prov. 22 viii
2004, sub Dipterocarpus alatus. Wat.No. 28784 in E.

Pileus 28mm, convex then plano-convex but slightly and shallowly depressed at centre,
not involute, pectinate-striate at margin, strongly striate to 2/3rds, brownish biege to
pale ochraceous grey, darker along the radial ridges and then even hazel colour, slightly
viscid when fresh, radially fibrillose-wrinkled but not disrupting to form flakes or
squamules. Fig 2A; stipe 18 x 7mm, whitish, flushed with colour of pileus in smudges
below annulus, cylindric, equal, with obtuse abrupt rounded base slightly depressed at
point of attachment to the substratum, darkening at very base; annulus about 1mm
thick with a lower zone concolorous with pileus and an upper white zone, membranous,
loosening, discrete; lamellae adnate to adnexed, concolorous with stipe, cream-colour,
relatively widely spaced, very few intermediates but some major lamellae venose at their
base. Fig 2B; context very thin; taste slightly acrid; odour slightly fruity.

Basidiospores heterotropic orthotropic, white to very pale cream-colour in mass
(A - B), 8 - 9x 6 - 7 um excl. ornamentation, subglobose to broadly ellipsoid with a

250

slight suprahilar applanation, but lacking distinct plage, hyaline, with strongly amyloid
ornamentation consisting of isolated or almost isolated conical warts 0.5-lum high,
neither catenulate nor reticulate, hilar appendage distinct < 2um long with a basal
slightly amyloid cuff. Figs. 1F & 2D; b/w photos; cheilocystidia crowded forming an
almost completely homogeneous margin, 29 - 48 x (5.6-) 6.7 - 11 um, hyaline, elongate- —
clavate, some drawn out into broad lanceolate apex or clavate with minute apical
papilla, changing to either yellowish sepia in SV or where more deeply seated dark
purple-brown. Figs. 1B, C & 2C; macrocystidia widespread, hyaline with or without
granular contents in ammoniacal solutions, similar to cheilocystidia but more distinct,
more elongate-clavate and appendages at apex more elaborate, often drawn out into

Fig. 1. R. siamensis holotype. A. Macrocystidium. B. Cheilocystidia. C. Range of apices of
cheilocystidia. D. Basidium. E. Terminal elements of pileipellis. F Basidiospores.
Bars: A-E = 10 um; F=5 um.

“hl

Fig. 2. R. siamensis holotype. A.&B. Fresh basidiome. C. Scanning electron micrograph of
cheilocystidia (C), macrocystidia (M) of R. siamensis. D. High magnification of macrocystidia (M),
basidiospore (S) and tetrasterigmatic basidia (T) with various stages of basidiospore formation of
R. siamensis. Note: smooth surface of papillate macrocystidia compared to wrinkled surface of
basidia. Bars: A = 10 mm; B&C = 10 um; D = 5 um.

elongate papilla, dark purple-brown in SV with granular contents. Figs. 1A, 2C&D;
basidia 4-spored, narrowly clavate, in upper part with parallel sides, hyaline, with
granular contents especially in SV, 30 - 38 x 6.5 - 8.5 (- 10) um; sterigmata distinct
2- 4 um long. Figs. 1D & 2D; pileipellis ixodermic with upper gelatinized zone 15 um
thick, suprapellis composed of radially arranged hyphae 4.5 - 6.5 um broad with shiny
walls and aggregated in places to give yellowish brown skeins intermixed with broader
elements 13um plus broad and with some rounded sphaerocytes 20 - 35 tm broad
exposed between the skeins; yellowish brown, granular contents in SV in many hyphae
but apparently randomly distributed over the pileus except where concentrated in the
skeins of hyphae; no prominent dermatocystidia seen, replaced by poorly differentiated
obtuse or torpedo-shaped terminal elements 17 - 20 (- 60) x 6.5 -11 um or mixture
of broader elements, generally with granular yellowish sepia contents in SV. Fig. 1E;
stipitipellis with poorly developed, filamentous, terminal elements, dark purple-brown
in SV, seated on hyaline, more-or-less parallel or intertwined, filamentous hyphae 2.5
-3.5 um broad; similar in structure to parts of the pileipellis but less organized; clamp
connections absent.

DOL

Habitat Thailand, Chacherngsoa Province, Panomsarakam District, Khao Hin Sorn Royal
Development Study Area, 22 viii 2004, under Dipterocarpus alatus, in plantation, legit
Sunadda Yomyart et al., Wat. No. 28784 in E; duplicate in Department of Microbiology,
Faculty of Science, Chulalongkorn University, Bangkok, Thailand.

Note SV = Sulphovanillin reagent.

Discussion

In overall features the present species closely approaches Russula cingulata Buyck &
E. Horak, described from Papua New Guinea, but in minutiae there are important
differences, especially in that the pileus does not disrupt into flakes or into scales as R.
cingulata; the basidiospores are also larger and less strongly ornamented. In colour R.
siamensis resembles members of the North Temperate Russula amoenolens Romagn. /
R. sororia (Fr.) Romell - complex, although the margin of the pileus is pectinate-striate
from a much earlier stage probably because of the thinness of the flesh. In the pectinate
feature it agrees with R. pectinatoides Peck in addition to the slightly russet flush which
develops with age at the stipe-base. Buyck & Horak (1999) placed their fungus in Sect.
Fistulosae subsect. Meleagrinae but they indicated that it certainly comes close to Sect.
Ingratae subsect. Pectinatineae erected by Bon (1986). Interestingly R. amoenolens is the
type of the subsection. It is suggested that R. siamensis should be placed therein and this
is supported by the ITS sequencing data. Miller & Buyck (2002) examined ribosomal
DNA sequences for 87 species of Russula from Europe but these did not include an
annulate species. Therefore at present available DNA sequences for the ITS region of
members of Russulaceae is limited, and only indicative as the family is probably of
the order of 400 species and complex in nature. At the moment our novel species sits
uneasily until further annulate species are sequenced. The species was introduced as R.
insignis Quél., then later in the same year it was recombined as a variety of R. pectinata
— R. pectinata var. insignis (Quél.) Quel. (Quélet 1888) and considered by Romagnesi
(1967) to be the same as R. livescens (Batsch) Quél. but differs in that there is evidence
of a pale yellow marginal veil. This would be in keeping with a placement near to R.
siamensis with its rather more fully developed velar tissue.

In parallel to the Thai fungus, Russula cingulata is found with a member of the
Dipterocarpaceae but the host of R. siamensis occurs only in the evergreen forests of
Myanmar (Burma) and Thailand, and the Andaman Islands. Dipterocarpus alatus is not
found in Peninsula Malaysia, except doubtful records at 152 m. in Penang and near Ipoh
in Perak. (Symington 1941). It would, however, be expected to occur further north but
not south into the collecting areas visited by Horak in Papua New Guinea since there
appears to be some host specificity shown by the two S.E. Asian annulate Russula spp.

Acknowledgements

This work was financial supported by the Thailand Research Fund through the Royal Golden
Jubilee Ph.D. program to S. Yomyart and P. Sihanonth under the research project no. 2.B.CU/47/
N.1. Thanks to Dr. Warawut Chulalaksananukul for use of his laboratory facilities. We are grateful
to Professor Steven Miller and Professor David Pegler for reviewing the manuscript.

pa fe!

Literature Cited

Beeli M. 1928. Contribution a létude de la Flore mycologique du Congo, champignons récoltés
par Mme. Goossens et determinés par M. Beeli. V. Fungi Goossensiani. Bulletin de la Société
Royale de Botanique de Belgique 2nd series 60: 153-169.

Beeli M. 1936. Contribution a létude de la Flore mycologique du Congo, champignons récoltés
par Mme. Goossens et determinés par M. Beeli. XI Fungi Goossensiani. Bulletin du Jardin
Botanique National de Belgique 14: 83-91.

Bon M. 1986. Novitates. Documentes Mycologigues 17 (No 65): 51-56.

Buyck B. 1988a. Etude microscopique de specimens types de Russules tropicales de la sous section
Diversicolores. Mycotaxon 33: 57-70.

Buyck B. 1988b. ditto. sous section Pluviales. Mycotaxon 33: 71-80.

Buyck B. 1993. Russula I (Russulaceae). Flore Ilustrée des Champignons d’Afrique Centrale,
(Fasc.15): 337-447.

Buyck B. 1994. Russula II. (Russulaceae). Flore Illustée des Champignons d’Afrique Centrale (Fasc.
16): 411-541.

Buyck B, Horak E. 1999. New species of Russula (Basidiomycotina) associated with Anisoptera
(Dipterocarpaceae) in Papua New Guinea. Australian Systematic Botany 12: 727-742.

Buyck B, Ovrebo CL. 2002. New and interesting Russula species from Panama. Mycologia 94: 888-
901.

Buyck B, Thoen D, Watling R. 1986. Ectomycorrhizal fungi in Africa, in IJ Alexander et al. (eds.),
Essays on the ecology of the Guinea-Congo Rainforest. Royal Society of Edinburgh Proceedings,
Series B. 104: 313-334.

Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycetes: application
to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113-118.

Heim R. 1938a. Diagnoses latines despéces et varietés nouvelles de Lactario-russulés du domaine
oriental Madagascar. Candollea 7: 374 -394.

Heim R. 1938b. Les Lactario-russulés du domiane oriental de Madagascar, essai sur la classification
et la phylogenie des Asterosporales. Prodrome a une flore mycologique de Madagascar et
dépendences 1: 196 p. 4 pl.

Heim R. 1948. Phylogeny and classification of macro-fungi. Transactions of the British Mycological
Society 30: 161-178.

Heim R. 1971. The interrelationships between the Agaricales and Gasteromycetes. 505-534, in RH
Petersen (ed.), Evolution in the Higher Basidiomycetes. Knoxville, University of Tennessee
Press.

Miller SL, Buyck B. 2002. Molecular phylogeny of the genus Russula in Europe with a comparison
of modern infrageneric classifications. Mycological Research 106: 259-276.

Pegler DN. 1983. Agaric Flora of the Lesser Antilles. Kew Bulletin. Additional Series IX: 617-621
pl. 21A-B, figs 126 a-h.

Pegler DN, Singer R. 1980. New Taxa of Russula from the Lesser Antilles. Mycotaxon 12: 92-96.

Quélet L. 1888. Flore Mycologique de la France: 346.

Romagnesi H. 1967. Les Russules d’Europe et d'Afrique du Nord. 998pp. Bordas, France.

Singer R. 1986. The Agaricales in modern taxonomy. KOnigstein, Koeltz Scientific Books.

Symington CE. 1941. Forest Manual of Dipterocarps. Malayan Forest Manual 16, 244 pp.

White T, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in MA Innis et al. (eds), PCR Protocols: a guide to
methods and applications. San Diego, Academic Press.

254

Zhou Z, Miwa M, Hogetsu T. 1999. Analysis of genetic structure of a Suillus grevillei population
in a Larix kaempferi stand by polymorphism of inter-simple sequence repeat (ISSR). New
Phytologist 144: 55- 63.

MY COTA XON

Volume 95, pp. 255-260 January-March 2006

Embellisia oxytropis, anew species isolated
from Oxytropis kansuensis in China’

Qi WANG?

qwang2003@hotmail.com
Institute of Mycology, Jilin Agricultural University
Changchun 130118, P. R. China

HIDEYUKI NAGAO

Genebank, National Institute of Agrobiological Sciences
Tsukuba 305-8602, Japan

YU-LING LI & HONG-SHENG WANG

Institute of Grassland, Qinghai Academy of Animal Science & Veterinary Medicine
Xining 810003, PB. R. China

MAKOTO KAKISHIMA

Graduate School of Life and Environmental Sciences, University of Tsukuba
Ibaraki 305-8572, Japan

Abstract—Embellisia oxytropis, isolated from Oxytropis kansuensis in China, is
described and illustrated as a new species. This species is characterized by cylindrical
conidia with 3-4 transverse septa and 1-celled abundant chlamydospores.

Key words—cultures, isolation, conidiophores, conidia, spores

Introduction

Since the genus Embellisia was established and segregated from Helminthosporium by
Simmons (1971) based on the morphological characteristics of conidiophores, conidia
and conidial septa, 21 species have been described or transferred from other genera (de
Hoog & Muller 1973; Muntafiola-Cvetkovic & Ristanovic 1976; Simmons 1983, 1990,
2004; David et al 2000).

‘Supported by National Natural Science Foundation of China (No. 30270008) and Japan Society for
the Promotion of Science (JSPS). Contribution no. 203, Laboratory of Plant Parasitic Mycology,
Graduate School of Life and Environmental Sciences, University of Tsukuba, Japan.

“Corresponding author

256

Oxytropis kansuensis Bunge (Leguminosae) is widely distributed in grassland of Tibet
plateau in China. This species is reported as a locoweed, which is poisonous to animals
and causes diseases of livestock (Chang et al. 1981). An endophytic fungus was isolated
from its healthy flowers, stems and leaves. Based on the morphological examination we
consider this fungus a member of Embellisia. Comparative morphology with 21 species
shows that this fungus is morphologically different from them. Therefore, we describe
this fungus as a new species.

Materials and Methods

Plant sample: The healthy locoweed, Oxytropis kansuensis, was coliected at Mt. Daming,
Qinghai, China, July 20, 2004 and kept in a refrigerator at 4C° for fungal isolation.

Isolation: The fungus was isolated with the method modified from Koga (1993) and
Braun et al. (2003). Plant samples were first immersed in 50% ethanol for 20s to
eliminate bubbles prior to surface sterilization and were sterilized as indicated in Table
1. The sterilized samples were dried on the sterilized filter papers, then cut into small
pieces and incubated on PDA medium at 18C° in darkness. After isolation, the fungus
was cultured on PDA, CMA, V-8 and EDMA media.

Table 1. Methods of surface sterilization

Solution Treatment times
70% ethanol 30 seconds
1% NaClO 3 minutes (leaf or flower)

5 minutes (stem)

Sterilized water 1 minute rinse, 2 times

Examination: The characteristics of the fungal colonies were observed with a
stereomicroscope. Hyphae and conidia obtained from cultures were mounted in lacto-
phenol solution on glass slides and examined with a light microscope (LM). For scanning
electron microscopy (SEM), they were fixed by vapors from 10% glutaraldehyde solution
and coated with platinum, and then observed with a Keyence VE-7800 SEM operating
at 2kv or 5kyv.

Observation of the fungus in plant tissues: The small pieces of plant samples were
boiled in the alcoholic lacto-phenol solution (1 part lacto-phenol to 2 parts 95%
ethanol) for 5-10min and stained in analine-blue solution for 30sec. Lacto-phenol
contains 10g phenol, 10ml glycerine, 10ml lactic acid and 10ml distilled water. After
staining they were immersed in the same solution to destain its pigment for a short
time. The hyphae in plant tissues were observed with LM by the method of Koga (1993).
For SEM observation, small pieces cut from dried plant samples or plant samples whose
epidermis was removed were prepared. They were directly coated by platinum with a
JEOL JFC-1600 Auto Fine Coater and observed with a Keyence VE-7800 SEM operating
at 2kv or 5kv.

Fig.1. Conidia and conidiophores of Embellisia oxytropis isolated from Oxytropis kansuensis and
cultured on PDA. 1, 2, 3, 4, 6, 7, 10, 11, 12, 13. Conidia. 5, 8, 9. Conidia and conidiophores.
Bars=10um

Taxonomic description

Embellisia oxytropis Q. Wang, Nagao & Kakish. sp. nov. Fig.1

Hyphae in PDA effusae pallide brunneae, crassiparietales, septatae, ca. 6~8\um diam.
Chlamydosporae abundae, catenulatae, intercalares vel terminales, 1-cellulares,
crassiparietales, atrobrunnea. Conidiophora simplicia vel ramosa, pallide brunnea,
plerumque geniculata in locis conidiogenis. Conidia longe ellipsoidea vel cylindracea, recta,
transverse (2~)3~4-septata, atrobrunnea, 8~10x50~60um, levia vel minute verruculosa.

258

Holotype: dried culture specimen on PDA, isolated from the leaf of Oxytropis kansuensis
Bunge, Mt. Daming, Qinghai, China, 20 July 2004, Q. Wang, HMJAU 10012, deposited
in the Mycological Herbarium of the Jilin Agricultural University, Changchun, China
(HMJAU).

Other specimens examined: dried culture specimens on PDA, isolated from O.
kansuensis, Mt. Daming, Qinghai, China, July 20, 2004, Q. Wang, HMJAU 10027, 10030,
10032.

Hyphae septate, thick-walled, pale brown, mostly 6~8um in diam. Chlamydospores
abundant as chains, intercalary or terminal, one celled, thick-walled, dark brown. |
Conidiophores simple or branched, pale brown, mostly becoming several geniculate
at conidiogenic loci, secondary sporulation occurring by means of a secondary
conidiophore at apex of primary conidia. Conidia long ellipsoid or cylindroid, sometimes
straight or slightly inequilateral, mostly with (2~)3~4 transverse septa, dark brown, ca.
8~10x50~60um. Conidial surfaces smooth or minutely verruculose.

Results and Discussion

Embellisia oxytropis was frequently isolated from healthy plant samples which were kept
in a refrigerator at 4C° after collection. The fungus usually appeared from the sides of
cross sections 3 days after incubation on PDA. The average ratio of isolation frequency
was 20% from leaves, 70% from stems and 85% from flowers, respectively. Therefore,
it was suspected that the fungus colonized in all organs of Oxytropis kansuensis as an
endophyte because no disease symptom was observed in the plant.

Hyphae of the fungus were also frequently observed in the tissues of leaves, stems and
flowers with LM and SEM (Fig. 2). They were branched, 2~4um in diameter and were
found under the epidermis or between the plant cells. These hyphae showed the similar
characteristics with those observed in cultures on agar media. The hyphae are abundant
in flowers and stems but less frequent in leaves. This observation supports the results of
fungal isolations. Therefore, we suspected that the flowers were more suitable substrate
for the growth of this fungus though it caused no obvious damage to them.

The growth speed on agar media is very slow, about 0.2~0.4mm per day on PDA at 18C°.
When the colonies were transferred at 25C° from 18C°, the horizontal growth stopped
and the colonies became dark green and formed domes. Colonies on PDA, CMA,
V-8 and EDMA showed somewhat different cultural characteristics in color and shape
(Fig. 3). On V-8 and PDA, abundant aerial hyphae were observed around the margin
of colonies and center of the colonies became dome shaped with dark green to black
mycelia. The white flat colonies grew relatively fast on CMA whereas the dark colonies
grew more slowly on EDMA. .

Embellisia oxytropis is characterized by cylindrical conidia with 3~4 transverse septa
and 1-celled abundant chlamydospores. Among 21 described Embellisia species,
E. oxytropis is morphologically similar to E. abundans E.G. Simmons, E. hyacinthi de
Hoog & PJ. Mull. bis, E. allii (Campan.) E.G. Simmons, E. telluster E.G. Simmons,
E. chlamydospora (Hoes et al.) E.G. Simmons in shape and/or size of conidia (Simmons
1983, 1990). However, this species is different from them in number of conidial septa
and/or direction of septa and also distinguished from E. hyacinthi and E. telluster by the
presence of chlamydospores.

ZY,

Fig. 2. Hyphae of Embellisia oxytropis in plant tissues of Oxytropis kansuensis 1. Hyphae observed
in the flower by LM. 2. Hyphae observed in the leaf by LM. 3, 4. Hyphae obsetved in the stem by
SEM. 1, 2, 3: Bars=10um, 4: Bar=4um

Fig. 3. Colony characteristics of Embellisia oxytropis on agar media. 1, 2. On CMA. 3, 4. On V-8. 5,
6. On EDMA. 7, 8. On PDA.

Acknowledgements

Our deep thanks to Dr. K. Okuno and Dr. T. Sato, Genebank of National Institute of Agrobiological
Sciences (NIAS), Japan, and Dr. T. Tsukiboshi, National Institute of Floricultural Sciences (NIFS),
National Agriculture and Bio-oriented Research Organization, NARO, Japan, for their kind
suggestions of our experiments. We are also grateful to Dr. K. Katumoto for his critical reading
of the manuscript and revision of the Latin diagnosis, to Dr. Y. L. Guo, Institute of Microbiology,
Chinese Academy of Sciences, China, for her critical review of the manuscript.

260

Literature Cited

Braun K, Romero J, Liddell C, Creamer R. 2003. Production of swainsonine by fungal endophytes
of locoweed. Mycol. Res. 107: 980-988.

Chang S, Gao Q, Hou D, Chen J, Zhu X. 1981. Poisoning by Oxytropis kansuensis. Acta Veterinaria —
et Zootechnica Sinica. 12: 145-150 (in Chinese).

David JC, Coles K, Fisher J, Moss ST. 2000. A new species of Embellisia from soil with high levels of
heavy metals. Mycoscience 41: 533-537.

de Hoog GS, Muller PJ. 1973. A new species of Embellisia, associated with skin disease of Eyecintae
Nethy Jo PlePath?79::85-93)

Koga H, Christensen MJ, Bennett RT. 1993. Incompatibility of some grass—Acremonium endonhi”
associations. Mycol. Res. 97: 1237-1244.

Muntanola-Cvetkovic M, Ristanovic B. 1976. A new species of Embellisia isolated from sea water.
Mycologia 68: 47-51.

Simmons EG. 1971. Helminthosporium allii as type of a new genus. Mycologia 63: 380-386.

Simmons EG. 1983. An aggregation of Embellisia species. Mycotaxon 17: 216-241.

Simmons EG. 1990. Embellisia and related teleomorphs. Mycotaxon 38: 251-265.

Simmons EG. 2004. Novel dematiaceous hyphomycetes. Studies in Mycology 50: 109-118.

MYCOTAXON

Volume 95, pp. 261-270 January-March 2006

Some hyphomycetes from Brazil. Two new species of
Brachydesmiella, two new combinations for Repetophragma,
and new records

RAFAEL FE, CASTANEDA RUIZ

rfcastaneda@inifat.co.cu
Instituto de Investigaciones Fundamentales en Agricultura Tropical
‘Alejandro de Humboldt”, Calle 1 Esq. 2, Santiago de Las Vegas
C. Habana, Cuba. C.P. 17200.

Luis FERNANDO PASCHOLATI GUSMAO

lgusmao@uefs. br
Universidade Estadual de Feira de Santana- UEFS
Departamento de Ciéncias Biologicas
Caixa Postal 252, 44.031-460, Feira de Santana, BA, Brazil

GABRIELA HEREDIA ABARCA

heredia@ecologia.edu.mx
Instituto de Ecologia, A.P. 63, Km,
2.5 Antigua carretera a Coatepec, Xalapa, Veracruz, México

MASATOSHI SAIKAWA

saikawa@u-gakugei.ac.jp
Department of Biology, Tokyo Gakugei University
Nukuikita-machi, Koganei-shi 184-8501, Tokyo, Japan

Abstract—Brachydesmiella brasiliensis anam. sp. nov., found on decaying pods of
unidentified Leguminosae and Brachydesmiella obclavata anam. sp. nov., collected
on the rotten leaf of an unidentified plant, both from the semi-arid region of Bahia
State, Brazil, are described and illustrated. The former is distinguished by navicular to

_broad fusiform, 3-euseptate, densely verrucose, brown conidia; the latter by obclavate,
rostrate, 1-euseptate, pale brown, smooth-walled conidia. A key to Brachydesmiella
species is provided. Repetophragma fasciatum comb. nov. and Repetophragma filiferum
comb. nov. are proposed. Some other microfungi are reported from the semi-arid
region of Brazil.

Key words—anamorph, leaf litter, rotten pod, systematics

Introduction

Over 35 hyphomycetes were collected during mycological surveys of conidial fungi from
the semi-arid region in Bahia State, Brazil. Among the collections were two conspicuous
fungi clearly related to the genus Brachydesmiella G. Arnaud ex S. Hughes (1961)
that appear to be new to science. Brachydesmiella is characterized by differentiated,
mononematous, brown to pale brown conidiophores and tretic, multilocal, sympodial,
indeterminate, terminal and intercalary conidiogenous cells. The conidial secession is —
schizolytic. Six species of Brachydesmiella have been validly published in the literature,
B. biseptata G. Arnaud ex S. Hughes, in Hughes (1961) (the type species); B. caudata V.
Rao & de Hoog, in Rao & de Hoog (1986); B. anthostomelloidea Goh & K. D. Hyde, in
Goh & Hyde (1996), B. orientalis (V. Rao & de Hoog) Goh, in Sivichai et al. (1998), B. —
verrucosa Goh et al., in Sivichai et al. (1998) and B. eugecapiellana R.F. Castafieda et al.,
in Castafieda Ruiz et al. (2003).

Materials and Methods

Leaf litter samples were placed in separate paper bags and taken to the laboratory.
Samples were incubated in Petri dish moist chambers at 25 °C in plastic containers (50
L capacity) with 200 ml of sterile water plus 2 ml of glycerol and examined at regular
intervals for the presence of microfungi. Aeration was supplied with a fan (Daytron)
for 5 to 10 minutes at 45 minutes intervals. Mounts were prepared in polyvinyl alcohol-
glycerol (8.0 g in 100 ml of water, plus 5 ml of glycerol) and measurements made at 1000 —
X magnification. The conidial fungi were isolated from single conidia picked out under
a stereomicroscope after four days incubation from the substrate. They were grown on
corn meal agar mixed 1:1 with carrot extract, incubated at 25 °C under alternating cycles
of 12 hours of daylight and darkness.

Taxonomy Description

Brachydesmiella brasiliensis R.F. Castafieda, Gusmao & Heredia anam. sp. nov.
Fig. (1-5)
Ad fungos conidiales, hyphomycetes pertinens. Coloniae in substrato naturali caespitosae,
effusae, brunneae. Conidiophora conspicua, mononematosa, erecta, sinuata vel leviter
geniculatae, 1- ad 6-septata, 20-110 um alta, 6-7 um crassa ad basim, brunnea, levia,
simplicia, non ramosa vel interdum ramosa; rami 12-39 um longi. Cellulae conidiogenae
multilocales, treticae, 10-25 x 5-6 um. Loci conidiogeni pori, 1 um diam, plerumque obcuri
circa poros. Conidia solitaria, navicularia usque ad ample fusiformia, aequilateralia,
leviter constricta ad centro, utrimque obtusa vel rotundata cicatricata ad basim, 3-septata,
perverrucosa, brunnea, 30-36 x 6-7 um; 1.5 um crassa ad basim. Teleomorphosis ignota.

Etymology: Latin, brasiliensis, in reference to Brazil.

Matrix: BRAZIL. BAHIA STATE: Senhor do Bonfim, in capsula putrida leguminosa
non determinata, legit L.EP. Gusmao, 17.VII.2005. Holotypus: HUEFS97984. Isotypus:
INIFAT C05/7.

Conidial fungi, Hyphomycetes. Colonies on the natural substratum caespitose, effuse,
brown. Mycelium superficial and immersed. Hyphae septate, branched, brown, smooth-

| 205

Fig. 1-4. Brachydesmiella brasiliensis. 1. Conidia; 2. Geniculate conidiophore; 3-4. Detail of
conidiogenous cells. (Bars = 10pm)

walled, 2.0-3.5 um diam. Conidiophores differentiated, mononematous, erect, sinuate
to slightly geniculate, somewhat nodose, 1- to 6-septate, 20-110 pm tall, 6-7 jum wide
at the base, brown, smooth, mostly simple, sometimes slightly branched; branches
12-39 ym long. Conidiogenous cells multilocal, tretic, terminal and intercalary,
sympodially proliferating, indeterminate, 10-25 x 5-6 jum, integrated, smooth-walled,
brown. Conidiogenous loci pores 1 um diam, with distinct melanized to blackish areas

264

Pion siecriccrorcooetnonneieonnsonesnentie

Fig. 5. Brachydesmiella brasiliensis. Drawings of conidiophores, conidiogenous cells and conidia.
(Bar = 10pm)

around the pores. Conidial secession schizolytic. Conidia solitary, navicular to broadly
fusiform, equilateral, slightly constricted at the middle, obtuse or rounded at the ends,
cicatrized at the base with a scar 1.5 um wide, 3-septate, coarsely verrucose, brown,
acropleurogenous, dry, 30-36 x 6-7 tm. Teleomorph: unknown.

265

Specimen examined: BRAZIL. BAHIA STATE: Senhor do Bonfim, on decaying pods
of unidentified Leguminosae, L.EP. Gusmao, 17.VII.2005. Holotypus: HUEFS97984.
Isotypus: INIFAT C05/7.

Note: Brachydesmiella brasiliensis resembles B. verrucosa and B. caudata in conidial
ornamentation and number of septa, but B. verrucosa has ampulliform, 56- 92 x 12-17
uum, unequally pigmented conidia with pale olivaceous brown central cell that is darker
than the apical and basal cells. Also, the apical rostrate cell of B. verrucosa is 4-6 um
wide. Brachydesmiella caudata is characterized by smooth, ellipsoidal to truncate-
limoniform, 52.5-72.0 x 13-33 um conidia with dark reddish brown central cells.

Brachydesmiella obclavata R.F. Castafieda, Gusmao & Saikawa anam. sp. nov.
Figs. (6-10)

Ad fungos conidiales, hyphomycetes pertinens. Coloniae in substrato naturali pilosae usque
ad caepitosa, effusae, hypophyllae, brunneae vel luteo-brunneae. Conidiophora conspicua,
mononematosa, erecta, sinuata vel geniculata, plerumque nodosa vel inflata ad apicem,
2- ad 5-septata, 40-75 um alta, 4-5 um crassa ad basim, brunnea vel dilute brunnea,
levia, plerumque simplicia, raro ramosa,; rami 10-22 um longi. Cellulae conidiogenae
multilocales, treticae, 11-20 x 3.0-3.5 um. Loci conidiogeni pori, 0.5-1 um diam,
plerumque obcuri circumvallati circa pori. Conidia solitaria, obclavata, obscura cicatricata
ad basim, 1-septata, raro 2- septata, levia, dilute, brunnea, 18-23 (-26) x 3 um; 1.5-2 um
crassa ad basim. Teleomorphosis ignota.
Etymology: Latin, obclavata, refers to the clavate conidial shape.
Matrix: BRAZIL. BAHIA STATE: Senhor do Bonfim, in foliis dejectis putridis non
determinatae, legit L.E P Gusmao, 17.VII.2005. Holotypus: HUEFS97983. Isotypus:
INIFAT C05/14.

Conidial fungi, hyphomycetes. Colonies on the natural substratum pilose to caespitose,
effuse, hypophyllous, brown to yellow-brown. Mycelium mostly immersed. Hyphae
septate, branched, brown to pale brown, smooth-walled, 1.5-2 um diam. Conidiophores
differentiated, mononematous, erect, sinuate to slightly geniculate, mostly nodose or
inflated towards the apex, 2— to 5—septate, 40-75 um tall, 4-5 sm wide at the base, brown
or pale brown, smooth, mostly simple, sometimes slightly branched; branches 10-22
um long. Conidiogenous cells multilocal, tretic, terminal and intercalary, sympodially
proliferating, indeterminate, 11-20 x 3.0-3.5 tm, integrated, smooth-walled, brown.
Conidiogenous loci pores 0.5-1.0 um diam, mostly melanized near the pore. Conidial
secession schizolytic. Conidia solitary, obclavate, cicatrized at the base with a scar 1,5
um wide, 1-septate, rarely 2-septate, smooth-walled, pale brown, acropleurogenous,
dry, 18-23 (-26) x 3 um; 1.5-2 um at the base. Teleomorph: unknown.

Specimen examined: BRAZIL. BAHIA STATE: Senhor do Bonfim, on dead leaves

- of unidentified plant, L.EP. Gusmao, 17.VII.2005. Holotypus: HUEFS97983. Isotypus:
INIFAT C05/14.

Note: Brachydesmiella obclavata is somewhat similar to B. eugecapiellana in conidial
pigmentation, but B. eugecapiellana has navicular to narrow fusiform, rostrate, 2-3-
septate, 32-40 x 4.0-6.5 um, verruculose conidia.

266

Fig. 6-9. Brachydesmiella obclavata. 6. Conidia; 7. Conidiophores; 8. Detail of the conidiogenous
cells; 9. Detail of young conidium (Bars = 10um)

| 267

Fig. 10. Brachydesmiella obclavata. Drawings of conidiophores, conidiogenous cells and conidia.
(Bar = 10um)

268

Key to Brachydesmiella species

L Conidia -[—Septates Cee. 22:5 ct mee. tek t ne, cene aa oe eer ee eee 2

la. Conidia usually, withimore thanyhseptuin samen tye). yee. oer ee eee 3

2. Conidia obclavate, pale brown, 18-23 (-26) x 3 um; 1.5-2 um at the base..........
sia Tan o,f ta ah ee ie RS Mer Rete Orso, Ee, ae en oye ye] B. obclavata

2a. Conidia limoniform to ampulliform, apical cell cylindrical, pale brown to subhyaline
and apical cell darkly olivaceous brown, 35-47 x 14-18 um...............005.

2b. Conidia pyriform, basal cell broad trapezoid, subhyaline and apical cell blackish

Drown, 30.0-3715) Alb). 5 (i) ees ant nea ee ge ey a B. orientalis
3. Conidia 2; septatersam tne tee ree ee en tn ee, ee ee 4
3a. Conidia sometimes or always with more than 2 septa .......................- 5

4. Conidia limoniform, 37.5-51.0 x 17.5-20.0 um, unequally pigmented, the apical cell
subhyaline, more or less conical, the central cell basal black and obtuse, the basal
cell trapezoid tcubhyalinct< tea. a see ci 0 eee ghee oe B. biseptata

4a. Conidia limoniform-caudate, 52.5-72.5 x 13-33 um, unequally pigmented, the
apical cell subhyaline, cylindrical, the central cell dark reddish brown, elliptical
and subhyaline, the basal cell obconical-truncate .................. B. caudata

4b. Conidia ampulliform-caudate, 56-92 x 12-17 um, unequally pigmented, the apical
cell cylindrical subhyaline, the central ellipsoid pale olivaceous brown and hyaline
to subhyaline, the basal cell obconical-truncate ................. B. verrucosa

5. Conidia 2— to 3-septate, navicular to narrow fusiform, rostrate, 32-40 x 4.0-6.5 um,
pale.Drown7@. few C. ., Cn Bee ec nae er B. eugecapiellana

5a. Conidia 3-septate, navicular to broadly fusiform, equilateral, slightly constricted at
the middle, obtuse or rounded at the ends, 30-36 x 6-7 um, brown............
eRe A EE I eee es eR RSG A CRI B. brasiliensis

Other microfungi recorded from semi-arid regions in Brazil

Acumispora phragmospora Matsush., Matsushima Mycological Memoirs 1: 3. 1980.

Specimen examined: BRAZIL. BAHIA STATE: Senhor do Bonfim, on rotten stem of
Bambusa sp., L.EP. Gusmao, 15.VII.2005 (HUEFS42877; INIFAT C05/10-1).

Diplodspora zinniae Matsush., Matsushima Mycological Memoirs 2: 8. 1981.

Specimen examined: BRAZIL. BAHIA STATE: Senhor do Bonfim, on rotten stem of
Bambusa sp., L.EP. Gusmao, 15.VII.2005 (HUEFS42884; INIFAT C05/13)

Phialosporostilbe setosa Bhat & W.B. Kendr., Mycotaxon 49: 57. 1993.

Specimen examined: BRAZIL. BAHIA STATE: Senhor do Bonfim, on rotten stem of
Bambusa sp., L.EP. Gusmao, 15.VII.2005 (HUEFS56578; INIFAT C05/9).

269

Physalidiella matsushimae (R.F. Castafieda & W.B. Kendr.) M. Morelet, Annales de la
Société des Sciences Naturelles et d’Archéologie de Toulon et du Var 47: 91. 1995.

Specimen examined: BRAZIL. BAHIA STATE: Senhor do Bonfim, on rotten pod of
unidentified Leguminosae, L.E.P. GusmAo, 15.VII.2005 (HUEFS56579; INIFAT C05/6).

Repetophragma fasciatum (R.F.Castafieda) R.F. Castafieda, Gusmao & Saikawa
comb. nov.

Basionym: Chaetendophragmia fasciata R. F. Castafeda, in Deuteromycotina de Cuba.
Hyphomycetes III. Instituto de Investigaciones Fundamentales Agricultura Tropical,
“Alejandro de Humboldt’, Cuba p.5. 1985.

=Endophragmiella fasciata (R. F. Castafieda) R. F. Castafieda, in Fungi Cubenses III (La
Habana, Cuba): 20. 1988.

Specimen examined: BRAZIL. BAHIA STATE: Palmeiras, Capao valley, on decaying
leaves of Cupania paniculata Cambess. (Sapindaceae), L.EP. Gusmao, 24.VI. 2000,
(HUEFS56675).

Repetophragma filiferum (Piroz.) R. E Castafieda, Gusmao & Heredia comb. nov.
Basionym: Sporidesmium filiferum Piroz., in Mycol. Pap. 129: 55. 1972.
Specimen examined: BRAZIL. BAHIA STATE: Palmeiras, Capao valley, on decaying
leaves of Cupania paniculata Cambess. (Sapindaceae), L.F.P. Gusmao, 24.V1.2000,
(HUEFS42798); BRAZIL. BAHIA STATE: Senhor do Bonfim, on rotten leaf of
unidentified plant, L.EP. Gusmao, 15.VII.2005, (INIFAT C05/2,).

Note: After re-examination of several samples of both fungi, the schizolytic conidial
secession after the production of euseptate conidia by several enteroblastic percurrent
proliferations was confirmed; these characters were described for Repetophragma
Subram. (1992); those fungi were recently recorded in Brazil by Grandi & Silva (2005).

Stylaspergillus laxus B. Sutton, Alcorn & P.J. Fisher, Trans. Br. Mycol. Soc. 79: 340. 1982.

Specimen examined: BRAZIL. BAHIA STATE: Senhor do Bonfim, on rotten pod
of unidentified Leguminosae, L.EP. Gusmao, 15.VII.2005, (HUEFS56583; INIFAT
C05/6-4).

Acknowledgements

We are grateful to Dr. L. M. Carris (Washington State University), Dr. D. W. Minter (International
Mycological Institute) for kindly reviewing the manuscript. We are grateful to the Cuban Ministry
of Agriculture for providing facilities during this study. We (RFCR, LFPG and GH) are indebted
to the CYTED for support this during this study. The second author extends the grateful to the
“PPBIO - semi-arid” and the Brazilian Ministry of Technology & Science (MCT).

Literature Cited

Castafieda Ruiz RE, Kendrick B. 1990. Conidial Fungi from Cuba II. University of Waterloo Biology
Seticso 3: 1-61,

Castafieda Ruiz RF, Iturriaga T, Minter DW, Saikawa M, Vidal G, Velazquez-Noa S. 2003.
Microfungi from Venezuela. A new species of Brachydesmiella, a new combination, and new
records. Mycotaxon 85: 211-229.

270

Ellis MB. 1971. Dematiaceous Hyphomycetes. Commonwealth Mycological. Institute, Kew.

Goh TK, Hyde KD 1996. Brachydesmiella anthostomelloidea, a new species of dematiaceous
Hyphomycete from Australia. Mycological Research 100: 1364-1366.

Grandi RAP, Silva TV. 2005. Fungos anamorfos descompositores do folhedo de Celsalpinia echinata
Lam. In Anais, V Congreso Latinoamericano de Micologia, p. 272, Brasilia, Brazil,

Hughes SJ. 1961. Microfungi. VU. Brachydesmiella Arnaud. Canadian Journal of Botany 39:
1095-1097.

Rao V, de Hoog GS. 1986. New or critical hyphomycetes from India. Studies in Mycology. 28:
1-84.

Sivichai S, Goh TK, Hyde KD, Hywel-Jones NL. 1998. The genus Brachydesmiella from submerged ©
wood in the tropics, including a new species and new combination. Mycoscience 39: 239-247. .

Subramanian CV. (1992). A reassessment of Sporidesmium (Hyphomycetes) and some related taxa.
Proceedings of the Indian National Science Academy B58: 179-190.

Volume 95, pp. 271-275 January-March 2006

Russula in Himalaya 3:
A new species of subgenus /ngratula

KANAD Das", J.R. SHARMA? & N.S. ATR?

*daskanad@yahoo.co.in
‘Mycology and Plant Pathology Group, Agharkar Research Institute
G.G. Agarkar Road, Pune 411004, India

Botanical Survey of India, 192, Kaulagarh Road
Dehradun 248195, India

’Botany Department, Punjabi University
Patiala 147002, India

Abstract—Russula natarajanii, a new species of subgenus Ingratula from Kumaon
Himalaya characterized by a whitish pileus, is described and illustrated in detail.

Key words—macrofungi, Russulaceae, taxonomy, India

Introduction

Although generally considered one of the largest ectomycorrhizal genera, Russula is
represented by only approximately 100 taxa on the Indian subcontinent. Of those, only
twenty—Russula delica Fr., R. densifolia Secr. ex Gillet, R. foetens Pers., R. gracillima Jul.
Schaff., R. heterophylla (Fr.) Fr., R. minutula var. robusta Saini et al., R. nitida (Pers.) Fr.,
R. versicolor Jul. Schaff., R. flavida Frost, R. compacta Frost, R. rhodomelanea Sarnari,
R. raoultii Quél., R. anatina Romagn., R. praetervisa Sarnari, R. decolorans (Fr.) Fr.,
R. mukteshwarica K. Das et al., R. mayawatiana K. Das et al., R. puellaris var. atrii K.
Das et al., R. dhakuriana K. Das et al. and R. appendiculata K. Das et al.—have been
described in detail from Kumaon Himalaya (Saini et al. 1982, Atri & Saini 1986, Atri et
al. 1994, Rawla 2001, Das & Sharma 2001, Das et al. 2002, Das & Sharma 2003, Das &
Sharma 2004, Das et al. 2006a, b). Earlier explorations (Atri et al. 1994, Rawla 2001) have
been restricted to the other Himalayan regions of Himachal, Kashmir, and Garhwal.
Our recent intensive surveys of the different altitudinal zones within Kumaon Himalaya
resulted in collections of some additional taxa not previously cited. Comparison with ©
the literature of previously described taxa revealed an undescribed new species, which
we formally describe here as Russula natarajanii.

Materials and Methods

The present communication is based on specimens collected periodically during
recent years from the Pithoragarh and Bageshwar districts of Kumaon Himalaya.

Zs 2

Macromorphological characters were noted from fresh specimens. Colour
changes resulting from the addition of FeSO, on fresh material were also noted.
Micromorphological examinations were made of free-hand sections of dried material
mounted in 5% KOH, Melzer’s reagent, Congo red, Lactophenol-cotton blue, and Carbol
Fuchsin. Colour terms follow Kelly & Judd (1955). Microscopic line drawings were made
with the aid of a camera lucida at original magnification of 1500x for basidiospores
and 1000x for other microstructures. Density of lamellae (L/cm) was measured at the
margin of the pileus. Basidiospore measurements exclude the height of ornamentation.
Basidium length excludes the length of sterigmata. Quotient (Q = L/W) was calculated
considering the mean value of length and width of 25 basidiospores. Herbarium names
follow Holmgren et al. (1990).

Description of the species

Russula natarajanii K. Das, J.R. Sharma & Atri sp. nov. Fig. 1

Etymology: To honour K. Natarajan for his contributions to Indian mycota.

Pileus 60-105 mm latus., planoconvexus, ad umbelicatus, sulcatus, albidus. Lamellae
adnexae,,satis distantes, albocremeae. Stipes 40-70 x 16-22 mm, cylindricus, ad
subclavatus, albidus. Sporae in cumulo luteoalbae, 6.5-8 x 5.8-7.1 um, subglobosae ad
late ellipticae, amyloideae, subreticulatae. Pleurocystidia 60-90 x 6-10.5 um, fusiformia.
Cheilocystidia nulla. Pileocystidia ad 6 um lata.

Holotypus: INDIA, Uttaranchal, Pithoragarh, Dafia Dhura, October 4, 2001, leg. K. Das
e J.R. Sharma, KD4097 (HOLOTYPUS, BSD).

Pileus 60-105 mm diam., convex, planoconvex, planoconcave to umbilicate at maturity;
pileipellis dry, viscid when moist, white to yellowish white with yellowish gray in the
center, sometimes light to medium brown spots at the periphery, unchanging; margin
tuberculate-sulcate, decurved, gradually plane at maturity. Lamellae adnexed, subdistant
to close (ca 6-7 per cm), forked near stipe, brittle, yellowish white to cream; lamellulae
absent; edges even. Stipe 40-70 x 16-22 mm, dry, central, cylindric to subclavate,
concolorous with pileus; context solid to stuffed, white to yellowish white, unchanging.
Taste mild. Odor not distinctive. Macrochemical (stipe): FeSO, positive (salmon).
Spore print yellowish white.

Basidiospores 6.5-8.8 x 5.8-7.1 um, subglobose to broadly ellipsoid, Q = 1.08-1.25
(1.34); ornamentation amyloid, up to 0.4 um high, composed mostly of minute warts
and ridges and forming incomplete reticulum. Basidia 28-35 x 7.5-9 um, subclavate
to clavate, 4-spored; sterigmata up to 6 um long. Pleurocystidia 60-90 x 6-10.5 um,
emergent up to 30 um, fusiform with mucronate to capitate apex, content dense.
Lamellae edge fertile. Cheilocystidia not found. Subhymenium layer up to 27 um thick,
cellular. Pileipellis composed of suberect hyphae and pileocystidia; pileocystidia up to
5 um broad. Stipitipellis composed of parallel hyphae (up to 3 um broad). Stipe trama
composed of numerous sphaerocytes.

Ecology—Russula natarajanii grows in close association with Quercus species in moist,
temperate (2300-2700 m), deciduous/mixed forests in the Kumaon Himalaya.

273

laed:

Basidiospores c. Bas

iomes b.

a. Basid

(from Holotype)

janit

Russula natar

Fig.

;b-e = 10 um.

=10mm

Bars

Pleurocystidia e. Pileipellis.

274

OTHER SPECIMENS EXAMINED—INDIA, Utaaranchal BAGEsHwWAR, Dhakuri, September 2003,
leg. K. Das & J.R. Sharma, KD7008 (GUH); ibid., KD7070 (BSD).

Comments—Russula natarajanii is distinguished in the field by having the unique ©
combination of a whitish pileus color that is unchanging with bruising or age, a ©

tuberculate pileus margin, and minutely warted basidiospores with ridges. The viscid
pileipellis, sulcate pileus margin, adnexed lamellae, low ornamented basidiospores and
the presence of pileocystidia support placing R. natarajanii in the subgenus Ingratula as
emended by Sarnari (1998).

In the field, R. natarajanii appears quite close to R. brevipes Peck var. brevipes and |

R. delica. However, typically shorter stipes, numerous lamellulae, absence of tuberculate-
sulcate pileus margin (cf. Shaffer 1964, Sarnari 1998), acrid taste, and higher spore
ornamentation separate both R. brevipes var. brevipes and R. delica from the newly
named species. Moreover, the typically decurrent lamellar attachment also helps to
separate R. brevipes var. brevipes from R. natarajanii.

Acknowledgements

We wish to express our gratitude to (Director) Dr. M. Sanjappa and (Joint Director) Dr. D.K. Singh
of the Botanical Survey of India, Kolkata and Dr. V.S. Rao, Director, Agharkar Research Institute,
Pune for providing facilities. We also thank Jukka Vauras (Abo Akademi University, Turku,
Finland) and Dr. Lorelei L. Norvell (PNW Mycology Service, Portland OR, USA) for critically
reviewing the manuscript.

Literature Cited

Atri NS, Saini SS. 1986. Further contribution on the studies of North West Himalayan Russulaceae.
Geobios New Reports 5: 100-105.
Atri NS, Saini MK, Saini SS. 1994. Indian Russulaceae Roze - a check list, in T.A. Sharma, S.S. Saini,
M.L. Trivedi & M. Sharma (eds.). 81 — 93. Current Researches in Plant Sciences, Dehradun.
Das K, Sharma JR. 2001. Russula rhodomelanea Sarnari — a new record for India. Mushroom
Research 10 (2): 109-111. ;
Das K, Sharma JR. 2003. New records of Russula from Kumaon Himalaya. Indian Journal of
Forestry 26 (3): 320-326.

Das K, Sharma JR. 2004. Russula compacta Frost & Peck — A new record from India. J. Mycol. Pl.
Pathol., 34 (1): 149-150.

Das K, Sharma JR, Bhatt RP. 2002. Russula flavida Frost - an addition to the Indian ectomycorrhizic
fungi. Mushroom Research 11 (1): 9-10.

Das K, Miller SL, Sharma JR. 2006b. Russula in Kumaon Himalaya 2: Four new taxa. Mycotaxon
95:.205=215.

Das K, Miller SL, Sharma JR, Sharma P, Bhatt RP. (2005) 2006a. Russula in Kumaon Himalaya 1:
A new species of subgenus Amoenula. Mycotaxon 94: 85-88.

Holmgren PK, Holmgren NH, Barnett LC. 1990. Index Herbariorum. Part 1: Herbaria of the
world, 86" ed. Brox: New York Botanical Garden.

275

Rawla GS. 2001. Himalayan species of Russula Pers. Ex S.F. Gray, in P.C. Pande & S.S. Samant (eds.).
1-48. Plant Diversity of the Himalaya. India.

Saini SS, Atri NS, Singer R. 1982. North Indian Agaricales — II. Sydowia, Annales Mycologici,
Ser. IT 35: 238-241.

Sarnari M. 1998. Monografia illustrata del genere Russula in Europa. Tomo Primo. Italia. 799 pp.

Shaffer RL. 1962. The subsection Compactae of Russula. Brittonia 14: 254-284.

“Wy

MYCOTAXON
Volume 95, pp. 277-280 January-March 2006

Wallemia—a genus newly recorded from China

GUANGYU SUN’, MIAO ZHANG', RONG ZHANG’, HUINING MA?
& MARK L. GLEASON?

sgy@nwsuaf.edu.cn
‘College of Plant Protection, Northwest A & F University
Yangling, Shaanxi, 712100, China

*Department of Plant Pathology, Iowa State University
Ames, Iowa 50011, U.S.A

Abstract— Wallemia sebi (Basidiomycota) is reported from China for the first time. The
fungus was found on the epicuticular wax of apple fruit sampled from an orchard in
Shaanxi Province, China. Its conidiophores are unbranched or sympodial, erect, and
phialidic; conidiogenous cells at the apex of conidiophores constrict and disarticulate
distally into four arthrospore-like conidia; conidia are one-celled, initially short
cylindrical, and finally spherical; the fungus can grow on potato dextrose agar (PDA)
and malt extract agar (MEA) media without additional solutes. A description based on
the Chinese material and illustrations are provided.

Key words—Wallemiomycetes, taxonomy, sooty blotch

introduction

Wallemia sebi (Fr.) Arx is a cosmopolitan xerophilic and osmophilic fungus that has
been reported from several continents, usually on sweet food (jams, fruits, sugar, cakes),
salted food (salted meats, fish, peanuts), dried materials (causing spoilage on dried hay,
bread, and dried fruits) (Samson et al. 2002), and seeds (sunflower, rye, wheat), as well
as in indoor environments (Takahashi 1997). Terracina (1974) found that the septum
of W. sebi was similar to those formed by many basidiomycetes and some ascomycetes.
Moore (1986, 1996) further ascertained that the hyphae of W. sebi contained dolipore
septa. Nevertheless W. sebi was ascribed to ascomycetes in Kirk et al. (2001). However,
Zalar et al. (2005) proposed a new basidiomycetous class, Wallemiomycetes, based on
unique dolipore morphology, xerotolerance, and sequence data of ITS rDNA (the rDNA
internal transcribed spacer regions), and included three species (Wallemia sebi, W.
ichthyophaga and W. muriae) in the now-basidiomycete genus Wallemia. In this paper
we provide the first description of morphological and colonial characteristics of W. sebi
collected in China.

Materials and Methods

Apple fruits were collected from Qianyang County in Shaanxi Province. To obtain a
pure culture thalli were sampled directly from the apple fruit surface (Sun et al. 2003).

278

The isolate was cultured on potato dextrose agar (PDA) at 24° in darkness.

The characteristics of the isolate were described and photographed growing on dishes
of PDA and malt extract agar (MEA); fungal structures were mounted in lactophenol for
microscopic examination. The colony diameter of the isolate was determined on three
media (YGA, YGA2, and M40Y) 15 days after inoculation at 24°.

Media: PDA (200 g potato; 20 g dextrose; 15 g agar; 1000 ml distilled water); MEA.

(20 g Bacto™ malt extract; 15 g agar; 1000 ml distilled water); YGA (10 g yeast extract,
50 g glucose, 4 g K,HPO,, 15 g agar, and 1000 ml distilled water); YGA2 (YGA amended

with 100 g glucose); M40Y (powdered malt extract 20 g, yeast extract 5 g, sucrose 400 g, |

agar 15 g, and 1000 ml distilled water).

Taxonomic Description

Wallemia sebi (Fr.) Arx, Gen. Fungi Sporul. Cult.: 166. 1970.
= Sporendonema sebi Fr., Syst. Mycol. 3: 435. 1832.

On surface of apple fruit mycelia are dark brown, forming sooty blotch colonies with
thick tree-like branched margins. Colonies on plate usually slow growing, variable in
shape. On M40Y, forming mounded cones, walnut or gray brown in color, fragments
easily dislodged from colonies and forming satellite colonies on the dish, darker color at
the colony margins, sometimes secreting light to dark yellowish mucous drops golden to
black in color, 16 mm colony diameter after 15 days. Colonies on YGA clumped, walnut
or gray brown, compact, slightly mounded in center, spreading deeply into medium,
surface usually dry but sometimes secreting tiny, light-colored drops that are initially
golden and slowly become brown or black, sometimes white aerial mycelia, 10 mm
diameter after 15 days. On YGA2, 13 mm diameter after 15 days, colonies similar to
those on YGA, but including easily dislodged fragments leading to scattered satellite
colonies.

On PDA, colonies ridged, 6 mm in diameter after 15 days, hyphae hyaline, smooth,
thin-walled, septate, mycelia loosely arranged, branched, and 1.5-3.0 um wide.
Conidiophores erect, short, subhyaline, compactly arranged, unbranched, phialidic,
smooth-walled, densely arranged. Conidiogenous cells at the apex of conidiophores,
cylindrical, not smooth-walled, basauxically extending, constricting basipetally and
disarticulating into four arthrospore-like conidia. Conidia one-celled, initially short
cylindrical, slightly brown or nearly hyaline, soon becoming spherical, not smooth,
thick-walled, brown or pale brown, 1.5-3.0 (-4.0) um diameter. Conidia forming long or
short, straight or bending chains. On MEA, colonies are similar to those on PDA.

HABITAT: In salty environments, on seeds (sunflower, wheat, rye, and soybean),
soil, air, sugary foods, hay, fruits, textiles, man, animal and the surface of apple fruit.

Discussion

Three species, Wallemia sebi, W. ichthyophaga, and W. muriae, were accepted by Zalar
et al. (2005) in the genus Wallemia. They can be distinguished by morphology (conidial
size, having or not having sarcina-like structures) and especially growth on media. Both
W. ichthyophaga and W. muriae grow on MEA only when amended with additional
solutes. In our experiment, the isolate from the apple fruit surface grew well on media

mAs

279

Fig. 1 Wallemia sebi

A: Hyphae, conidiophores and chains of conidia; B: Spherical conidia and initially cylindrical
conidial chains, and sympodially elongating conidiophores; C: Conidial chains arising from
a conidium; D: Conidia in chains; Bars = 10 pm. E: Colonies on M40Y; F: Colony on YGA;

G: Colonies on YGA2, satellite colonies scattering in the plate; H: Colony on the surface of apple
peel; I: Mycelia of the colony on the apple surface under stereo microscope; J: Colony on PDA.

280

such as MEA and PDA, its conidial size was similar to that of W. sebi, and sarcina-
like structures (typical of W. ichthyophaga) were absent. Based on these characters we
identified the isolate as W. sebi.

Wallemia sebi has been reported commonly as growing on food and from the indoor
environments. This is the first report of its occurrence as a saprophyte on living plants.

Acknowledgements

This work was supported by International Science Foundation (D/S3538-1). The authors wish to
thank Dr. Turner Sutton (Department of Plant Pathology, North Carolina State University, Raleigh,
NC 29695) and Dr. Pedro Crous (Centraalbureau voor Schimmelcultures, Fungal Biodiversity
Centre, PO Box 85167, 3508 AD Utrecht, The Netherlands) for reviewing the manuscript.

Literature Cited

Kirk PM, Cannon PF, David JC, Stalpers JA. (eds). 2001. Dictionary of the fungi, 9th ed. Wallingford,
CAB International.

Moore RT. 1986. A note on Wallemia sebi. Antonie van Leeuwenhoek 52: 183-187.

Moore RT. 1996. The dolipore/parenthesome septum in modern taxonomy. 13-35. In: B Sney et
al. (eds.), Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease
Control. Dordrecht, Kluwer Acad. Publ.

Samson RA, Hoekstra ES, Frisvad JC, Filtenborg O. 2002. Introduction to Food and Airborne
Fungi, 6th ed. Centraalbureau voor Schimmelcultures, Utrecht, the Netherlands.

Sun GY, Zhang R, Zhang Z, Zhang M. 2003. Isolation of sooty blotch and flyspeck fungi from apple
surface by picking up the thalli. Acta Phytopath. Sin. 33 (5): 479-480 [in Chinese].

Takahashi T. 1997. Airborne fungal colony-forming units in outdoor and indoor environments in
Yokohama, Japan. Mycopathologia 139 (1): 23-33.

Terracina FC. 1974. Fine structure of the septum in Wallemia sebi. Can. J. Bot. 52: 2587-2590.

Zalar P, de Hoog GS, Schroers HJ, Frank JM, Gunde-Cimerman N. 2005. Taxonomy and phylogeny
of the xerophilic genus Wallemia (Wallemiomycetes and Wallemiales, cl. et ord. nov.). Antonie
van Leeuwenhoek 87 (4): 311-128.

MY COTA XON

Volume 95, pp. 281-284 January-March 2006

Phialophora sessilis, a lithobiont fungus

GIUSEPPE CARETTA’, SOLVEIG Tosi*!, EDUARDO PIONTELLI’
& G.S. DE HooG 3

solveig.tosi@unipv. it
‘Sezione di Micologia, Dipartimento di Ecologia del Territorio e degli Ambienti Terrestri
Universita di Pavia
via S. Epifanio 14, 27100 Pavia, Italy

?Catedra de Micologia, Facultad de Medicina, Universitad de Valparaiso
Casilla 92, Valparaiso, Chile

3Centraalbureau voor Schimmelcultures
PO. Box 85167, NL-3508 AD Utrecht, The Netherlands

Abstract—Phialophora sessilis was repeatedly isolated from marble powder in a
cemetery site in Pavia (Italy). Morphological characteristics of this strain are reported.
Its probable role as a lithobiont with a high adaptability to different organic sources is
discussed.

Key words—rock-inhabiting fungi, adelophialide

Introduction

During a survey on rock-inhabiting fungi from marble powder in the cemetery site
of Sommo, a suburb of Pavia (Italy), numerous fungal taxa were isolated. Among the
species recognized by molecular identification was Phialophora sessilis de Hoog (de
Hoog et al. 1999). In this paper the first record of this species in the Mediterranean is
reported and the isolation of the fungus from nutrient-poor substrates such as marble
powder is discussed.

Phialophora sessilis was firstly reported by de Hoog et al. (1999) from Picea abies resin
in Baarn (Netherlands) and described in a comparative study of 34 strains belonging
to the Phialophora verrucosa complex. Additional strains of P sessilis originated from
forest soil in Sweden, from the lichen Peltigera polydactyla and from a biological filter for
styrene-containing fumes (de Hoog et al. 1999; for further data refer to www.cbs.knaw.
nl/databases/). Important phenetic characteristics of P. sessilis are the dark, slow-growing
colonies, conspicuous collarettes which are darker than the rest of the phialide and are
laterally inserted on undifferentiated hyphae, and conidia inflating to germinating
cells prior to germination and then frequently bearing phialidic collarettes. A key to
Phialophora species occurring as opportunists on humans and bearing morphological
similarity to P. sessilis was provided by de Hoog et al. (2000).

282

Phialophora sessilis, despite its apparent phylogenetic position in the Ascomycetes
order Chaetothyriales containing numerous opportunists on humans (de Hoog et al.
1999), has never been found causing infections in warm- or cold-blooded animals, and
it seems to lack any ecological preference. Wrona & Grabowski (2004 a, b) considered
P. sessilis to be one of the causal agents of apple sooty blotch disease, growing their
strain only on the apple skin, utilizing fructose and glucose as primary source of carbon
(Wrona & Grabowski 2004 a). However, the possibility is not excluded that a well-

known Phialophora-like apple-colonizer, Cadophora malorum (Kidd & Beaumont) W. |

Gams (McColloch 1944; Gams 2000) was concerned. We were unable to verify this, as
no voucher strain was sent upon request.

The present finding of consistent growth on marble may shed some light on the
ecology of P. sessilis.

Material and Methods

Powder of marble, originating from an indoor cemetery marble stone near Pavia (Italy),
was collected in a sterile plastic box in November 2003. The powder was spread on Petri
dishes containing potato dextrose agar (PDA Sigma-Aldrich, Steinheim, Germany),
dichloran rose bengal agar (DRBA, Sigma-Aldrich), oat meal agar (OA, Sigma-Aldrich)
and potato carrot agar (PCA).

Media were prepared separately with and without cycloheximide, tested at a
concentration of 0.1% (w/v). Numerous fungal taxa were isolated and among these
P. sessilis was, consistenly appearing on all plates and media. Cultural characteristics and
morphology were studied on malt extract agar 2% (MEA 2%, ME of Sigma-Aldrich),
DRBA, OA, PCA, water agar (WA, bacteriological agar of Sigma-Aldrich) in which
cycloheximide, sterile marble powder and sterile CaCO, were added separately and
compared with controls. The plates (in triplicate) were incubated at 20°, 25°, 30°C and
observed after 30 days. Tolerance of 5%, 10% NaCl (w/v) was detected in 5% glucose
liquid medium at 20°C, following method of Kurtzman & Fell (1998). Radial growth
of colonies was measured after 30 days on PDA at 8°, 15°, 20°, 25°C. Morphological
observations were made on PDA after 7 weeks of incubation by means of Zeiss
microscope (Axioskop2 Plus) connected with a Ks-100 imaging System Release 3:0.
Each mean value reported in this paper was calculated from a set of 50 measures.

Results and discussion

Molecular ID using the rDNA Internal Transcribed Spacer (ITS) region resulted in
100% sequence identity with the ex-type strain of Phialophora sessilis, CBS 243.85.
The morphological characteristics of our specimens of P. sessilis isolated from marble
powder agree with those described by de Hoog et al. (1999) and can be summarized as
follows (Figs 1-10): colonies olivaceous black, attaining up to 20 mm in diam in 30 days
on PDA at 20°C and 7 mm in diam at 8°C, granular, cerebriform. Optimum of growth
temperature: 20°C. No growth at 30°C. Hyphae torulose near the germinating cell, evenly
wide higher up the filament, smooth-walled, 2.25-3.68 um; sometimes inflated hyphal
cells 4.0-9.7 um wide; most phialides intercalary, with conspicuous, dark collarettes
inserted laterally on the supporting cells (adelophialides), 1.4-2.3 x 1.6-2.2 um. Non-
sessile phialides rare, 3.6-9.4 x 2.0-2.8 um with similar collarettes. Conidia subhaline,

). Figs 3-4. Conidia in slimy balls and some conidiogenous cells

Figs 1-2. Sessile collarettes (arrow
(arrow). Fig. 5. inflated hyphal cells. Fig. 6. Phialides bearing conidia (arrow). Figs 7-8. Conidia

ow). Fig. 9. Small conidia. Fig. 10. Aspect of mature mycelium.
Bar in all figures 10 pm.

with open collarettes (arr

284

smooth, biguttulate, obovoidal to ellipsoidal, of two types: (1) 2.3-4.1 x 1.5-2.2 um, and
(2) 4.7-7.0 x 2.4-3.5 um. Conidia in slimy heads 6.2-8.8 x 7.1-8.2 um. Chlamydospores
absent.

Little variation was observed in P. sessilis growing on the different cultural media
used. PDA was the most suitable substrate for growth. Differences in tolerance of NaCl
and in the growth temperature were recorded. The strain isolated from marble can grow
well with 5% NaCl and weakly with 10% NaCl. It grows at relatively low sae arin
reaching 7 mm in diam at 8°C in one month and does not grow at 30°C.

Interest in P sessilis is driven particularly by the apparent capacity of this fungal
species to colonize and survive in lithic material such as marble, by the variety of sources
of isolation not easy degradable (resin, styrene, lichen) and by the low competitive ability
with mesotrophic microorganisms. Colonization of marble, where it probably lives on
degraded bacteria or components of air pollution (Sterflinger & Prillinger 2002) then
would fit such ecology. Prenafeta-Boldu et al. (2006) suggested that the assimilation
of toxic hydrocarbons might be an essential factor in the ecology of black yeast-like
members of the Chaetothyriales. The detection and identification of this possible
lithobiont is important for the future studies on the deteriogenic processes of stone
monuments where chemioorganotrophic bacteria, fungi, and phototrophic organisms,
are present in microbial consortium. The finding of P. sessilis, consistently isolated at
the sampling site in Pavia (northern Italy), extends southward the distribution area and
habitat of this rare species, isolated to central and northern Europe.

Acknowledgments
We are grateful to Prof. S. Onofri (Dipartimento di Scienze Ambientali, Universita della Tuscia,

Viterbo, Italy) and Prof. C. Urzi (Dipartimento di Scienze Microbiologiche, Genetiche e Molecolari,
Universita di Messina, Italy) for presubmittal review of the manuscript.

References

de Hoog GS, Weenink XO, Gerrits van den Ende AHG. 1999. Taxonomy of the Phialophora
verrucosa complex with the description of two new species. Stud. Mycol. 43: 107-122.

de Hoog GS, Mayser P, Haase G, Horré R, Horrevorts AM. 2000. A new species, Phialophora
europaea, causing superficial infection in humans. Mycoses 43: 409-416.

Gams W. 2000. Phialophora and some similar morphologically little-differentiated anamorphs of
divergent ascomycetes. Stud. Mycol. 45: 187-199.

Kurtzman CP, Fell JW. 1998. The Yeasts: a taxonomic study. Elsevier, Amsterdam, The
Netherlands.

McColloch LP. 1944. A study of the apple rot fungus Phialophora malorum. Mycologia 36:
576-590.

Prenafeta-Boldt FX., Summerbell RC, de Hoog GS. 2006 Fungi growing on aromatic hydrocarbons:
biotechnology’s unexpected encounter with biohazard. FEMS Microbiol. Rev. (in press).

Sterflinger K, Prillinger H. 2001. Molecular taxonomy and biodiversity of rock fungal communities
in an urban environment (Vienna, Austria). Antonie van Leeuwenhoek 80: 275-286.

Wrona B, Grabowski M. 2004 a. Influence of fructose and glucose occurring on fruit surface on the
growth of fungi that cause sooty blotch of apple. J. Plant Protection Res. 44 (4): 287-291.

Wrona B, Grabowski M. 2004 b. Etiology of apple sooty blotch in Poland. J. Plant Protection Res.
44 (4): 294-297.

MYCOTAXON

Volume 95, pp. 285-293 January-March 2006

Revision of Termitomyces species
originally described from China

B.-H. TANG” T.-Z. WEI’ & Y.-J. YAo'*

yaoyj@sun.im.ac.cn
'Key Laboratory of Systematic Mycology and Lichenology
Institute of Microbiology, Chinese Academy of Sciences
Beijing 100080, China

*Graduate School of Chinese Academy of Sciences
Beijing 100080, China

Abstract—Revision of the four Termitomyces species originally described from China
was carried out to clarify their taxonomic status. Among them, T’ bulborhizus was
reported recently with well supported specimens and is confirmed as a distinct and
reliable species, whilst the other three, viz. T. albiceps, T. cylindricus and T. macrocarpus,
were described in the 1980s and are determined here to be synonymous with other
species of the genus. Termitomyces albiceps and T. macrocarpus are synonyms of T.
eurhizus, and T. cylindricus of T. aurantiacus. Full descriptions of available specimens
cited in the original publication of T: albiceps and T. cylindricus are also provided for
reference.

Key words—Tricholomataceae, termite symbionts, nomenclature, taxonomy

Introduction

Four species of Termitomyces R. Heim, an agaric genus associated with termites, have
been described from China. They are T. albiceps, T: bulborhizus T. Z. Wei et al., T.
cylindricus and T: macrocarpus. Among them, T. bulborhizus was described recently
with descriptions in both English and Latin, well supported by a number of specimens
preserved in internationally accessible herbaria (Wei et al. 2004), whilst the other three
were published in the 1980s in Chinese with Latin diagnoses and with specimens mostly
not easily accessible (He 1985, Zhang & Ruan 1986). Both T! albiceps and T. cylindricus
were described from collections made in Guizhou (He 1985) and were included in
Wu (1990) and Ying & Zang (1994). Termitomyces albiceps was further included in
Zhang (1991) and T. cylindricus in Huang (1998). The latter was also reported from
Fujian (Guo 1995) and other localities of Guizhou (Hu et al. 2000). However, none
of the later publications noted any additional material of the taxa reported. Based on

* Author for correspondence

286

the Latin diagnosis of He (1985), Pegler & Vanhaecke (1994) suspected T. albiceps was —
conspecific with T. eurhizus or with T. globulus R. Heim & Gooss.-Font., and treated T. —
cylindricus as a distinct species. However, according to the full description in Chinese ~
(He 1985), T: albiceps is quite different from T: globulus in having a broad and blunt ~
perforatorium and blackish brown pseudorhiza in contrast with a scarcely developed ©
(or absent) perforatorium and tawny to rusty brown pseudorhiza in the latter (see Pegler
& Vanhaecke 1994). Termitomyces cylindricus is medium-sized with pileus 6.5-12.0 cm a
diam. and with white pseudorhiza, although it was considered similar to T. globulus ~
(pileus 8-20 cm diam., tawny to rusty brown pseudorhiza, see Pegler & Vanhaecke ~
1994) by He (1985). Termitomyces macrocarpus was introduced based on two collections ;

from Yunnan (Zhang & Ruan 1986) and was included by Ying & Zang (1994), Zang et

al. (1996) and Shao & Xiang (1997). Again, no further collections were noted in these ~

later publications.

In a survey of Termitomyces species in China, all the reported taxa of the genus have ~

been examined based on specimen and literature study. Some specimens of T: albiceps
and T! cylindricus cited by He (1985) were traced in the Herbarium Mycologicum,
Academia Sinica (HMAS) and the Herbarium of Cryptogams, Kunming Institute of
Botany, Academia Sinica (HKAS). They were examined and redescribed in detail and
compared with collections of T. eurhizus and T: aurantiacus from China and abroad
to determine their identity. The authors have contacted Mr. Z.-F. Zhang (co-author of
Zhang & Ruan 1986), and according to him, the specimens of T: macrocarpus are no

longer traceable and apparently lost (Zhang, pers. comm. 2003-2004) and study on its ©
taxonomic status has been based on the original description and the follow-up reports. |

Termitomyces bulborhizus is confirmed as a distinct and reliable species in the genus and
is not repeated here.

Materials and Methods

Dried specimens from Guizhou in the herbaria listed above were examined
both macroscopically and microscopically. The dried herbarium specimens were
photographed and the following description is based on the examination of the material.
For microscopic studies, free-hand sections of dried basidiocarps, including lamellae,
cutis and pileal context, were prepared using a razor-blade and mounted in a 5 % KOH
solution. Size ranges of basidiospores, basidia, hyphae of lamella and trama, pileal and
stipe context were measured using an ocular micrometer. At least 30 basidiospores and
20 basidia of each mature specimen were measured.

Taxonomy
Termitomyces albiceps S. C. He in Acta Mycol. Sinica 4: 106 (1985). Fig. 1
Synonym of T. eurhizus (Berk.) R. Heim in Arch. Mus. Hist. Nat. Paris, Sér. 6, 18: 140

(1942).

Pileus up to 9.5 cm. diam., applanate with a round perforatorium; surface brown at
centre, yellowish brown elsewhere and paling toward margin, radially striate; margin
straight, radially splitting. Lamellae free, up to 6.0 mm wide, greyish white; crowded, with

287

lamellulae. Stipe 9.0 cm long, 1.5 cm thick, central, cylindrical and thickening slightly at
ground level; surface greyish to brownish, smooth; solid and fibrous, of longitudinally
parallel hyphae, thin-walled and hyaline, 2.5-25 tm diam. Pseudorhiza up to 20 cm
long, tapering, with a pale yellowish disk connected with termite comb; surface dark
brown in upper part and black below, longitudinally striate; solid, fibrous, consisting of
thin-walled and hyaline hyphae, 2.5-33 tm diam. Partial veil not found. Context fleshy,
white, of inflated, thin-walled and hyaline hyphae, 2.0-7.5 um diam., inflating up to 35
um. Basidiospores 5.5-9.0 x 4.0-5.5 um, ovoid to ellipsoid, thin-walled and subhyaline.
Basidia 16.0-26 x 6.0-9.0 um, clavate, tetrasporic, thin-walled and subhyaline. Lamella-
edge heterogeneous. Cheilocystidia 14.0-33 x 10.0-17.0 um, clavate to pyriform, thin-
walled and hyaline. Pleurocystidia not found. Hymenophoral trama regular, up to 50 um
wide, of thin-walled and hyaline hyphae, 4.0-20 um diam. Subhymenial layer 5.0-10.0 um
wide, of branched, thin-walled and hyaline hyphae, 2.0-6.0 um diam. Pileipellis a repent
epicutis of narrow, radially parallel hyphae, 3.0-5.0 um diam.

Specimens examined - CHINA: Guizhou: Xingyi, Baiwayao, alt. 1530 m, solitary on

nest of Odontotermes formosanus (Shiraki) in coniferous forest, 22 Aug. 1983, S.-C. He

1056, HMAS 47850 (paratype); same details, 26 Aug. 1983, S.-C. He 469, HKAS 14660

(paratype).
Most of the 10 specimens cited by He (1985) in the original description of T. albiceps,
including the type, are now apparently lost. The above description is based on the two
dried collections from Guizhou cited here, which are paratypes of T. albiceps. The
following specimens of T. eurhizus were also examined for comparison to confirm the
above determination.

CHINA: Yunnan: Xishuangbanna, Mengla, Menglun, Xishuangbanna Tropical
Botanical Garden, on termite nest of Odontotermes sp., 1 Aug. 2004, M. Li & B.-H.
Tang, T0453, HMAS96507. Sichuan: Dechang, Badong Town, Songbai Village, 14 Aug.
2003, H. Deng, Y.-J. Yao, S.-Z. Fu and L. Jiao, W03-36, HMAS 79897; Honggi Village,
14 Aug. 2003, H. Deng, Y.-J. Yao, S.-Z. Fu and L. Jiao, W03-37, HMAS 84715; Pujiang,
purchased in local market, 18 Aug. 2002, B. Wang 200235, HMAS 76913. INDIA:
Kerala: Malappuram Dist., Calicut University Campus, near school ground, solitary on
ground, 30 Jul 1986, V. Vrinda, V 236, F1095161; Malappuram Dist., Botanical Garden,
Calicut University Campus, ca. 40-50 m., roadside, front of garden, on ground, 13 Jun
1984, K.M. Leelavathy, F 177, F 1091313. South Africa: Pretoria: attached to termite
nest underground, I. Bredenkamp, 14 March 1966, PREM 43147.

According to the original description of He (1985), the pileus of T. albiceps is up to
18 cm diam., and the surface of its pseudorhiza is blackish brown, similar to that of
T. eurhizus. Comparison of the above two collections, cited for T. albiceps by He (1985),
with T. eurhizus collections from China and abroad revealed that the pseudorhiza of
T. albiceps specimens was black, which is a distinct character of the T’ eurhizus specimens
examined. Furthermore, the other characters of the two specimens, such as large
basidiocarp, brownish pileus, round perforatorium and size of basidiospores, are almost
identical with those of T. eurhizus (see Pegler & Vanhaecke 1994). He (1985) mentioned
T. albiceps had some irregular tubercles on the pileus margin and its stipe surface was
covered by some fluffy squamules. However, neither of the two characters was detected
on the dried material, and no tubercles could be seen in the illustration of the type in

288

the protologue. Moreover, the present authors consider these two characters are not
constant for species identification. The tubercles on the pileus margin may be accidental
variation, which can also be found in some T! eurhizus collections, e.g. HMAS 96507.
The squamules on the stipe, which are occasionally found in some fresh material of
T. eurhizus, e.g. HMAS 79897, HMAS 84715 and HMAS 96507, are probably ephemeral
remains of a partial veil that are easily lost in specimen preservation. According to He
(1985), no pleurocystidia were found in T. albiceps. This was confirmed in the present
study of the two specimens examined. The number of pleurocystidia can vary from
numerous to scattered or rare, e.g. T. clypeatus R. Heim and T: entolomoides R. Heim
(Pegler & Vanhaecke 1994, Wei et al. 2003), or absent, e.g. T’ radicatus Natarajan
(Natarajan 1977) in some species of the genus. This phenomenon was also present in
some T. eurhizus collections, e.g. pleurocystidia were reported rare in AMH 4479 (Sathe
& Deshpande 1981) and AMH 4546 (Sathe & Daniel 1981, Tang et al. 2006), and were
absent in some specimens examined in this study, e.g. HMAS 76913 and F 1095161.
Therefore, the pleurocystidia are also not a constant character for species identification.
Consequently, there is no reliable morphological character to distinguish T: albiceps
from T. eurhizus and they are evidently conspecific.

Collections of Termitomyces albiceps were found on nests of Odontotermes formosanus,
O. quinquedentatus and O. periformosanus (He 1985). In our field work in the southwest
of China, T. eurhizus was often found associated with Odontotermes species.

Termitomyces cylindricus S.C. He in Acta Mycol. Sinica 4: 104 (1985). Fig. 2
Synonym of T. aurantiacus (R. Heim) R. Heim in Termites et Champignons (Paris): 56
(1977).

Pileus up to 9.3 cm diam., conical-applanate, with a small and bluntly pointed
perforatoium; surface brown to blackish and darker at the centre, glabrous; margin
straight, radially striate and splitting. Lamellae free, 3.0-4.0 mm wide; greyish white;
crowded, with lamellulae. Stipe 6.0-7.0 x 1.5-2.3 cm, central, cylindrical and slightly
thickened at ground level; surface greyish white to brownish, smooth and glabrous;
solid, of longitudinally parallel, thin-walled hyphae, 2.0-25 um diam. Pseudorhiza up to
17.0 cm, 1.1 cm wide and tapering downward from ground level, terminating with a pale,
cylindrical base; surface brownish, longitudinally striate; solid, of longitudinally parallel,
thin-walled hyphae, 2.0-25 um diam. Partial veil not found. Context fleshy, white,
of inflated, thin-walled and hyaline hyphae, normally 2.5-8.0 um diam. inflating to 35 um
diam. Basidiospores 5.0-7.5 x 3.5-4.5 um, ovoid to ellipsoid, thin-walled and subhyaline.
Basidia 17.0-22 x 6.0-7.5 um, clavate, tetrasporic, thin-walled and subhyaline. Lamellae
edge heterogeneous. Cheilocystidia 25-43 x 12.0-23 um, clavate to pyriform, thin-
walled and hyaline. Pleurocystidia not found. Hymenophoral trama regular, 40-50 um
wide, of thin-walled and hyaline hyphae, 4.0-18.0 um diam. Subhymenial layer narrow,
of branched hyphae, 2.0-5.0 um diam. Pileipellis an epicutis of narrow, radial hyphae,
containing yellowish granules, 2.5-5.0 um diam.

Specimens examined - CHINA: Guizhou: Xingyi, Baiwayao Town, alt. 1530 m, symbiotic
with Macrotermes orthognathus Ping et Xu, 22 Aug. 1983, S.-C. He 1062, HKAS 14695
(paratype); alt. 1330 m, 22 Aug. 1983, S.-C. He 1061, HMAS 47851 (paratype).

289

Figs 1-2. Photographes of Termitomyces spp. from China. Fig. 1. Habit of Termitomyces albiceps
(HMAS 47850). Fig. 2. Habit of Termitomyces cylindricus (HMAS 47851).

The above description is solely based on these two dried collections from Guizhou,
which were cited in the protologue of T. cylindricus (He 1985). The following specimens
of T: aurantiacus were also examined for comparison.

CHINA: Yunnan: Mengla, Menglun, Xishuangbanna Tropical Botanic Garden, on
termite nest, G.-R. Hu & T.-Z. Wei, 8 Aug. 2003, w03-19, HMAS 84720; the same
locality, on termite nest of Macrotermes sp, M. Li & B.-H. Tang, 2. Aug. 2004, T0456,
HMAS 99569; the same locality, on mounds of Macrotermes sp., Li & B.-H. Tang, 8 Aug.
2004, T0493, HMAS 99570; Jingdong, Phoenix Mountain, alt. 1260 m, 25 Aug. 1991,
Z.-L. Yang 1642, HKAS 23955. THAILAND: River Kwai: Kanchanaburi, Kang Chaw,
Boonthungs Farm, 20 Sept. 1980, B. J. Bels, K(M) 94661.

The type and most of the 11 specimens cited for T: cylindricus by He (1985) cannot
now be traced. The two collections cited in the protologue and examined here resemble
T. aurantiacus in having medium-sized basidiocarps with a pointed perforatorium and
pale pseudorhiza. Microscopically, the two T: cylindricus specimens are identical with
those of T: aurantiacus. According to He (1985), T: cylindricus can be distinguished
from other species of the genus by its cylindrical pseudorhiza base. However, several
collections of T. aurantiacus from Xishuangbanna, Yunnan, (e.g. HMAS 99569, HMAS
99570 and HMAS 84720), also have a cylindrical base at the end of the pseudorhiza. The

' present authors found no small squamules mentioned by He (1985) on the stipe surface

290

of the two collections. The structure is probably formed by ephemeral remains of partial
veil and can often be seen in fresh material of T. aurantiacus.

Termitomyces aurantiacus is distinct in its constantly bright reddish ochraceous to
orange pileus and its firm texture (Pegler & Vanhaecke 1994). The pileus of T. cylindricus
was described as ‘brunneolus vel cinerascens’ in Latin and ‘pale brown to ash-grey’
(literary translation) in Chinese by He (1985), and is brown to blackish in the two dried
herbarium specimens examined by the present authors, but the illustration of the type
material in the protologue (Plate I-2) shows no clear difference in pileus color from
T. aurantiacus as seen in the field, although the plate seems not to be produced perfectly
in color.

He (1985) described the lower part of the pseudorhiza of T. cylindricus as ‘pale
yellowish green, different from the white pseudorhiza of T. aurantiacus (Pegler &
Vanhaecke 1994). Unfortunately, this character cannot be detected in the dried
specimens. In some T. aurantiacus collections from Yunnan, the lower part of the
pseudorhiza was slightly yellowish when fresh, but no green pseudorhiza have been
seen in any species of Termitomyces.

Based on the discussion above and the morphological characters observed from the
two specimens of T! cylindricus, it is concluded here that T. cylindricus is synonymous
with T! aurantiacus.

Termitomyces aurantiacus is widely distributed in both Africa (Heim 1977, Mossebo
et al. 2002, Aanen et al. 2002, Froslev et al. 2003) and Asia (Pegler & Vanhaecke 1994,
Aanen et al. 2002, Froslev et al. 2003, Wei & Yao 2003). According to He (1985),
T. cylindricus grows on nests of Macrotermes barneyi and M. orthognathus. In our field
work in Xishuangbanna, Yunnan, T’ aurantiacus was also found to be symbiotic with
Macrotermes species. In Africa, T: aurantiacus was reported to be associated with the
termite Pseudacanthotermes militaris (Batra & Batra 1979, Pegler & Vanhaecke 1994).

Termitomyces macrocarpus Z.F. Zhang & X.Y. Ruan in Acta Mycol. Sinica 5: 10 (1986).
nom. invalid (Arts 37.1 and 37.2, ICBN).

Synonym of T. eurhizus (Berk.) R. Heim in Arch. Mus. Hist. Nat. Paris, Sér. 6, 18: 140_
(1942).

In the protologue of T: macrocarpus, the specimens examined were listed as ‘YUNNAN:
Ad Odontotermim formosanum Shiraki et O. yunnanensem Tsai, alt. 1200-1900 m,
Zhang Zheng-fu 1979-1981 (Typus Y B002, Y BO03). Similar phrases were used in
the description of the material in Chinese, but adding two locations as ‘#R 3, 32H’
(Luquan, Mengzi). Apparently, the description of the material is a mixture, with different
locations, hosts and dates, and the designation of the type, either one specimen “Y B002’
or both specimens “Y B002’ and ‘Y B003; is unclear. Although Ying & Zang (1994) was
later able to specify “YB002’ from Luquan and “YB003’ from Mengzi and declared the
type was deposited in the Herbarium of Yunnan Agricultural University (YB), the two
numbered specimens are no longer traceable and the status of the type material cannot
be further clarified. Because Zhang & Ruan (1986) did not unambiguously designate
the holotype, the name ‘“Termitomyces macrocarpus Z. F. Zhang & X. Y. Ruan’ is invalid
according to Arts 37.1 and 37.2 of ICBN (Greuter et al. 2000).

291

According to the description by Zhang & Ruan (1986), the basidiocarp of
T. macrocarpus was large and robust, with pileus up to 38 cm diam., and the stipe base
dark, often fuliginous-brown. In the illustration in the protologue, the badiocarps
show typical characters of T. eurhizus in terms of the shape of pileus and stipe, and
the pseudorhiza surface which is apparently darker than that of the stipe and possibly
blackish. Because the pseudorhiza was not mentioned in their description, the dark
stipe base described for T: macrocarpus by Zhang & Ruan (1986) is possibly referable
to the pseudorhiza. Termitomyces eurhizus is recognized by its large fleshy, gray brown
pileus with an obtusely rounded or broadly umbonate perforatorium, and the long,
cartilaginous pseudorhiza encrusted with black-brown cuticle (Pegler 1977, Pegler &
Vanhaecke 1994). The pileus of T. eurhizus can also extend to 36 cm in diam. (Pegler
1977), and the color of its pileus surface varies from almost white to dark brown. The
morphological characters described by Zhang & Ruan (1986) and Ying & Zang (1994)
for T. macrocarpus are identical with those of T. eurhizus. Therefore, T. macrocarpus is
an additional synonym of T. eurhizus, although it was not validly published.

Discussion

Termitomyces is a paleotropical genus of macrofungi cultivated by termites belonging to
the subfamily Macrotermitinae (Isoptera) (Heim 1942, 1977, Batra & Batra 1979, Bels &
Pataragetvit 1982, Pegler & Vanhaecke 1994). In total, 68 taxa have been published in
Termitomyces, with 81 names including combinations and autonyms. In recent decades,
many new taxa were described from Asia, especially China (He 1985, Zhang & Ruan
1986, Wei et al. 2004) and India (Dhancholia et al. 1991, Natarajan 1975, 1977, 1979,
Sathe & Daniel 1981, Sathe & Deshpande 1981). However, quite a few taxa described
from this region have been found to be synonyms of early published names, i.e. taxa
originally reported from India, T. longiradicatus Sathe & J. T. Daniel, T: poonensis
Sathe & S. D. Deshp. and T. quilonensis Sathe & J. T. Daniel (Tang et al. 2006) and
T. indicus Natarajan (Pegler & Vanhaecke 1994). Many more taxa of Termitomyces have
been documented from Africa (Heim 1942, 1977, Otieno 1966, 1969, Pegler 1977, Van
der Westhuizen & Eicker 1990, Mossebo et al. 2002) and the taxonomic status of some
of them is also suspicious, i.e. T: narobiensis Otieno has been regarded as a synonym
of T. microcarpus (Berk. & Broome) R. Heim, T: biyii Otieno and T. rabuorii Otieno
considered a representative of an exannulate form of T! letestui (Pat.) R. Heim and of
T. mammiformis R. Heim respectively, and T: magoyensis Otieno close to T. schimperi
(Pat.) R. Heim (see Pegler 1977), and T. umkowaanii (Cooke & Massee) D. A. Reid very
close to T. eurhizus (Pegler & Vanhaecke 1994). Mossebo et al. (2002) proposed eight
new taxa based on material from Cameroon, but most of them resemble existing taxa.
Careful revision of these taxa is required to confirm their taxonomic status.

Acknowledgements

The authors are grateful to Drs Peter Roberts and Zhu-Liang Yang for serving as pre-submission
reviewers and for their valuable comments and suggestions, and to Prof. Fu-Sheng Huang for
assistance in identification of the termite. This project is supported by a general grant (30470008)

and the National Science Fund for Distinguished Young Scholars (30025002) from the National

292

Natural Science Foundation of China, the Key Research Direction of Innovation Programme
(KSCX2-SW-101C) and the scheme of Introduction of Overseas Outstanding Talents, operated —
by the Chinese Academy of Sciences, and the National Hi-Tech Research and Development Plan
(2004AA227100) from the Ministry of Science and Technology.

Literature Cited

Aanen DK, Eggleton P, Rouland-Lefévre C, Froslev TG, Rosendah S, Boomsma JJ. 2002. The ~
evolution of fungus-growing termites and their mutualistic fungal symbionts. Proceedings of
the National Academy of Sciences of the United States of America 99: 14887-14892. i

Batra LR, Batra SWT. 1979. Termite-fungus mutualism. In Batra, L R, 1979. Insect-Fungus 4
Symbiosis. Nutrition, Mutualism and Commensalis. New York: Allanheld, Osmun & Co. 117-
163.

Bels PJ, Pataragetvit S. 1984. Edible Mushrooms in Thailand, Cultivated by Termites. in Zhang, S. T.
& T. H. Quimio. 1984. Tropical Mushrooms, Biological Nature and Cultivation Methods (2nd.
edn). Hong Kong, the Chinese University Press. 445-461.

Dhancholia S, Bhatt JC, Pant SK. 1991. Studies on some Himalayan agarics. Acta Botanica Indica
19: 104-109.

Froslev TG, Aanen DK, Leessoe T, Rosendahl S. 2003. Phylogenetic relationships of Termitomyces
and related taxa. Mycological Research 107: 1277-1286.

Guo D-Z. 1995. Termitomyces species on Nantai Island, Fuzhou. Edible Fungi 17: 5. (in Chinese).

He S-C. 1985. Taxonomic studies of Termitomyces from Guizhou Province of China. Acta
Mycologica Sinica 4: 103-108.

Heim R. 1942. Nouvelles Etudes sur Les Agarics Termitophiles d'Afrique Tropicale. Archives du
Muséum National d'Histoire Naturelle, Séries. 6, 18: 1-60, pls 9-12.

Heim R. 1977. Termites et Champignons. Société Nouvelle Des Editions Boubée, Paris. 1-206

Hu Q-X, Cang R, Xiang H. 2000. Investigation of wild Termitomyces in Shuicheng County, Guizhou.
Edible Fungi 22: 7. (in Chinese).

Huang N-L. 1998. Cloured Illustrations of Macrofungi (Mushroom) of China. Beijing: Chinese
Agricultural Press. (in Chinese).

Kirk PM, Cannon PF, David JC, Stalpers JA. 2001. Dictionary of the Fungi. 9" edn. CAB
International, Wallingford, UK.

Mossebo DC, Amougou A, Atangana RE. 2002. Contribution a létude du genre Termitomyces
(Basidiomycetes) au Cameroon: écologie et systematique. Bulletin de la Société Mycologique
de France 118: 195-249.

Natarajan K. 1975. South Indian Agaricales 1. Termitomyces. Kavaka 3: 63-66.

Natarajan K. 1977. A new species of Termitomyces from India. Current Science 46: 679-680.

Natarajan K.1979. South Indian Agaricales V: Termitomyces heimii. Mycologia 71: 853-855.

Otieno NC. 1966 [as 1964]. Contributions to a knowledge of termite fungi in East Africa: the genus
Termitomyces Heim. Proceedings of East African Academy 2: 108-120.

Otieno NC. 1969 [as 1968]. Further contributions to a knowledge of termite fungi in East Africa:
the genus Termitomyces Heim. Sydowia 22: 160-165.

Pegler DN. 1977. A Preliminary Agaric Flora of East Africa. Kew Bulletin. Additional Series 6:
277-295.

Pegler DN, Vanhaecke M. 1994. Termitomyces of Southeast Asia. Kew Bulletin 49: 717-736.

293

Rouland-Lefevre C, Diouf MN, Brauman A, Neyra M. 2002. Phylogenetic relationships in

Termitomyces of ITS: a first approach to elucidate the evolutionary history of the symbiosis
_ between fungus-growing termites and their fungi. Molecular Phylogenetics & Evolution 22:

423-429.

Sathe AV, Daniel J. 1981 [as 1980]. Maharashtra Association for the Cultivation of Science (MACS),
Monograph No. 1: Agaricales (Mushrooms) of south west India (Pune): 75-108.

Sathe AV, Deshpande S. 1981 [as 1980]. Maharashtra Association for the Cultivation of Science
(MACS), Monograph No. 1; Agaricales (Mushrooms) of South West India (Pune): 9-42.

Shao L-P, Xiang C-T. 1997. Mushrooms in the forest of China. Harbin: Northeast Forestry
University Press. (in Chinese).

Tang B-H, Wei T-Z, Yao Y-J. 2006 [as 2005]. Type revision of three Termitomyces species from
India. Mycotaxon. 94: 93-102.

Van der Westhuizen GCA, Eicker A. 1990. Species of Termitomyces occurring in South Africa.
Mycological Research 94: 923-937.

Wei T-Z, Yao Y-J. 2003. Literature review of Termitomyces species in China. Fungal Science 18:
39-54. (in Chinese).

Wei T-Z, Yao Y-J, Li T-H. 2003. First record of Termitomyces entolomoides in China. Mycotaxon
88: 433-438.

Wei T-Z, Yao Y-J, Wang B, Pegler DN. 2004. Termitomyces bulborhizus sp. nov. from China, with
a key to allied species. Mycological Research 108: 1458-1462.

Wu X-L. 1990. Macrofungi in Guizhou Province. Guiyang: Guizhou People’s Republic Press.
(in Chinese).

Ying J-Z, Zang M. (eds.) 1994. Economic Macrofungi from Southwestern China. Beijing: Science
Press. (in Chinese).

Zang M, Li B, Xi JX. 1996. Fungi of the Hengduan Mountains. Beijing: Science Press.
(in Chinese).

Zhang X-Y. 1991. Illustration of Edible Fungi and Poisonous fungi in Guizhou. Guiyang: Guizhou
Technological Publisher. (in Chinese). )

Zhang Z-F, Ruan X-Y. 1986. A new species of Termitomyces-Termitomyces macrocarpus Zhang et
Ruan sp. nov. Acta Mycologica Sinica 5: 10-13. (in Chinese).

294

Volume 95, pp. 295-300 January-March 2006

Two new species of Marasmius
(Basidiomycota, Marasmiaceae) from Brazil

CARLA PUCCINELLI & MARINA CAPELARI

puccinellic@yahoo.com.br
Instituto de Botanica, Segao de Micologia e Liquenologia
Caixa Postal 4005, 01061-970 Sao Paulo, SP, Brazil

Abstract—Two new species of Marasmius, M. pseudosetosus and M. dimorphus,
collected in Atlantic Forest at Sao Paulo city, SP, Brazil are described, illustrated and
discussed. Both species belong to Marasmius sect. Sicci subsect. Siccini series Leonini.

Key words—Agaricales, taxonomy, biodiversity

Introduction

In the course of making collections of Marasmius for the revision of this genus in the
Parque Estadual das Fontes do Ipiranga (PEFI), Sao Paulo, SP, Brazil, two new species
have been collected and are here described. Both species are classified in Marasmius
sect. Sicci Singer, subsect. Siccini Singer, series Leonini Singer (Singer 1976). This group
of Marasmius is characterized by the hymeniform pileal surface composed by smooth
or Siccus-type broom cells without setae, absence of pleurocistidia and stipe glabrous
without dermatocystidioid hairs or setae.

Until now, eight species of this group have been reported for PEFI by Grandi et al.
(1984) and Pegler (1997): M. berteroi (Lév.) Murrill, M. haediniformis Singer, M. leoninus
Berk., M. phaeus Berk. & M.A. Curtis, M. pusio Berk. & M.A. Curtis, M. rhabarbarinus
Berk., M. ruber Singer and M. subrotula Murrill.

The microscopic analyses have been made from dried material rehydrated in 70%
ethanol followed by 5% KOH and Melzer’s reagent. The Qm represents the mean length/
width quotient of the total spores measured. All the specimens are deposited in SP.

Taxonomic descriptions

Marasmius pseudosetosus C. Puccin. & Capelari sp. nov. Figure 1

Pileus 5-20 mm latus, campanulatus dein convexus, cum papilla centralis, margine levis,
glaber, reticulatus, hygrophanus, pallide aurantiacus. Lamellae liberae sed confertae
stipes, pseudocollarium in juvenis, albidae vel cremeae, acie concolorae, confertus, cum
lamellulae. Stipes 30-42 x 1 mm, cylindricus, rubro-brunneus vel vinaceus, apice
concolor lamellae, fistulosus, mycelium basium flavus. Basidiosporae 7.5-11.25 x 3.0-5.0
um, ellipsoidae-fusoidae, leves, hyalinae, inamyloideae, tenuitunicatae. Pleurocystidia

296

Figure 1. Marasmius pseudosetosus (holotype): a. basidioma, b. basidiospore, c. cheilocystidia,
d. pileipellis cells, e. transitional cells. Scale bar = 10 um.

297

nulla. Cheilocystidia similes cellulis hymenidermatis Marasmii sicci et clavatus pyriformis,
17.5-21.25x 7.5-8.75 um hyalinus tenui vel crassitunicatis. Trama lamellarum regulare,
ex hyphis dextrinoideis, 2.5-5 um, tenuitunicatis, septatis, fibulae presentes. Pileipellis
hymeniformis et cellulis similibus cellulis hymenidermatis Marasmii sicci et cellulis
similibus setae. Cellulae setulosae 13.75-20 x 3.75-7.5 um, clavate, hyalinae vel pallide
luteo-brunneae, crassitunicatae, setulae ad apicem 6.25-8.75 um; cellulae simili setae
31.25-55 x 5-8.75 um, crassitunicatae, brunneae. Caulocystidia nulla. Dispersus ad folia
sicca.

Holotypus: BRAZIL, SB, Sado Paulo. Parque Estadual das Fontes do Ipiranga, (23°39°S
46°37'W), 30 March 2005, Puccinelli 126 (holotypus in herbarium SP asservatur).

Pileus 5-20 mm diam., convex to campanulate, applanate when mature with a small
central papilla, disc reticulate, margin smooth, glabrous, hygrophanous, pale orange and
darker center. Lamellae free, but very close to the stipe, pseudocollarium present in the
young specimens, with lamellulae, close, dirty white to cream, with concolorous edge.
Stipe 30-42 x 1 mm, cylindrical, glabrous, central, hollow, reddish brown to vinaceous,
becoming paler at apex where it is concolorous with the lamellae, yellowish cream, with
a well-developed basal mycelium. Context thin, dextrinoid. Basidiospores 7.5-11.25
x 3.0-5.0 um (Qm = 2.50, n = 40 basidiospores), ellipsoid-fusoid, smooth, hyaline,
inamyloid, thin-walled. Basidia not observed. Pleurocystidia absent. Cheilocystidia
of two types: a) similar to the broom cells from pileal surface, hyaline and very rarely
found; b) predominantly clavate-pyriforme, 17.5-21.25 x 7.5-8.75 um, smooth, hyaline,
thin to thick-walled. Pileipellis hymeniform, composed of Siccus-type broom cells
and transitional cells between broom cells and structures that resemble setae. Siccus-
type broom cells with main body 13.75-20 x 3.75-7.5 um, clavate, hyaline to brown
or gold, thick-walled; apical setulae 6.25-8.75 um; transitional cells 31.25-55 x 5-8.75
um, scattered, brownish, thick-walled, some with similar shape to the broom cells.
Lamellar trama regular, dextrinoid, with hyaline, thin-walled, septated hyphae, with
clamp-connections, 2.5-5 um diam. Stipe with cortical hyphae 3.75-7.5 um diam,
parallel, brownish yellow, dextrinoid, thick-walled; medullary hyphae 2.5-3.75 um diam,
hyaline, weakly dextrinoid, thin-walled. Caulocystidia absent. Basidioma scattered on
dry leaves in the litter.

Material examined: BRAZIL, SP, Sao Paulo. Parque Estadual das Fontes do Ipiranga,
(23°39’S 46°37’'W), 30 March 2005, Puccinelli 125 (SP); Puccinelli 126 (holotype, SP);
01 April 2005, Puccinelli 131 (SP); 132 (SP).

Comments: This species is characterized by the hygrophanous, light orange, reticulated
pileus, the close lamellae with lamellullae and stipe colour. Microscopically by the
small and ellipsoid-fusoid basidiospores, absence of pleurocystidia, by the presence of
dimorphic cheilocystidia (those similar with the broom cells are very difficult to find)
and scattered transitional cells between setiform structures mixed with the broom
cells in the pileipellis, (easily visible when the material is squashed). ‘These structures
are easily recognized by the larger size, the thickness of the wall and the deep colour.
Among the species of Marasmius sect. Sicci with true setae in the pileipellis (series
Spinulosi (Clémencon) Desjardin), M. pseudosetosus differs by the absence of setae
in the pileipellis, by the pileus and stipe colour and by the dimorphic cheilocystidia.
_ Macroscopically a close relative is M. leoninus, but they could be separated by the pileus
colour and the peculiar pilleipellis structure of M. pseudosetosus.

298

Marasmius dimorphus C. Puccin. & Capelari sp. nov. Figure 2
Pileus 12-20 mm latus campanulatus dein convexus, margine crenata, glaber, sulcatus,
spadiceus novus, brunneo-vinosus siccatus. Lamellae liberae, distantes, cremae, 17-18
lamella exclusus lamellulae. Stipes 4.8-5.6 mm, filiformibus, cavis, glabris, atrocastaneus,
mycelium basium cremium. Basidiosporae 12.5-16.25 x 3.75-5 um, clavate fusoideae, leves,
hyalinae, inamyloideae, tenuitunicate. Pleurocystidia nulla. Cheilocystidia elementisque
epicuticularibus setuligeris typi sicci sed minutus et hyalinus, crassitunicatae, 11.25-16.25
x 2.5-5 um. Trama lamellarum regulare, hyphis hyalinis, dextrinoideis, 1.25-3.75 um,
tenuitunicatis, septatis, fibulae presentes. Pileipellis hymeniformis et cellulis similibus
cellulis hymenidermatis Marasmii sicci, dimorphae. Minora cellulae setulosae 7.5-17.5
x 3.75-5 um clavatae, crassitunicatae luteobrunneae et magna cellulae atrobrunnea,
crassitunicatae, 32.5-45 x 5-6.25 um. Caulocystidia nulla. Dispersus ad folia sicca.

Holotypus: BRAZIL, SP, Sado Paulo. Parque Estadual das Fontes do Ipiranga, (23°39°S
46°37°'W), 19 January 2005, Puccinelli 62 (holotypus in herbarium SP asservatur).

Pileus 12-20 mm diam, campanulate to convex, margin crenate, surface glabrous but
velutinous under a lens, sulcate, membranaceous, beige to light brown or pinkish
brown, with darker center when fresh, turning vinaceous brown when dry. Lamellae
free, distant (17-18), lamellulae absent, cream. Stipe 48-56 mm in length, central,
glabrous, filiform, hollow, chestnut brown, with cream basal mycelium. Context thin,
dirty white, dextrinoid. Basidiospores 12.5-16.25 x 3.75-5 um (Qm = 3.8, n = 25
basidiospores), clavate-fusiform, smooth, hyaline, inamyloid, thin-walled. Basidia not
observed. Pleurocystidia absent. Cheilocystidia like the broom cells of the pileipellis,
but smaller and with pale color, slightly thick-walled, 11.25-16.25 x 2.5-5 um. Lamellar
trama regular; hyphae 1.25-3.75 um diam., hyaline, dextrinoid, thin-walled, septated,
with clamp-connections. Pileipellis hymeniform, composed of dimorphic Siccus-type
broom-cells, normal broom-cells with main body 7.5-17.5 x 3.75-5.0 um, clavate, light
brown to light gold, thick-walled and larger broom-cells 32.5-45 x 5-6.25 um, with
few to many branches, deep brown, thick-walled. Stipe with cortical hyphae 6.25-8.75
tum diam, parallel, hyaline to brownish yellow, dextrinoid, thick-walled. Caulocystidia
absent. Basidioma solitary on small sticks in litter.

Material examined: BRAZIL, SP, Sao Paulo, Parque Estadual das Fontes do Ipiranga,
(23°39°S 46°37°W), 19 January 2005, Puccinelli 62 (holotype SP), 07 April 2005,
Puccinelli 142 (SP).

Comments: Marasmius dimorphus is characterized by the pileus colour, which ranges
from beige to light brown, with darker center when fresh, some are pinkish brown and
after drying they become vinaceous brown, with distant cream gills. The microscopical
features of the broom cells of this species are very distinct, being dimorphic and
differing in shape and size. The larger broom cells differ from the normal ones by the
color, the thickness of the wall, the absence of a visible delimitation between the basal
body and the setulae and by the few branches of the apical portion. They are also larger
and more abundant near the centre and smaller and less present near the margin. These
characteristics distinguish this interesting species from all other described species of
Marasmtus.

Z99

Figure 2. Marasmius dimorphus (holotype): a. basidioma, b. basidiospore, c cheilocystidia,
d. normal pileipellis cell, e. larger pileipellis cell. Scale bar = 10 um.

300
Acknowledgments

A special thanks to Maria Cecilia Tomasi for inking the illustrations, Dr. Jefferson Prado, Instituto
de Botanica, for revision of the Latin diagnosis. We also thank Dr. Vladimir Antonin, Moravian
Museum, Dept. of Botany, and Dr. Dennis E. Desjardin, San Francisco State University, for their
careful review of the manuscript. This study was supported by Fundacao de Amparo a Pesquisa do
Estado de Sao Paulo (FAPESP, grant 04/04319-2).

Literature cited

Desjardin DE, Horak E. 1997. Marasmius and Gloiocephala in the South Pacific Region: Papua
New Guinea, New Caledonia and New Zealand taxa. Part 1: Papua New Guinea and New
Caledonia taxa. Part 2: New Zealand taxa. In Petrini O, Petrini LE, Horak E. (eds.), Taxonomic
monographs of Agaricales II. Bibliotheca Mycologica 168: 1-152.

Grandi RAP, Guzman G, Bononi VL. 1984. Adicées as Agaricales do Parque Estadual das Fontes do
Ipiranga, Sao Paulo, SP, Brasil. Rickia 11: 27-33.

Pegler DN. 1997. The agarics of Sao Paulo, Brazil. Royal Botanic Gardens, Kew, 68 p.

Singer R. 1976. Marasmiae (Basidiomycetes, Tricholomataceae). Flora Neotropica. Monograph 17:
1-347.

MYCOTAXON

Volume 95, pp. 301-304 January-March 2006

Geastrum hirsutum: a new earthstar fungus
with a hairy exoperidium

I. G. BASEIA? & F. D. CALONGE?

baseia@cb.ufrn.br
Universidade Federal do Rio Grande do Norte, CB
Depto. Botanica, Ecologia e Zoologia, 59072-970, Natal, RN, Brazil

calonge@ma-rjb.csic.es
?Real Jardin Botdnico, CSIC
Plaza de Murillo 2, 28014 Madrid, Spain

Abstract- Geastrum hirsutum was found growing on decaying wood on an abandoned
termites nest in Atlantic rainforest. This rare species is easily recognized by its small and
caespitose basidiome with a very hirsute exoperidium.

Key words- Gasteromycetes, Phallales, taxonomy, neotropics, Brazil.

Introduction

Historically, the Geastrum has been placed in the Lycoperdales. Recently, however,
molecular data have prompted a great modification in the systematics of the
gasteromycetes that has led to the transfer of this genus to the Phallales (Hibbett et al.
1997). Despite several previous publications (Rick 1961, Bononi et al. 1984, Kimbrough
et al. 1995, Baseia & Milanez 2002, Baseia et al. 2003, Sobestiansky 2005), Geastrum is
still not well known Brazil.

During the last decade, the extent of fungal diversity was widely discussed
(Hawksworth 1993; Hyde 1997). Today we know that—in terms of species numbers—
Kingdom Fungi is probably surpassed only by the insects (Hyde & Hawksworth 1997).
It is estimated that there are at least 1.5 million fungal species in the world (Hawksworth
2001) but, up to now, only 72,000 species (or 5% of the projected total) have been
described. In this context, our goal is to contribute to what is known about fungal
diversity in Brazil and the world in general, with emphasis on the taxonomy and ecology
of the gasteroid fungi.

Materials and methods

Fieldtrips have been carried out during May and June 2003, to the Parque Dois Irmaos

(07°55 S and 34°52’ W) and Reserva Ecoldégica do Gurjaui (08°14 S and 35°03 W). Both
; 8 )

are remnants of the Atlantic rainforest located in the State of Pernambuco. Sporocarps

302

were examined and photographed in the field. Macro and microscopic characters were
determined according to Sunhede (1989). Colours were coded according to Kornerup
& Wanscher (1978), with the indication “KW’, bracketed in the text, and simultaneously
described. They were dried up slowly and placed in containers with naphthalene.

Results

Geastrum hirsutum Baseia & Calonge, sp. nov. Figs. 1-2.

Basidiomata juvene epigaeum, depresse globosum vel ovoideum, 4-8 mm latum, 5-10
mm altum, caespitosum, in subiculo pallide luteo. Exoperidium non hygroscopicum
apertum 15-20 mm latum, fissum in 5-7 radios acutos, recurvos; stratum myceliale
hirsutum, brunneoluteum; stratum medium pallide luteum, tenue; stratum internum
brunneoluteum, tenue, persistens. Endoperidium sessile globosum cinereobrunneum laeve,
4-6 mm diam., cum; peristomio determinato, fibrilloso, cinereo. Gleba cinerea; columella
indistincta; sporae globosae, 2.5-3 um latae, brunneae, verrucis uniformibus subtilibus
brevibus ornata. Hyphae capillitii longae, 1-1.5 um latum, brunneae, verruculosae, non
ramificatae.
Holotypus: Brasil, Pernambuco, Recife, Reserva Ecologica do Gurjau, ad lignum putridum,
12-VI-2003, leg. I. G. Baseia, UFRN-fungos 245. Paratypus: Dois Irmdos, 21/VI/2003,
leg. I. G. Baseia URM 78711. MA-Fungi 67886.

Basidiomata epigaeus when young, subglobose to obovate (Fig. 1), 4-8 mm broad, 5-10
mm high, caespitose, growing on a subiculum pale yellow (KW 4A3). Exoperidium,
when open, 15-20 mm broad, split into 5-7 acute, recurving rays; nonhygroscopic (Fig.
1); mycelial layer densely hairy (Fig. 1), yellowish-brown (KW 5D8 to 5E7); hairs 1.5-
3 mm long, made of hyphal aggregates with pointed ending, the hyphae are 2-5 um
diam., aseptate, clampless, with or without lumen, pale yellowish; medium layer pale
yellowish (KW 4A3) to yellowish white (KW 4A2), thin; inner layer yellowish brown
(KW 5E5), thin, persistent. Endoperidium smooth, brownish grey (KW 5D2), sessile,
globose, 4-6 mm diam.; peristome definite, fibrillose, grey (KW 5B1). Gleba grey (KW
5F1), columella indistinct; spores globose, 2.5-3 um broad, brown, with irregular short
warts (Fig. 2a). Capillitium hyphae long, 1-1.5 um broad, brown, covered with small
wart-like outgrowths (Fig. 2b), not branching.

Discussion

Within Geastrum there are several species with some kind of hairy elements. Thus,
G. albonigrum also has a hairy exoperidium (Calonge & Mata 2004), but it grows on
soil, lacks any kind of a subiculum, and both basidiomata and spores are larger. On the
other hand, G. hieronymi (Ponce de Leon 1968), G. fimbriatum var. pseudohieronymi
(Calonge et al. 2005) and G. setiferum (Baseia & Milanez 2002) have a hairy or setose
endoperidium, but they lack of any type of ornamentation on the exoperidium. Finally,
Phialastrum barbatum (Sunhede 1989) shows a columella with a radiating sterile hyphal
covering that resembles a beard.

An assembly of peculiar characteristics can easily identify this species: a mature
developed subiculum and an exoperidium with a very hairy mycelial layer. Furthermore,
it has very small spores 2.5-3 um diam. The habitat is likewise unusual: decaying wood
on an abandoned termites nest.

303

Fig. 1 Geastrum hirsutum (holotypus) a: Immature and mature basidiomata.

os ieee : Bes
500 -15000x__ age)

Fig. 2: Geastrum hirsutum (holotypus) a: Basidiospores under SEM, b: Capillitium surface.

Geastrum hirsutum is close to another tropical species, G. schweinitzii (= G. mirabile),
in that both share several features in common: small, caespitose basidiomes growing on
a well-developed subiculum that produce small spores and have a lignicolous habitat.
In contrast, the exoperidium of G. schweinitzii has a smooth mycelial layer. All these
features are enough to propose G. hirsutum as a new species.

Acknowledgments

We express our gratitude to the Conselho Nacional de Desenvolvimento Cientifico e Tecnoldgico
(CNPq) for the partial financial support, and to Tereza Cristina de Oliveira Galvao for the
illustrations. We also thank Professors H. Kreisel and G. Moreno for critical revision of the
manuscript.

304

References

Baseia IG, Milanez AI. 2002. Geastrum setiferum (Gasteromycetes): a new species with a setose
endoperidium. Mycotaxon 84: 135-139.

Baseia IG, Cavalcanti MA, Milanez AI. 2003. Additions to our knowledge of the genus Geastrum
(Phallales: Geastraceae) in Brazil. Mycotaxon 85: 409-416.

Bononi VL, Guzman G, Capelari M. 1984. Basidiomycetos do Parque Estadual da Ilha do Cardoso,
V: Gasteromycetos. Rickia 11: 91-97. .

Calonge FD, Mata M. 2004. A new species of Geastrum from Costa Rica and Mexico. Bol. Soc.
Micol. Madrid 28: 331-335.

Calonge FD, Mata M, Carranza J. 2005. Contribucién al catalogo de los Gasteromycetes

(Basidiomycotina, Fungi) de Costa Rica. Anales Jardin Botanico Madrid 62 (1): 23-45.

Hawksworth DL. 1993. The tropical fungal biota: census, pertinence, prophylaxis and prognosis.
In: Aspects of Tropical Mycology (eds. Issac S$, Frankland JC, Watling R, Whalley AJS),
Cambridge University Press, Cambridge: 265-293.

Hawksworth DL. 2001. The magnitude of fungal diversity: the 1.5 million species estimate revised.
Mycological Research 105 (12): 1422-1432.

Hibbett DS, Pine EM, Langer E, Langer G, Donoghue MJ. 1997. Evolution of gilled mushrooms
and puffballs inferred from ribosomal DNA sequences. Proceeding of the National Academy
of Science USA 94: 12002-12006.

Hyde, KD. 1997. Can we rapidly measure fungal diversity? Mycologist 11(4): 176-178.

Hyde KD, Hawksworth DL. 1997. Measuring and monitoring the biodiversity of microfungi. In:
Biodiversity of tropical microfungi (ed. Hyde, K. D.). Hong Kong University Press, Hong Kong:
141-156.

Kimbrough JW, Alves MH, Maia, LC. 1995. Basidiomycetes saprofitos presentes em troncos vivos
e em folhedos de sombreiro (Clitoria fairchiana (Benth.) Howard). Bioldgica Brasilica 6 (1/2):
51-56.

Kornerup A, Wanscher JH. 1978. Methuen handbook of colours. Third edition. Eyre Methuen.
London. 252 pp.

Miller OK, Miller HH. 1988. Gasteromycetes: Morphology and Developmental Features. Mad
River, Eureka, CA, 157 pp.

Ponce de Leén P. 1968. A revision of the family Geastraceae. Fieldiana: Botany 31: 302-349.

Rick J. 1961. Basidiomycetes Eubasidii in Rio Grande do Sul. Iheringia, Ser. Bot. 9: 451-490. _
Sobestiansky G. 2005. Contribution to a Macromycete Survey of the States of Rio Grande do Sul
and Santa Catarina in Brazil. Brazilian Archives of Biology and Technology 48(3): 437-457.
Sunhede S. 1989. Geastraceae (Basidiomycotina). Morphology, ecology and systematics with special
emphasis on the North European species. (Synopsis Fungorum 1). Fungiflora, Oslo, 535 pp.

MYCOTAXON

Volume 95, pp. 305-308 January-March 2006

Tricholoma lavendulophyllum,
a new species from Yunnan, China

Fu-QIANG Yu?”, YUN WANG? & PEI-GuI1 Liu’

fayu@mail.kib.ac.cn
"Kunming Institute of Botany, Chinese Academy of Sciences
Kunming 650204, China

?Graduate School of Chinese Academy of Sciences
Beijing 100039, China

*Shenyang Institute of Applied Ecology, Chinese Academy of Sciences
Shenyang 110016, China

Abstract—A new species of Tricholoma from the matsutake group, Tricholoma
lavendulophyllum, is described and illustrated from Yunnan, China. It is characterized
by its lavender lamellae and sweetish-aromatic smell resembling T. matsutake. The
relationship of the new species to other closely related species is discussed.

Keywords—Matsutake, mushroom, taxonomy

Introduction

Tricholoma matsutake (S. Ito & S. Imai) Singer, commonly known as “Matsutake” or
pine mushroom, is one of the most precious edible mushrooms in the world. There are a
few closely related species, such as T. bakamatsutake Hongo, T. caligatum (Viv.) Ricken
and T: magnivelare (Peck) Redhead, that are generally included in “Matsutake” (Wang et
al., 1997). Although some taxonomical work has been done on this group (Zeller, 1934;
Hotson, 1940; Hongo, 1960, 1974; Smith, 1979; Kytévuori, 1989), it is still insufficiently
known, especially from China (Zang, 1990; Cao et al., 2003). In the fall of 2005, two
collections of matsutake similar to T: bakamatsutake were obtained from Kunming wild
edible mushroom markets. Careful examination of these two collections resulted in the
description of a new species, T: lavendulophyllum.

Materials and Methods

Macroscopic characters were taken from fresh specimens. Descriptions of microscopic
characters were observed under a Nikon E400 microscope with light and phase-contrast
optics. Sections were made with a razor blade under the stereomicroscope, mounted

* Author for correspondence

306

in 5% KOH, and Melzer’s solution, and then illustrated under the light microscope,
with the aid of a drawing tube. Specimens examined were deposited in the Cryptogamic
Herbarium of Kunming Institute of Botany, Academia Sinica (HKAS).

Taxonomy

Tricholoma lavendulophyllum F.Q. Yu, sp. nov. Fig. 1-4

Pileus 45-70 mm latus, subumbonatus vel convexus, margine involuto dein recto; castaneo .
in centro, subcremeo ad marginem, fibrilloso. Lamellae lavandulus, adnatae vel subliberae.
Stipes 80-95 x 12-15 mm, annulato, aequali vel basi incrassato, supra annulum albo, infra
annulum pileo concolore, fibrilloso castaneo squamosoque. Carne alba, odor fragrans sicut
in T. bakamatsutake. Basidia clavata, 40-50 x 7.5-15 um; basidiosporae (5.5) 6-7.5 x (4.5)
5-5.5 (6) um, late ellipsoideae.

Etymology—The specific epithet refers to the lavender-coloured lamellae

Pileus 45-70 mm broad, hemispherical to convex when young, becoming subumbonate
to plano-convex when mature; surface slightly viscid when wet, chestnut brown to
fuscous in the center, with appressed dark brown zoned scales, often becoming broken
up into rather indistinct pieces; margin brown to whitish brown, inrolled when young.
Context thick in the center, thin toward the margin, compact, white, taste sweetish.
Aroma resembling T: matsutake, but stronger and with a slight smell of honey. Lamellae
adnate, sinuate or arcuate, then separating from stem, pale to creamy lavender, with some
lamellulae. Stipe 80-95 x 12-15 mm, equal or enlarged at the base, with an persistent
but inconspicuous annulus on the upper part, 1.5-2.2 cm downward from the lamellae;
concolorous with the pileus below the ring, with dark brown, appressed scales, whitish
above the ring. Context white, solid, compact.

Pileipellis a layer of interwoven and thin-walled hyphae, 5-13 um in diam., light
yellowish brown, terminal elements subclavate to clavate, 7.5-9 x 22.5-67.5 um. Lamellar
trama subparallel, hyphae mostly 3-12 um in diam., thin-walled, hyaline. Basidia 40-50
x 7.5-15 um, clavate, hyaline, 4-spored, rarely 2- and 1-spored, sterigmata 2-5 um long.
Cystidia absent, but some clavate free hyphal ends present at the gill edge. Basidiospores
(5.5-) 6-7.5 x (4.5-) 5-5.5 (-6) um, Q= (1.18-) 1.25-1.33, broadly ellipsoid, thin-walled,
hyaline, smooth, inamyloid. Stipitipellis with longitudinally arranged, appressed, parallel
hyphae, 4-12 um in diam., thin-walled, whitish brown to yellowish brown, terminal
elements scattered, cylindrical, 6.8-9 x 30-54 um, periclinally arranged.

Ecology: unknown.

Specimens examined—CHINA. YUNNAN PROVINCE: Kunming City, Aziying, wild
edible mushroom market, 05 Aug. 2005, F. Q. Yu 1310B, HKAS49796; Kunming City,
Wujing Road, wild edible mushroom market, 23 Jul. 2005, F Q. Yu 1273, HKAS49804
(Holotype).

Notes—-T. lavendulophyllum strongly resembles T: bakamatsutake in its appearance
and aroma. It is sold as T. bakamatsutake at wild edible mushroom markets in
Yunnan, China, but T. lavendulophyllum can be distinguished by its creamy lavender
lamellae, and the absence of ventricose or flask-shaped cheilocystidia (Hongo, 1974).
T. fulvocastaneum Hongo is another similar species to T. lavendulophyllum but differs in

307

Figs 1-4: Tricholoma lavendulophyllum, HKAS49804 (Holotype).
1. Basidiocarps; 2. Hymenium; 3. Basidiospores; 4. Section through pileipellis

wigs

308

lacking of matsutake aroma, having whitish lamellae and a tapered base (Hongo, 1960).
This species also resembles T. caligatum but the latter has whitish lamellae, relatively
narrow spores, and a sweetish-bitterish to bitter taste (Kyt6vuori, 1989).

Acknowledgements

The authors wish to thank Dr. H. Knudsen of Copenhagen University, Dr. C. L. Ovrebo of University
of Central Oklahoma, and Mr. E. Nagasawa of Tottori Mycological Institute for serving as pre-
submission reviewers and for their valuable comments and suggestions. This project is partially
supported by National Geographic Society of America (C56-04), Natural Science Foundation of
Yunnan Province (2004C0050M), and National Natural Science Foundation of China (30470011).

Literature Cited

Cao ZM, Yao YJ, Pegler, DN. 2003. Tricholoma zangii, a new name for T. quercicola M. Zang
(Basidiomycetes: Tricholomataceae). Mycotaxon 80: 159-164.

Hongo T. 1960. Notes on Japanese larger fungi (15). Journ. Jap. Bot. 35(3): 83-89.

Hongo T. 1974. Notes on Japanese larger fungi (21). Journ. Jap. Bot. 49(10): 294-304.

Hotson HH. 1940. The genus Armillaria in Western Washington. Mycologia 6: 776-790.

Kytovuori I. 1989. The Tricholoma caligatum group in Europe and North America. Karstenia 28:
65-77.

Smith AH. 1979. The Stirps caligata of Armillaria in North America. Sydowia Beih. 7: 368-377.

Wang Y, Hall IR, Evans LA. 1997. Ectomycorrhizal fungi with edible fruiting bodies I. Tricholoma
matsutake and related fungi. Economic Botany 51: 311-327.

Zang M. 1990. A taxonomic and geographic study on the Songrong (matsutake) group and its
allied species. Acta Mycologica Sinica 9(2): 113-127.

Zeller SM, Togashi K. 1934. The American and Japanese matsutake. Mycologia 26: 544-558.

MYCOTAXON

Volume 95, pp. 309-313 January-March 2006

Changes and additions to the North American lichen mycota - V

KERRY KNUDSEN

kk999@msn.com
Herbarium, Botany e& Plant Sciences Department
University of California, Riverside
Riverside, CA, 92521-0124, USA

JAMES C. LENDEMER

lendemer@acnatsci.org
Lichen Herbarium, Department of Botany
The Academy of Natural Sciences of Philadelphia
1900 Benjamin Franklin Pky., Philadelphia, PA, 19103, USA

Abstract - Lecanora utahensis is placed in synonymy with Lecanora peltasticoides. A
new combination is made: Placopyrenium stanfordii. Dermatocarpon zahlbruckneri
(syn. Catapyrenium zahlbruckneri; Placopyrenium zahlbruckneri) is placed in synonymy
with P. stanfordii. Usnea cristatula and Cercidospora xanthoriae reported new to North
America.

1. Cercidospora xanthoriae (Wedd.) R. Sant., The Lichens and Lichenicolous Fungi of
Sweden and Norway. p. 57. 1993.

Cercidiospora xanthoriae is known from Fennoscandia (Santesson 1993), Macaronesia
(Hafellner 2002) and Europe (Sérusiaux et al. 1999). It is reported as new to North
America, parasitic on Xanthomendoza fallax (Hepp ex Arnold) Sochting et al., in
California. Javier Etayo verified the determination by the first author. The species usually
has four strongly heteropolar spores per ascus.
USA. CALIFORNIA. SAN DIEGO CO.: Warner Hot Springs, Warner Hot Spring Ranch,
33°17'07” N, 116°37'31”W, elev. 1001 m., on Xanthomendoza fallax growing on Quercus
agrifolia, Knudsen et al. 3900 (UCR, hb. Etayo).

2. Lecanora peltasticoides Hasse, The Bryologist, 17: 63. 1914. TYPE: USA, California,
Riverside County, Palm Springs, on granite, 1901, H.E. Hasse 861 (FH! holotype).
Syn. nov. Lecanora utahensis H. Magn., Acta Horti Gothob., 19(2): 39. 1952. TYPE: USA.
Utah, Wayne County, Ekker’s Ranch, on dry exposed sandstone, 6000 ft., S. Flowers
359 (UPS, holotype; MIN! isotype).

Hasse (1914) published Lecanora peltasticoides based on a single collection made in
1901 in Palm Springs, California. The specific name refers to the similarity of the species

310

to Acarospora peltastica Zahlbr., a synonym of Acarospora strigata (Nyl.) Jatta, which is
common in the Palm Springs area.

Magnusson saw the holotype of L. peltasticoides in 1926 and annotated it as a
Lecanora. By the fifties, he had long since forgotten the Hasse taxon and while studying
the Utah lichen collections of the bryologist S. Flowers he re-described the species
as Lecanora utahensis (Magnusson 1952). The holotype, according to Sliwa (Ryan et
al 2004), is a poor fungus-infected specimen. But Sliwa expressed the opinion that
southwestern collections represented the same species as Magnusson’s holotype. The
isotype of L. utahensis at MIN was given to Clifford Wetmore by Flowers and is a much
better specimen than the holotype. Sliwa also reviewed the isotype and verified it as L.
utahensis. The first author's examination of the isotype reveals it is conspecific with the
holotype of L. peltasticoides.

During the work on the Lecanora treatment for the Sonoran flora project the holotype
of L. peltasticoides was not seen by Sliwa. While on loan to ASU it was placed with the
specimens for the Acarospora treatment based on William Weber’s erroneous annotation
of the specimen as “Acarospora smaragdula mod. strigata oligospora”. Correcting the
placement of the species in Acarospora, Knudsen (2003) recognized L. peltasticoides as a
distinct species in need of further taxonomic study. The name thus appears in the most
recent edition of the North American Checklist (Esslinger 2005).

Reexamination of the holotype of L. peltasticoides by the first author for Bjorn Owe-
Larsson, to exclude the possibility that it represented a species of Aspicilia, revealed that
it matched a collection of L. utahensis (Knudsen 3448, UCR!) from the San Bernardino
Mountains of southern California. Subsequent examination of the isotype of L. utahensis
revealed it to represent L. peltasticoides. Thus L. utahensis is here placed in synonymy
with L. peltasticoides.

The thallus of L. peltasticoides is formed of chalky white areoles with immersed or
sessile apothecia that are a red-brown. ‘The ascospores are simple and hyaline, 13.3-16.3
x 5.9-7.4um. For a full description by Sliwa see Ryan et al. (2004). The species has been
collected on sandstone, granite, soil, and limestone, and occurs throughout western
North America (Ryan et al. 2004), though it is infrequently collected. Growing in areas
where A. strigata is common, L. peltasticoides is probably under-collected because of its
superficial resemblance to the Acarospora.

3. Placopyrenium stanfordii (Herre) K. Knudsen, comb. nov.

Verrucaria stanfordii Herre, Proceedings of the Washington Academy of Sciences, 12: 42-
43. 1910. TYPE: USA, California, on rocks in the foothills of Stanford University, one
and a half miles back of Mayfield, 150 ft., A.C.T. W. Herre 146 (F!, lectotype designated
here).

Syn. nov. Dermatocarpon zahlbruckneri Hasse, Bryologist, 16:2. 1913. TYPE: USA, Los
Angeles, on trap rock in Topanga Canyon, Santa Monica Range (FH, holotype)

Catapyrenium zahlbruckneri (Hasse) J.W. Thomson, Bryologist 90: 38. 1987.

Placopyrenium zahlbruckneri (Hasse) Breuss in Nash et al., Lichen Flora of the Greater
Sonoran Region, 1: 396-397. 2002.

Herre (1910) published Verrucaria stanfordii based on a specimen collected in the
Santa Cruz Mountains in Santa Cruz County in central California. After its description

by Herre, V. stanfordii was forgotten. Hasse (1913) published the same species under
the name Dermatocarpon zahlbruckneri three years later, perhaps unaware of Herre’s
specimens or their possible relevance with regard to his own lichen.

Later revisions of genera of Verrucariaceae placed in Dermatocarpon adopted Hasse’s
name for the taxon instead of Herre’s name. In his revision of Catapyrenium, Thomson
(1987) tranferred D. zahlbruckneri to Catapyrenium, based on the study of the holotype
in the Farlow Herbarium (FH). When Breuss (2002) revised Placopyrenium in the
Sonoran Desert region he transferred C. zahlbruckneri to Placopyrenium.

Recently, the first author (KK) reviewed the type of V. stanfordii and discovered
it to be conspecific with P zahlbruckneri. Agreeing with Breuss’ circumscription of
Placopyrenium from the related genera Verrucaria and Catapyrenium, but respecting the
priority of Herre’s original description, the new combination Placopyrenium stanfordii is
made here. Dermatocarpon zahlbruckneri and its synonyms (Catapyrenium zahlbruckneri
and Placopyrenium zahlbruckneri) are placed in synonymy with P. stanfordii.

For a description of Verrucaria stanfordii see Breuss (2002) under the name
Placyopyrenium zahlbruckneri. The species is common in small populations mixed
with other crustose lichens in southwestern North America. The specimen selected
here as the lectotype was marked as a “co-type” but we have not been able to locate
another specimen (and only one collection was cited in the protologue). Since the above
annotation calls into question the status of the specimen as the holotype we have chosen
to designate it as a lectotype to avoid ambiguity in the application of the name.

It should be noted that the epithet was originally published as “stanfordi’. The epithet
should be spelled “stanfordii” This orthographic error is corrected in the above new
combination.

In his study of the lichen flora of Reno, Nevada, Herre (1911) reported V. stanfordii.
Two specimens determined as V. stanfordii by Herre from Nevada were examined by
the first author. The first collected at 5000 feet in Reno on March 5, 1910 (F!) and the
second, collected in Marmol, Nevada, on April 30, 1910 (F!), are not Placopyrenium
stanfordii but belong to the similar-looking Verrucaria inficiens group. The collections
are characterized by subglose ascospores 10-13 x 7-9um, evidence of being parasitic on
two different lichen species (one a brown Acarospora), and as well as a broadly attached
thallus (smaller than P stanfordii). These collections correspond well with a new species
of Verrucaria to be described by Breuss (in prep.) from the San Bernardino Mountains
in southern California. Every specimen determined as Verrucarria stanfordii by Herre
should thus not automatically be assigned to Placopyrenium stanfordii.

4, Usnea cristatula Motyka, Lich. Gen. Usnea Stud. Monogr. Pars Syst. 2(2): 643. 1938.
| TYPE: Mexico, Michaocan, Morelia, Cerro Azul, elev. 3300 m, A. Brouard (LBL, holotype).

While revising A.W. Evans’ collections of short apotheciate Usnea specimens for a revision
the Usnea strigosa group (Lendemer & Ohmura in prep.) the second author enczountered
specimens of a taxon unrelated to U. strigosa (Ach.) Eaton. Though superficially similar
to U. strigosa, the thalli contained diffractaic acid (TLC!) and a pink medullary pigment
like that of U. ceratina Ach. The specimens had been erroneously identified by Herre and
Motyka (one each) as U. strigosa. Since both collections were from Texas, USA it seemed

likely that the material represented a South/Central American taxon that reached the
northern edge of its distribution in Texas. Examination of the available names led to the
conclusion that the material represents U. cristatula, a species originally described from
Michoacan, Mexico. The species is here reported for the first time from North America.
The presence of diffractaic acid in the medulla as well as the medullary pigment easily
separates this species from any other apotheciate taxon in North America and we hope
that this report stimulates a search for modern collections from the region.
USA. TEXAS. [without county]: without locality, Lindheimer s.n. (NY); Guadalupe River
region, i.1931, sine legit 76 (YU!). ATASCOSA CO.: low Celtis-live oak woods along
Atascosa Creek, 7 miles north of Jourdanton along Texas 346, 12.vii.1963, Pursell 5912
(NY). BEXAR CO.: mesquite woods, 18 miles east of San Antonio, 17.v.1940, Hubricht
B-1890 (F!, YU!).

Acknowledgments

We thank the following for helpful discussions, criticism and searching for specimens in other
herbaria: Othmar Breuss, Robert Liicking, Clifford Wetmore, and Richard C. Harris. We also
thank the curators of the following herbaria for loaning material cited herein: K FH, MIN, and YU.
We thank Javier Etayo for his verification of Cercidospora xanthoriae, Scott Eliason and Chris L.
Wagner of the U.S. Forest Service for facilitating work in the San Bernardino Mountains, and Char
Glacy and Nancy Nenow.

Literature Cited

Breuss, O. 2002. Placopyrenium. In: Nash II TH, Ryan BD, Gries C, and Bungartz F (eds.): Lichen
Flora of the Greater Sonoran Desert Region. I. Lichens Unlimited, Arizona State University,
Tempe, Arizona, pp. 393-397.

Breuss, O. In prep. Verrucaria. In: Lichen Flora of the Greater Sonoran Desert Region, vol. 3.

Esslinger, TL. 2005. A cumulative checklist for the lichen-forming, lichenicolous and allied fungi
of the continental United States and Canada. North Dakota State University: http://www.ndsu.
nodak.edu/instruct/esslinge/chcklst/chcklst7.htm. Fargo, North Dakota.

Halfellner, J. 2002. Bemerkenswerte Funde von Flechten und lichenicolen Pilzen auf
makaronesischen Inseln VI. Uber einige Neufunde. Fritschiana, 36: 11-17.

Hasse, HE. 1913. Additions to the lichen flora of southern California. VIII. Bryologist, 16: 1-2.

Hasse, HE. 1914. Additions to the lichen flora of southern California. No. 9. Bryologist, 17: 61-63.

Herre, AWCT. 1910. The lichen flora of the Santa Cruz Peninsula, California. Proceedings of the
Washington Academy of Sciences, 12: 27-269.

Herre, AWCT. 1911. The desert lichens of Reno, Nevada. Botanical Gazette, 51: 286-297.

Knudsen, K. 2003. Type specimens: investigations and observations. Bulletin of the California
Lichen Society, 10(2): 36-38.

Magnusson, AH. 1952. New crustaceous lichen species from North America. Acta Horti
Gotoburgensis, 19(1): 31-49.

Ryan, BD., Lumbsch HT., Messuti MI., Printzen C., Sliwa L., and Nash III TH. 2004. Lecanora. In:
Nash III TH, Ryan BD, Diederich P, Gries C, and Bungartz F (eds.): Lichen Flora of the Greater
Sonoran Desert Region, Vol. 2. Lichens Unlimited, Arizona State University, Tempe, Arizona,
pp. 176-286.

Santesson, R 1993. The Lichens and Lichenicolous Fungi of Sweden and Norway. SBT-forlaget,
Lund. 240 pp.

Sérusiaux, E., Diederich, P., Brand, AM., and van den Boom, P. 1999. New or interesting lichens and
lichenicolous fungi from Belgium and Luxembourg. VIII [Lichens et champignons nouveaux
ou interessants pour la flore de la Belgique et du G.-D. de Luxembourg. VIII]. Lejeunia, 162:
1-95.

Thomson, JW. 1987. The lichen genera Catapyrenium and Placidiopsis in North America. Bryologist,
90: 27-39.

MYCOTAXON

Volume 95, pp. 315-318 January-March 2006

Four new lichens from Turkey

KENAN YAZICI*

kcagri_1997@ yahoo.com
Karadeniz Technical University, Giresun Science and Art Faculty
Biology Department, Giresun, Turkey

ALI ASLAN

aliaslan@atauni.edu.tr
Biology Department, Kazim Karabekir Education Faculty
Atatiirk University, Erzurum, Turkey

Abstract—Four species of lichenized fungi, Acrocordia cavata, Cladonia awasthiana,
Parmelinopsis afrorevoluta and Usnea silesiaca, are reported new to the lichen flora of
Turkey. For each, a short description is presented.

Key words— Ascomycetes, biodiversity, Giresun, Giimtishane, Trabzon, Zonguldak

Interest in the lichen flora of Turkey has greatly increased in recent years (Aslan 2000,
Aslan et al. 2002a,b, John 1995, 1996a,b, John & Breuss 2004, John et al. 2000, Yazici
& Aslan 2002, 2003, 2005, Yazici et al. 2004, 2005). This present paper is a further
contribution to these works.

The present report is based on collections in the three different provinces of Giresun,
Gimiishane and Trabzon between 12 October 1999 and 10 August 2005. A stereo
microscope, a light-microscope and the usual spot tests were used in the identification
of the samples, together with the following references: Ahti & Upreti (2004), Clerc (1991,
1997), Halonen et al. (1988), Louwhoff & Elix (2002) Purvis at al. (1992). Acrocordia
cavata has been stored in the herbarium of Kazim Karabekir Faculty of Education,
Biology Department of Atatiirk University, Erzurum and the others in the herbarium of
Biology Department, Giresun Science and Art Faculty, Karadeniz Technical University.

Results

Acrocordia cavata (Ach.) R.C. Harris

Thallus crustose, immersed, grey—white, cortex absent. Photobiont Trentepohlia.
Perithecia 0.2-0.7 mm _ diam., half-immersed, brown-black, involucrellum
hemispherical, colourless-pale brownish exciple. Ostiole mostly eccentric and rarely
papillate. Hamathecium of persistent, slender, sparingly branched or anastomosing,

316

long-celled paraphysoids; no periphyses. Ascus 8-spored, cylindrical, fissitunicate; apical
dome consiting of a broad ocular chamber surmounted by a hemispherical, meniscus-
like structure, Ascospores uniseriate, colourless, elipsoid, the ends usually rounded, 1-
septate, the median septum thick, 10-16 (-16.5) x 5.5-9.5 um. Pycnidia absent.

This species normally grows on Ilex and Corylus. North America and Europe
(Belgium, Germany, Sweden, Estonia, Norway, England, Netherlands, Luxemburg,
France, Scotland, Slovenia, Spain).

Giresun: Kesap-Karabulduk, Camlica village, on Corylus avellana, at 1100 m, 40° 50’ 50”
N, 38° 32’ 30” E, 12 October 1999, Aslan 1270.

Cladonia awasthiana Ahti & Upreti

Primary thallus evanescent, consisting of very small (0.4-2.1 x 0.4 mm), crenate
squamules bearing granules, sometimes squamules patches present from basal up
to cups but mostly only basal portion of potedia. Podetia 35-45 mm tall, 2-2.5 mm
across, 0.2-0.5 mm thick, grey to brownish, sometimes dichotomously branched, often
proliferate from margins, axils mostly closed; surface + corticated at the very base but
otherwise ecorticate, consisting of granular soredia and microsquamules; soredia from
basal up to cups. Podetial wall 220-270 tm, medulla 70-90 um, surface of central
canal minutely papillulate. Hymenial discs brown. Conidiomata mostly not common,
terminal, clearly constricted at the base. K-, P+ red, UV+ white; fumarprotocetraric
acid (major), homosekikaic acid (major), confumarprotocetraric and protocetraric
acids (minor).

This species normally grows on bare, humous soil in the middle and upper Himalayan
forested slopes, both in the Western and Eastern Himalayan Regions in India, at the
elevations of 950-2800 m. Recorded before from the Indian states Arunachal Pradesh,
Himachal Pradesh, Jammu & Kashmir, Sikkim, Iran and Uttaranchal (Ahti and Upreti
2004).

Zonguldak: Caykéy, mainroad, on the mosses, 75 m, 41°22” N, 32°00” E, 10 August
2005, Yazici 1269.

Parmelinopsis afrorevoluta (Krog & Swinscow) Elix & Hale

Thallus grey, grey—white, some parts olive-green, loosely adnate, 4-12 cm wide. Lobes
mostly abundant, subimbricate, sublinear, irregularly branched, to 3 mm wide; margins
more or less entire or dentate, rarely irregularly incised, sometimes + revolute, like
slightly burned and wavy appearance, ciliate; cilia simple or partly forked, c. 1-1.2 mm
long; cilia tips subrotund to subtruncate; granular soralia submarginal or in some parts
laminally and pustular. Lower surface dark black and lobe margins mostly brown or
rarely dark black, smooth to rugulose and with abundant rhizines; rhizines simple or
bifurcate, to 2-2.5 mm long. Apothecia and pycnidia not seen. Medulla K-, P-, C+ rose,
KC+ red; cortex C+ yellow; containing atranorin (minor), chloroatranorin (minor),
gyrophoric acid (major), lecanoric acid (minor), 4, 5-Omethylhiascic acid (minor),5-
O-methylhiascic acid (minor).

Grows in the warm-temperate and tropical regions of both hemispheres. Its
distribution extends to Papua New Guinea, where it is uncommon, corticolous, occurring

in disturbed and undisturbed montane forest at 1600-3600 m altitude. Known Australia,
Ethiopia, Tanzania, Eastern North America and Sweden. (Elix 1994).

Trabzon: Diizkéy; Beypinar high plateau, on siliceous rock, at 700 m, 40° 48’ N, 39° 20°
E, 15 August 2004, Yazici 1273.

Usnea silesiaca Motyka

Thallus mostly pendulous (one of the specimens is subpendulous and partly shrubby),
to 10 cm long (length of three samples are 6, 8 and 10 cm respectively), light-green or
slightly yellow-green; cortex consisting of many annular cracks especially towards the
base; base dark black, but black—brown base onwards to 2-3 cm.; cortex thick (10-20%
of radius), K + red, C-, P-; medulla white, or sometimes slightly brown, compact, thin
(9-15% radius), K+ red, P+ yellow, C-. Pseudocyphellae and soralia on cortex, soralia
abundant, raised, confluent (but rare or absent on some branches, sometimes especially
towards near the tips), mostly tuberculate, partly excavate and mostly larger than % of
the branch diameter, K—, C—, P—. Isidia seen when young. Papillae generally indistinct.
Branches are mostly isotomic and dichotomic, but anisotomic mostly near the tips.
Thallus containing salazinic acid and accessory protocetraric and constictic acids.
Normally grows on conifers and deciduous trees, shrubs and hardwoods in open,

humid forests at lower elevations. Common in humid coastal areas of North America
(along the Pacific Northwest coast from Alaska and British Columbia south to California)
and Europe (including Macaronesia, Austria, England, France, Netherlands Norway,
Poland, Romania and Scotland) (Clerc 1991, 1997; Halonen et al. 1998)

Gumushane: Kiirtiin; Cikrikdiizii high plateau, “Oriimcek forests” on Picea orientalis,

1900m., 40° 35’ 30” N, 39° 03°30” E, 02 June.2001, Yazici 1271.

Acknowledgements

We are grateful to Dr. André Aptroot and Dr. Javier Etayo for linguistic revision and helpful
comments on an earlier draft of this paper and would like to thank Dr. André Aptroot for the
identification and verification of Acrocordia cavata, Professor Teuvo Ahti for Cladonia awasthiana,
Professor Jack A. Elix for Parmelinopsis afrorevoluta and Dr. Philippe Clerc for Usnea silesiaca.

References

Aslan A. 2000: Lichens from the Regions of Artvin, Erzurum and Kars (Turkey). Israel J. Plant Sci.
48: 143-155.

Aslan A, Yazici K, Karagéz Y. 2002a: Lichen Flora of the Murgul District (Artvin, Turkey) Israel J.
Plant Sci. 50: 77-81.

Aslan A, Aptroot A, Yazici K. 2002b: New lichens from Turkey. Mycotaxon 84: 277-280.

Ahti T, Upreti DK. 2004: Two new species of Cladonia (Lecanorales) from the Himalayas. Biblioth.
Lichenol. 88: 9-13.

Clerc P. 1991: Usnea maderiensis Mot. (ascomycete lichénisé): une espece meconnue de l'Europe et
de l Amérique du Nord. Candollea 46: 427-438.

Clerc P. 1997: Notes on the genus Usnea Dill. ex Adanson. Lichenologist 29: 209-215.

Elix JA. 1994: Hypotrachyna. Flora of Australia 55: 49-59.

318

Halonen P, Clerc P, Goward T, Brodo IM, Wulf K. 1988 : Synopsis of the Genus Usnea (Lichenized
Ascomycetes) in British Columbia, Canada. The Bryologist 101(1): 36-40.

John V. 1995: Flechten der Turkei IV. Erginzungen zum die Tiirkei betreffende lichenologische
Schrifttum. Neunkirchen.

John V. 1996a. Preliminary catalogue of lichenized and lichenicolous fungi of Mediterranean
Turkey. Bocconea 6: 173-216.

John V. 1996b. UTM-grid-mapping and distribution patterns of lichens in Turkey.- In Oztiirk,
M.A., Seg¢men, O & Gérk, G (eds.). Plant life in southwest and central Asia. Proceedings of.
4" Plant life of Southwest Asia Symposium. 21-28 may 1995. izmir: Ege Univ. Press. Bornova
Izmir: 440-453.

John V, Seaward M.R.D, Beatty J.W. 2000. A neglected lichen collection from Turkey. Berkamsted
School expedition 1971. Turk. J. Bot. 24: 239-248.

John V, Breuss O. 2004: Flechten der Ostlichen Schwarzmeer-Region in der Tiirkei (Blam-Exkursion
1997). Herzogia 17: 137-156.

Louwhoff SHJJ, Elix JA. 2002: Hypotrachyna (Parmeliaceae) and allied genera in Papua New
Guinea. Bibliotth. Lichenol. 81: 1-150.

Purvis OW, Coppins BJ, Hawksworth DL, James PW, Moore DM. 1992: The Lichen Flora of Great
Britain and Ireland. Natural History Museum & British Lichen Society, London.

Yazici K, Aslan A. 2002: New records for the lichen flora of Turkey. Turk. J. Bot. 26: 117-118.

Yazici K, Aslan A. 2003: Lichens from the Regions of Giimiishane, Erzincan and Bayburt (Turkey).
Cryptogamie, Mycol. 24: 287-300.

Yazici K, Aslan A. 2005: Six new lichen records from Turkey. Mycotaxon 93: 359-363

Yazic1 K, Aslan A, Aptroot A. 2004: Four new lichen species from Turkey. Mycotaxon 90:
177-180.

Yazici K, Aslan A, Aptroot A. 2005: New lichen records from Turkey. Mycotaxon 92: 341-344.

Volume 95, pp. 319-322 January-March 2006

Two new species in the genus Morchella
(Pezizales, Morchellaceae) from China

SHU-HonG LI’, YONG-CHANG ZHAO”?,
HoNG-MEI CHAI? & MING-HuI ZHONG?!

'Imorelsh@yahoo.com.cn *yczhao@public.km.yn.cn*
°chm722@km169.net ‘yaasmushroom@yahoo.com.cn

Yunnan Key Lab of Agricultural Biotechnology
Kunming 650223, P. R. China

Abstract—Two new species of Morchella, M. meiliensis and M. degqinensis, collected
from Yunnan, China are described and illustrated. The relationship of these two new
species to other closely related species is discussed.

Key words— morel, ascocarp, taxonomy

Introduction

One thousand and thirty specimens of Morchella were collected from southwestern
China and examined in the recent years. A total of ten species were identified, including
two new species collected from Deqin County, Yunnan Province. Descriptions and
illustrations of the two species, M. meiliensis and M. deginensis, and comparisons with
other morel species are provided below.

Taxonomy

Morchella deqinensis Shu H. Li, Y.C. Zhao, H.M. Chai & M.H. Zhong, sp. nov.
Fig. 1 a-f
Ascomata 5.2-9.5 cm alata, intus excavata. Capitulae 2.3-4.3 x 1.8-3.2 cm, ovoideae
vel subconicae. Stipes conicus, cavus, 2.6-5.8 x 0.8-3.0 cm. Asci cylindricei, paraphysati,
8-spori, 9.91-10.49 x 105-148.65 um. Sporidia elliposideo vel ovoideae, 6.4-8.1 x
9.2-9.6 um.

Etymology: the specific epithet refers to the location of the holotype collected.

Ascomata 5.2-9.5 cm tall, hollow, with pileus completely attached to the stipe; pileus
2.3-4.3 x 1.8-3.2 cm, egg-shaped, sometimes broadly conical; ribs sparse and vertically

*Corresponding author

320

arranged, dark greenish-brown; pits irregular quadrilateral, 2-3 times longer in length
than in width, creamy or pale creamy, with many tiny crystals on the surface under
stereomicroscope; context thin, firm, creamy or pale creamy; odor and taste not
distinctive. Stipe 2.6-5.8 x 0.8-3.0 cm, hollow, conical, tapering, about 1/3-1/2 of the
top, whitish when young, becoming dark rust when mature or dried, with white granules
at the top and grooves at the base.

Hymenium 6-10 um thick, hyaline, parenchyma, the bottom flattened; asci 9.91-
10.49 x 105-148.65 um, hyaline, cylindrical, circular on apex, 8-spored, single-space
arranged, coming forth a circular orifice (8.5-9.0 um in diameter) and a hemisphere
cap on the apex and freeing ascospores from the orifice at maturity; ascospores
6.4-8.1 x 9.2-9.6 tm, hyaline, smooth, ellipsoid to ovoid, without oil droplets, thin-
walled, spore print creamy; paraphyses 3.59-4.50 x 43.38-43.42 um, hyaline, club-
shaped, witha septum on the base.

Holotype: CHINA, Yunnan, Deqin County, Xiaruo, alt.2800-3200 m, on the ground
under coniferous or mixed forests, 20 April, 2005, Shu.H. Li (YKLAB, Yunnan Key Lab
of Agricultural Biotechnology, Yunnan, China) YKLAB1002.

Fig.1—Morchella deginensis (YKLAB1002). a. Ascospore. b-c. Germinating ascospores.
d. Paraphysis. e. Ascus with ascospores. f. Fruiting body.

a VA

Morchella meiliensis Y.C. Zhao, Shu H. Li, H.M. Chai & M.H. Zhong, sp. nov.
Fig. 2 a-e
Ascomata 6.0-8.5 cm alata, intus excavata. Capitulae 3.5-4.8 x 1.2-2.0 cm, conicae. Stipes
cylindricus, cavus, 2.3-3.5 x 0.8-2.0 cm. Asci cylindrcei, paraphysati, 8-spori, 5.18-5.87 x
91.16-94.44 um. Sporidia elliposideo-oblonga, 4.67-5.10 x 5.20-5.66 um.

Etymology: the specific epithet refers to the location of the holotype collected.

Ascomata 6.0-8.5 cm tall, hollow, completely attached to the stipe; pileus 3.5-4.8 x
1.2-2.0 cm, conical; ribs sparse and vertically arranged, dark brow to black; the
hymenium of between the ridges merulioid; pits irregular-quadrilateral or rectangle,
creamy to yellowish; context thin, firm when drying; odor and taste not distinctive. Stipe
2.3-3.5 x 0.8-2.0cm, whitish when fresh becoming waxy yellow when dry, cylindrical,
with white granules at the top and grooves at the base.

Hymenium 8-15 um, hyaline or pale, parenchyma, the bottom slightly wavy; asci
5.18-5.87 x 91.16-94.44 um, hyaline, cylindrical, circular on the apex, 8-spored, single-
space arranged; ascospores 4.67-5.10 x 5.20-5.66 um, hyaline, smooth, ellipsoid, with
oil droplets, thin-walled, swollen and darkening when germinating; spore print creamy;
paraphyses 4.19-5.20 x 40.09-65.01 um, dark, club-shaped.

Holotype: CHINA, Yunnan, Deqin County, Meili Snow Mountain, alt.2800-3500m, on
the ground under broadleaf forests or mixed forests, 13 May, 2005, Y.C. Zhao (YKLAB,
Yunnan Key Lab of Agricultural Biotechnology, Yunnan, China) YKLAB1080.

Fig.2—Morchella meiliensis (YKLAB1080). a. Paraphyses. b. Ascus. c. Germinating ascospores.
d. Pores (under stereo-microscope). e. Fruiting body.

Byte

Discussion

M. deqinensis resembles M. umbrina Boud. (Huang 1998, Mao 2000) but differs in its
tapering stipe with white granules and grooves at the base. Also M. umbrina has smaller
pits and a deeper color than M. deqinensis.

M. meiliensis is closely related to M. angusticeps Peck (Bi 1994, Zang 1996, Mao 2000,
Kuo 2005) and M. conica Pers. (Zang 1996, Huang 1998, Mao 2000). The merulioid
hymenium, lighter colored ribs, and club-shaped paraphyses distinguish M. meiliensis
from the other two species.

Acknowledgements

We would like to thank Profs. Yun Wang (Crop & Food Research, New Zealand) and Xin-Chang
Luo (Department of Plant Protection, Huazhong Agricultural University) for paper review and
good advice in English writing. This study was supported in part by Opening Grant of Shanghai
Key Lab of Agricultural Genetics and Breeding (Shagb2005-02).

Literature Cited

Bi ZS, Zheng GY, Li TH. 1994. Macrofungi in Guangdong. Guangdong Science & Technology
Press, Guangzhou.

Chen JY, Liu PG. 2005. A new species of Morchella (Pezizales, Ascomycota) from southwestern
China. Mycotaxon 93: 89-93.

Huang NL. 1998. Colored Illustrations of Macrofungi of China. China Agricultural Press, Beijing.

Kuo M. 2005. The black morels. Retrieved from the MushroomExpert.Com web site:
http://www.mushroomexpert.com/morchella_angusticeps.html

Kuo M. 2005. The Morchellaceae: True morels and verpas. Retrieved from the Mushroom Expert.
Com Web site: http://www. mushroomexpert.com/morchellaceae.html

Mao XL. 2000. The Macrofungi in China. Henan Science and Technology, Zhengzhou.

Zang M. 1996. Fungi of the Hengduan Mountains. Science Press, Beijing.

MYCOTAXON

Volume 95, pp. 323-330 January-March 2006

Notes on some species of the lichen genus
Lecidea from India

D.K. UpRETI*, S. NAYAKA?
& M.P ANDREEV’

*upretidk@rediffmail.com
'Lichenology Laboratory, National Botanical Research Institute, Rana Pratap Marg
Lucknow - 226 001, India

?Komarov Botanical Institute of the Russian Academy of Sciences
2, Prof. Popov St., 197376, St. Petersburg, Russia

Abstract—A detailed morphotaxonomic account of seven species of Lecidea from India
is provided. Lecidea confluens, L. plana, and L. tessellata are new records for the Indian
lichen mycota.

Key words—Lecideaceae, lichen flora

Introduction

The lichen genus Lecidea is characterized by crustose, heteromerous, continuous,
areolate or verruculose or squamulose thallus lacking rhizines and decorticated or
with a thin cortex and sometimes sorediate, with photobionts being members of the
Trebouxiophyceae. Apothecia are orbicular or angular, contorted, immersed, sessile or
very shortly stalked, proper margin colourless, coloured or blackened, or closely woven
hyphae; excipulum colourless or reddish or grayish; hypothecium colourless or coloured
or + black; paraphyses simple or branched with swollen, with free or conglutinate,
capitate apices, free or conglutinate, Lecidea-type asci clavate, 8-spored; ascospores
simple colourless, oblong-oval, ellipsoid, with thin wall, pycnidia immersed, with short
conidia.

Awasthi (2000) listed 42 species of Lecidea s. lat. from Indian subcontinent, out of
which about 20 species are known from the Karakorum and Khumbu Himal area of
Nepal, five from Ceylon (Sri Lanka), and 17 species from India. Most of the taxa earlier
listed under Lecidea from India are at present transferred to different lichen genera. The
material of Lecidea advena Nyl. ex Hue, L. albicans Nyl., L. caliginosa Stirt., L. fuscorubida
Nyl., L. secernens H. Magn., which were not traceable in the Indian herbaria, therefore
are not included in the present study. Lecidea nagalandica G.P. Sinha & Kr.P. Singh,
which Sinha & Singh (1987) described as a new foliicolous lichen from India, probably
does not belong to Lecidea due to the presence of brown-black exciple.

324

The Lecidea species in India are widespread in higher altitudes (2000-4700 m) of
the Himalayan region. The states of Uttaranchal and Himachal Pradesh in the western
Himalayas include five each of taxa reported in the present study while only three species
are found in Jammu and Kashmir.

Awasthi (1991) did not treat Lecidea species in his key to microlichens from the
Indian subcontinent. The present communication provides a detailed morphotaxonomic
account of seven species of Lecidea occurring in India according to the modern —
concept.

Materials and methods

Specimens were studied from the personal lichen collections of Dr. D.D. Awasthi (AWAS),
Botany Department, Lucknow University Herbarium (LWU), and National Botanical
Research Institute (LWG) preserved at LWG and representing all the phytogeographical
regions of India. The specimens were examined morphologically, anatomically and
chemically. For chemical spot reaction the usual reagents 5% potassium hydroxide (K),
paraphenylenediamine (PD) and calcium hypochlorite (C) were applied.

Thallus and apothecial sections were cut using a microtome (Fuji-Japan) at 12-15 um
thickness and stained with lactophenol cotton blue. The chemical constituents were
identified in solvent A (180 ml toluene : 60 ml 1-4-dioxane : 8 ml acetic acid) using the
thin layer chromatography (TLC) technique by Culberson (1972) and Walker & James
(1980).

Key to the Lecidea species from India

1b. Thallus whitish, greyish to pale yellowish brown or grey brown ............... 2
2a. Medulla I+ deep violet (thallus thick, grey, hypothecium brown to dark brown)

Ee Oo cet Avcgla ud can © IN igs ee a ee ee L. confluens
ZDalledilla, Tae csp tare anensriae last opty Sita tan eect Senta ec (raed lee Cece tre PB can ra 5
3a. Thallus K+ yellow (PD-, hypothecium pale to dark brown) ........... L. lapicida
3D. Lnalliis Kart ater circus Watley eet nec iea eae! 4 ge RCC Moen rer en ree -
4a. Hypotheciumrcolourless, epihymenium) deep green 72 2 tas one. L. plana
AB. zy potheeiim PLOW tor dark OlOW Ln Genre eee te eae ter tne nee eee ee ern 5

5a. Apothecia immersed, thallus chalky white to grey, hypothecium pale brown ......
tie Bi eR es bee eee Baan h abl aree avert ihe L. tessellata

6a. Excipulum usually broad, developed below the apothecium ....... L. auriculata

6b. Excipulum not developed below the apothecium ............. L. paratropoides

Figures-1-7. Habit
1. Lecidea atrobrunnea; 2. L. auriculata;
3. L. confluens; 4. L. lapicida;

5. L. paratropoides; 6. L. plana;
7. L. tessellata.

326

Taxonomic descriptions

Lecidea atrobrunnea (Lam. & DC.) Schaer. Lich. Helv. Spic., sect. 3: 134 (1818). Fig. 1
~ Rhizocarpon atrobrunneum Ramond ex Lam. & DC., Fl. Franc. ed. 3, 2: 367 (1805).

Thallus reddish brown with epinecral layer, squamulose-areolate, areolae rounded,
plane, with whitish margin; hypothallus distinct, black; apothecia subimmersed to
adnate, slightly constricted at base, upto 1.5 mm diam.; disc plane or somewhat convex |
in mature ones, epruinose, margin prominent, sometimes flexuose; excipulum 40-60
tum thick, blackish green externally, colourless internally; epithecium deep green to
blackish green; hymenium 40-60 tm high, colourless, I+ blue; subhymenium 60-70
tum high, colourless, I+ blue; hypothecium brown, 80-100 «1m high, I+ blue; paraphyses
simple or sometimes branched, thickened at apices. Asci clavate, 40-50 x 10-13 um;
ascospores 8-10 x 4-6 um; with obtuse ends.
Thallus K-, KC-, C-, PD-; a pale yellow spot at Rf class 5 in TLC.
SPECIMENS EXAMINED-HIMACHAL PRADESH: Kangra district, Bir Tea Estate area, Billing
Hills, 2000-2500 m, on exposed rocks, Upreti 213602/A (LWG); Lahul Spiti district,
Baralacha La Pass, 4700 m, on exposed rocks, Upreti and Chatterjee 03-001776 (LWG);

Shimla district, Narkanada, Hatu Peak, 3360 m, on rocks, Nayaka and Srivastava 02-
67181 (LWG).

Lecidea atrobrunnea is distinguished by a deep brown thallus with an epinecral layer and
a well developed hypothecial medulla, small ascospores, and I+ blue medulla.

The species is widely distributed in alpine regions of all the continents. Hertel (1977)
reported the occurrence of this species from Reti Runi area in Spiti valley. In India the
species is known to occur in alpine regions of Himalayas in Himachal Pradesh between
altitudes of 2000-4700 m in Lahul Spiti, Kangra and Shimla districts.

Lecidea auriculata Th. Fr. Nova Acta Reg. Soc. Sci. Upsal., Ser. 3, 3: 213 (1860). Fig. 2

Thallus endolithic, or cracked-areolate, medulla I+ blue; hypothallus indistinct; apothecia
black, sessile, constricted at base, 1.0-2.0 mm in diameter; disc plane, epruinose or
sometimes slightly pruinose; margin distinct, sometimes flexuose; excipulum developed
below the apothecium, 100-150 um thick, dark brown externally, internal part light
brown, hyphae intricate-radiating, 3-5 um, thin walled; epithecium blue-green;
hymenium colourless, 30-40 um high; subhymenium 40-50 um high, light brown;
hypothecium light brown; subhypothecial medulla prominent and raised up, I+ blue;
paraphyses simple, thickened at the apices. Asci clavate, 25-40 x 7-9 um; ascospores
ellipsoid with obtuse ends, 6-11 x 2.5-4 um.

Thallus K-, KC-, C-, PD-; no lichen substances detected with TLC.

SPECIMENS EXAMINED-JAMMU AND KASHMIR: Leh district, Ganglas area, 4000 m, on
exposed rocks, Upreti and Chatterjee 03-001814/A (LWG). HIMACHAL PRADESH:
Lahul Spiti district, Pasio, 3800 m, on exposed rocks, Upreti and Chatterjee 03-001742/
A (LWG); Zinzibar, 4200 m, on exposed rocks, Upreti and Chattrjee 03-001756/A
(LWG); Baralacha Pass, 4700 m, on exposed rocks, Upreti and Chatterjee 03-001772,
03-001774 (LWG).

wey,

The species is characterized by a well-developed excipulum below the apothecium,
blue green epithecium, violet brown subhymenium, very narrow ascospores and the
presence of confluentic acid.

According to Hertel (1977) this taxon has a bipolar distribution and is widespread
and common in Arctic-alpine belt of the more humid high mountain rages in Europe,
Asia and North America. In India the species is known to occur in alpine regions of
Jammu and Kashmir and Himachal Pradesh between altitudes of 3800-4700 m. Awasthi
(1963) first reported this species from Kangra district in Himachal Pradesh.

Lecidea confluens (Weber) Ach. Methodus Lich. 14 (1803). Fig. 3
— Lichen confluens Weber, Spicil. Fl. Goett. 180, tab II (1778).

Thallus cracked areolate, bluish grey to grey, medulla, I+ blue; prothallus black; apothecia
adnate 0.5-1.2 mm diam., immersed to + sessile, arising between the areoles, black; disc
plane to slightly concave, epruinose; margin thick, prominent; epithecium green to olive
green; hymenium colourless 70-100 um high; hypothecium dark red brown to dark
brown, 90-100 um high; excipulum blackish at outer edge, + colourless within. Asci
clavate, 50-60 x 10-16 um; ascospores ellipsoid, 10-12 x 4-6 um.
Thallus medulla K-, KC-, C-, PD-; confluentic acid in TLC.
SPECIMENS EXAMINED-JAMMU AND KASHMIR, Glumarg, at Khilanmarg, 2760 m, on
boulders, Dange 77-535 (LWU-LWG). UTTARANCHAL: Chamoli district, Badrinath,
south of temple near Brahmini village, 3100-3200 m, on boulders, Dange 76-740 (LWU-

LWG), north of temple, way to Mana Village 3100-3250 m, on boulders, Dange 76-892
(LWU-LWG).

The species is know to occur on siliceous rocks in northern Eurasia and North America
and is a new record for Indian lichen flora. }

This species is similar to L. lapicida and L. tessellata. L. confluens prefers to grow in
more humid habitats, has wider areoles, dark red brown to dark brown hypothecium,
K+ yellow excipulum and smaller ascospores than L. lapicida. From L. tessellata it differs
in having an almost colourless hypothecium.

Lecidea lapicida (Ach.) Ach. Method. Lich. 37, (1803). Fig. 4
— Lichen lapicida Ach., Lich. Suec. Prodrom. 61, (1798).

Thallus cracked areolate, whitish grey, changed brownish in herbarium, medulla I+
blue; prothallus black; apothecia appressed to adnate, 0.5-1.5 mm diam., immersed to +
sessile, arising between the areoles, black; margin thick prominent; disc plane or slightly
concave; epruinose with dark green at outer edge; epihymenium greenish black, K+
blue green; hymenium colourless, 90-120 um high; hypothecium pale to dark brown,
80-100 um high; excipulum blue-green externally, pale brown internally, K+ yellow;
Asci clavate, 40-60 x 10-16 um; ascospores ellipsoid, 19-11 x 4-6 um.

Thallus medulla K+ yellow, C-, KC-, PD+ yellow; stictic and constictic acid in TLC.

SPECIMENS EXAMINED-U'T’'TARANCHAL: Dehra Dun district, Mussoorie hills, way to Lal
Tibba, 2250 m, on rocks, Joshi 75-340 (LWU-LWG). HIMACHAL PRADESH: Lahul
Spiti district, 10 km before Sarchu, 4000 m, on rocks, Upreti 03-001783 (LWG).

328

The species is widespread in northern and southern hemispheres on siliceous rocks.
Earlier, Hertel (1977) reported this species from Chandra Valley in Kangra district of
Himachal Pradesh.

In having whiter thallus and K+ yellow reaction it is similar to L. lactea Florke ex
Schaer., which can be differentiated by the presence of norstictic acid and having more
neatly arranged angular areoles.

Lecidea paratropoides Mill. Arg. Flora 57: 348 (1874). Fig. 5

Thallus indistinct (not developed); prothallus not seen; apothecia rounded to angular,
crowded, 0.5-1.0 mm in diam.; margin thick, entire, black; disc plane to slightly convex,
black, epruinose; epihymenium olive green to dark green 12-17 um; hymenium
colourless, 40-65 tm high; hypothecium brown to dark brown 40-50 um high;
excipulum colourless. Asci 26-30 x 10-15 um; ascospores ellipsoid, 7-9 x 3.5-5 um.
Thallus K-, KC-, C-, PD-: no lichen substances detected with TLC.

SPECIMEN EXAMINED-U'T'TARANCHAL: Chamoli district, Kedarnath hill side, on east and

north of the temple, 3600-3700 m on boulders, Dange 76-293 (LWU-LWG); Almora

(now Bageshwar) district, Pindari Glacier, on ridge of moraine, 3940 m, Awasthi 7716
(LWG - AWAS).

The species is widely distributed in the alpine regions of southern Europe and Central
Asia. In India it has a restricted distribution in the western Himalayas and first reported
by Hertel (1977) from Pindari glacier in Uttaranchal.

L. promiscens Nyl., which is close to this species, can be differentiated by having
larger (9-12 x 3-5 um) ascospores and blackish-brown hypothecium.

Lecidea plana (J. Lahm) Nyl. Flora 55: 552 (1872). Fig. 6
— Lecidella plana J. Lahm in Korber, Parerga Lich. 211 (1861).

Thallus absent or thin, white, granular to cracked, areolate, areoles flat, white to grey;
prothallus indistinct; apothecia adnate 0.4-1.2 mm diam., black; margin thin, entire
or more or less sinuous; disc flat to somewhat convex; epihymenium deep green,
intensifying in K; hymenium colourless, 40-50 um high; hypothecium colourless, 50-80
tum high; exciple colourless. Asci clavate, 30-40 x 8-14 um; ascospores 8-14 x 3-6 um,
ellipsoid.
Thallus and medulla K-, C-, KC-, PD-; planaic acid in TLC.
SPECIMENS EXAMINED-HIMACHAL PRADESH: Lahul Spiti district, Sissu, 3100 m, on
rocks, Upreti and Chatterjee 03-001706 (LWG). JAMMU AND KASHMIR: Leh
district, Khardungla Pass, 4700 m, on rocks, Upreti and Chatterjee 03-001806/B (LWG).

UTTARANCHAL: Chamoli district, Badrinath, East of Temple, way to Devdarshani,
3150 m, on boulders, Dange 76-814 (LWU-LWG).

The species is distributed in Europe, North America, Japan, Australia and is a new
record for Indian lichen flora. It preferably grows on coarse to grained siliceous rocks
in alpine habitats.

L. plana is closely related to L. lithophila (Ach.) Ach., in anatomy and morphology.

929

L. plana can be distinguished by having smaller ascospores, greenish epithecium, lower
hymenium and adnate, purely black apothecia.

Lecidea tessellata Flérke Deutsche Lichenen, no. 64 (1819). Fig. 7

Thallus cracked areolate, chalky white to grey, areolate, plane, medulla I+ blue;
apothecia subimmersed, appressed to adnate, black, 0.5-1.8 (-2.0) mm diam.; disc
smooth, plane, rounded in young apothecia, convex, variously irregular in mature
ones, with sometimes thin, white pruinose; epihymenium brownish-green to blackish
green; hymenium colourless, 40-60 um high; hypothecium pale brown, 30-40 um high;
excipulum blackish-green externally, colourless internally. Asci clavate, 30-50 x 8-14
um, ascospores ellipsoid, 7-9 x 5-6 um.

Thallus and medulla K-, C-, PD-; confluentic acid in TLC.

SPECIMENS EXAMINED-UTTARANCHAL: Chamoli district, Badrinath east of Temple,

way to Devdarshani, 3150 m, on boulders, Dange 76-794 (LWU-LWG). HIMACHAL
PRADESH: Lahul Spiti district, Keylong, 2040 m, on exposed rocks, Upreti (LWG).

This species is widely distributed in Afghanistan, Russian Asia, China, Nepal, Europe
and North America. It is a new record for Indian lichen flora and known only from the
alpine Western Himalayas at an altitude of 3450 m.

In the presence of white thallus, it is similar to L. lapicida and L. confluescens Nyl. L.
lapicida can be distinguished by having K+ yellow reaction (stictic and constictic acid)
while L. confluescens has much bigger (12-14 x 5-7 tum) ascospores and I- reaction in
the medulla.

Acknowledgements

We are grateful to Dr. R. Tuli, Director, NBRI for providing necessary laboratory facilities, to
Drs. Gerhard Rambold, Christian Printzen and Teuvo Ahti for their valuable comments on the
manuscript.

Literature Cited

Awasthi DD. 1963. Some noteworthy additions to the lichen flora of India and Nepal. Univ.
~ Colorado Studies. Ser. Biol. 10: 28-36.

Awasthi DD. 1991. A key to the microlichens of India, Nepal and Sri Lanka. Biblioth. Lichenol.
40: 1-337.

Awasthi DD. 2000. Lichenology in Indian Subcontinent. Bishen Singh Mahendra Pal Singh, Dehra
Dun, India

Culberson CF. 1972. Improved conditions and new data for the identification of lichen products by
a standard thin layer chromatographic method. J. Chromat. 97: 107-108.

Hertel H. 1977. Gesteinsbewohnende Arten der Sammelgattung Lecidea (Lichenes) aus Zentral,

_ Ost-, und Siidasien. Khumbu Himal 6(3): 145-378.

Magnusson AH. 1940. Lichens from Central Asia I. In Repts. Sci. Exped. NW Prov. China (the
Sino-Swedish Expedition). (Ed. Hedin, S.). 13, XI. Botany, 1: 1-168. Aktiebolaget Thule\
Stockholm. Pp. 1-168.

Poelt J. 1961. Flechten aus dem N.W. Karakorum in Rahmen der Deutschen Karakorum-Expedition
1959, von FE. Lobbichler und Dr. Schneider gesammelt. Mitteil. Bot. Staatssamml. Miinchen 4:
83-94

330

Schneider G. 1980 (‘1979’). Die Flechtengattung Psora sensu Zahlbruckner. Biblioth. Lichenol. 13:
1-129.

Sinha GP, Singh KP. 1987. Foliicolous lichens from Nagaland, India. Geophytology 17(2): 174-
185.

Timdal E. 1984. The delimitation of Psora (Lecideaceae) and related genera, with notes on some
species. Nordic J. Bot. 4: 525-540.

Walker FJ, James PW. 1980. A revised guide to microchemical technique for the identification of
lichen products. Bull. Brit. Lich. Soc. 46: 13-29.

MY COTA XON

Volume 95, pp. 331-334 January-March 2006

Contributions to the macrofungi of
Bolu and Duzce Provinces, Turkey

DuRSUN YAGIz', AHMET AFYON’,
MUHSIN KONUK?’ & STEPHAN HELFER?

dyagiz@selcuk.edu.tr aafyon@selcuk.edu.tr
mkonuk@aku.edu.tr s.helfer@rbge.org.uk

"Selcuk University, Education Faculty
42099, Meram, Konya- TURKEY

?Afyon Kocatepe University, Faculty of Art and Science
Afyonkarahisar-TURKEY

Royal Botanic Garden Edinburgh
20A Inverleith Row, Edinburgh EH3 5LR, U.K.

Abstract—This study was based on specimens of macrofungi collected from Bolu and
Diizce provinces between 1998 and 2004. According to the field and laboratory results,
277 taxa belonging to 44 families (7 families of Ascomycetes and 37 of Basidiomycetes)
have been identified.

The full checklist is available at http://rbg-web2.rbge.org.uk/mycotaxon/56.pdf

Key words—macromycota, flora, Western Black Sea Region

Introduction

This research was carried out in Bolu and Diizce provinces of Turkey which are situated
in the Western Black Sea Region (Figure 1). These provinces are placed in squares A3-
A4 according to the floristic square system (Davis 1965-1985). In the study area mainly
the second type of oceanic rain fall regime occurs (Akman 1990). But in some parts
(e.g., in the west and southwest), it also displays continental climatic features.

One checklist for macrofungi of Turkey was produced by Sesli & Denchev (2005).
According to this, there was only one previous study in the area (Stimer 1982). This

account of wood decaying macrofungi and and a few other reports on other macrofungi
are included here. The study area is covered mainly by natural forest due to the prevailing
climatic and edaphic conditions and limited timber extraction. The canopy vegetation of
the study area is composed of mainly coniferous and broadleaved trees. The research area
therefore is an ideal habitat for mycological studies. This paper presents the most up-to-date
and extensive list of macrofungi of Bolu and Diizce provinces.

332

Materials and Methods

Specimens were collected from the research area (Fig. 1) during field trips between 1998
and 2004. The morphological and ecological characters of the specimens were recorded
in situ and their microscopic features determined in the laboratory. The diagnoses of the
taxa were carried out with the help of Marchand (1971-1986), Phillips (1981), Moser
(1983), Michael et al. (1983-1988), Breitenbach & Kranzlin (1984-1991) and Dahncke
(1993). Taxa and their authors were given according to an amended CABI Bioscience
electronic version (http://www.indexfungorum.org/Names/Names.asp). The specimens
are kept at Selcuk University, Education Faculty Herbarium (KNYA).

Results

In our study, 277 species were recovered belonging to 44 families. The distribution of the
species and their families are: Dermataceae 1, Discinaceae 1, Helvellaceae 4, Rhizinaceae
1, Morchellaceae 7, Pezizaceae 2, Pyronemataceae 1, Agaricaceae 14, Albatrellaceae 1,
Auriscalpiaceae 1, Bankeraceae 3, Bolbitiaceae 11, Boletaceae 9, Cantharellaceae 1,
Clavariaceae 1, Clavulinaceae 1, Coprinaceae 5, Cortinariaceae 15, Dacrymycetaceae
2, Entolomataceae 5, Fomitopsidaceae 1, Ganodermataceae 2, Geastraceae 4,
Gomphaceae 2, Gomphidiaceae 2, Hydnaceae 1, Hydnangiaceae 1, Hygophoropsidaceae
1, Hymenochaetaceae 3, Lycoperdaceae 8, Marasmiaceae 16, Paxillaceae 1, Phallaceae
2, Pleurotaceae 1, Pluteaceae 11, Polyporaceae 10, Ramariaceae 4, Rhizopogonaceae
2, Russulaceae 38, Stereaceae 1, Strophariaceae 10, Suillaceae 4, Tremellaceae 2, and
Tricholomataceae 64. ‘Their collection dates, localities, habitats, collectors’ names and
herbarium numbers are given in the web version of the paper: http://rbg-web2.rbge.org.
uk/mycotaxon/56.pdf .

Discussion

277 species of macrofungi were collected from the study area (Bolu and Diizce
provinces, located in the western Black Sea Region of Turkey). 17 of them belonged to
Ascomycotina and 260 to Basidiomycotina. Stimer (1982) reported 102 wood decaying
macrofungi from the study area. There are no other reports related to our study area
known to the authors. Oder (1986) reported 17 poisonous macrofungi and 14 edible taxa
from the East Black Sea Region (Oder 1988). Some reports from neighbouring regions
of the study area were: Afyon et al. (2000) 62 taxa from Bartin; Afyon & Konuk (2002)
77 taxa from Zonguldak; Afyon et al. (2004) 170 taxa from Sinop; Yagiz et al. (2005) 121
taxa from Karabiik, and Afyon et al. (2005) 80 wood decaying macrofungi from Western
Black sea region. When comparing taxa given from the neighbouring areas, the present
study gives a very high number of recorded taxa. Bolu seems to be the richest area
for its macrofungi species when compared to the other parts of Turkey. A diversity of
habitats may be the cause for this abundance of taxa. The five most species-rich families
and their species numbers are Tricholomataceae 64, Russulaceae 38, Marasmiaceae 16,
Cortinariaceae 15 and Agaricaceae 14. These 5 families include 147 species and their
ratio is 53% when compared to total numbers of the taxa diagnosed.

8 oi

Akgcakoca

Cigekpinar @

a
Yumrutas Same?

Gerede

z Kaindira
Akgalan :
. Goleiik ;
> Province
mam ; Boundary Province + District Asagi Ovacik @ @
Giinyayla
(5 Abant lake 99 sereem : Boundary District © ? Town houses

eee > Highway : Village eu ue es ey) or
mere fener femennr

Figure 1: Map of the study area.

Acknowledgements
We would like to thank TUBITAK (The Scientific and Technical Research Council of Turkey)
(TBAG-1659) and Selcuk University Scientific Research Project Commission (BAP: E.F/065)
for supporting this study financially. Thanks are also due to Profs M. Isiloglu and R. Watling for
reviewing the paper and for helpful comments.

Literature Cited

Afyon A, Konuk M, Yagiz D. 2000. Bartin Yoresi Makrofunguslari Uzerine Bir Arastirma. S. U.
Egitim Fak Fen Bilimleri Derg 8/2: 77-86.

Afyon A, Konuk M, Yagiz D. 2004. Macrofungi of Sinop Province. Turk J Bot 28:351-360.

Afyon A, Konuk M, Yagiz D, Helfer S, 2005. A study of wood decaying macrofungi of the western
Black Sea Region, Turkey. Mycotaxon 93: 319-322.

Akman Y. 1990. Iklim ve Biyoiklim. Ankara: Palme Yayin Dagitim.

_ Breitenbach J, Kranzlin F. 1984-1991. Fungi of Switzerland. Vol.1-3. Lucerne: Verlag Mycologia.

Davis PH (ed.). 1965-1985. Flora of Turkey and East Aegean Islands. Vol. 1-9, Edinburgh Univ.
Press.

Dahncke RM. 1993. 1200 Pilze. Aarau: AT Verlag.

Kirk PM, et al. 2004. Authors of fungal names. CABI Bioscience, Wallingford. Elecronic version:
http://www.speciesfungorum.org/AuthorsOfFungalNames.htm

Marchand A. 1971-1986. Champignons du Nord et du Midi. Tome. 1-9. Perpignan: Soc. Mycol.
Des Pyrénées Meéditerr.

334

Michael E, Hennig B, Kreisel H. 1983-1988. Handbuch fiir Pilzfreunde. Bd. 1-5. Stuttgart: Gustav
Fischer Verlag.
Moser M. 1983. In: Gams H (ed.). Kleine Kryptogamenflora. Stuttgart: Gustav Fischer Verlag.
Oder N. 1986. Karadeniz Bélgesinde (Sinop-Artvin Illeri Arasi) Yetisen Onemli Bazi Zehirli
Mantarlar Uzerinde Taksonomik Arastirmalar. S. U. Fen-Edebiyat Fak Fen Derg 5: 87-104.
Oder N. 1988. Karadeniz Bélgesinde (Sinop-Artvin I[lleri Arasi) Yetisen Halkin Tanidigi Bazi
Onemli Yenen Mantarlar Uzerinde Taksonomik Arastirmalar. S. U. Fen-Edebiyat Fak Fen Derg
8: 215-297.

Phillips R. 1981. Mushrooms and other Fungi of Great Britain and Europa. London: Pan Books
Ltd.

Sesli E, Denchev CM. 2005. Checklists of the myxomycetes and macromycetes in Turkey. Mycologia
Balcanica 2: 119-160.

Siimer S. (1982). Bati Karadeniz Bélgesi Ozellikle Bolu Cevresinde Bulunan Odun Tahripcisi
Mantarlar. Ist. Univ. Yayinlar1, No:2907/312.

Yagiz D, Afyon A, Konuk M. 2005. The Macrofungi of Karabiik Province. Turk J Bot., 29:345-353.

MYCOTAZXON

Volume 95, pp. 335-340 January-March 2006

First isolation of Aphanomyces frigidophilus
(Saprolegniales) in Europe

ISABEL BALLESTEROS, MARIA P. MARTIN
& JAVIER DIEGUEZ-URIBEONDO

dieguez@ma-rjb.csic.es
Departamento de Micologia, Real Jardin Botanico C.S.I.C.
Plaza Murillo 2, Madrid 28014, Spain

Abstract—Aphanomyces frigidophilus was isolated and described for the first time
in Europe. The isolate was characterized by studying its ability to undergo repeated
zoospore emergence, to parasitize crayfish, and to produce chitinase constitutively,
and by sequencing the internal transcribed spacer of nuclear ribosomal DNA
(ITS1+5.8S+ITS2). The physiological properties studied differed from those of the
“crayfish plague” parasite, A. astaci, but they were similar to those of saprobiotic
Aphanomyces species. The ITS nrDNA sequence obtained from this isolate corresponded
to A. frigidophilus.

Key words—Aphanomyces astaci, crayfish, conservation, rDNA, taxonomy

Introduction

The genus Aphanomyces de Bary belongs to the order Saprolegniales (Oomycetes) and
comprises ca 30 species. Many of the species of this group have a saprobiotic mode
of life, living on decayed animals and plant remains. A few species are detrimental
parasites and responsible for economically important diseases affecting agriculture and
aquaculture crops, as well as wildlife populations of freshwater animals (Papavizas &
Ayers 1974, Sdderhall & Cerenius 1999). Aphanomyces frigidophilus Kitanch. & Hatai
is a recently described species, which so far has only been found in salmonids eggs
in Japan (Kitancharoen & Hatai 1997, 1998). Specimens resembling A. frigidophilus
have been described in fish eggs in Poland (Czeczuga et al. 2004a, b, 2005). However,
no isolations have been done to confirm the presence of this species in Europe or to
study the molecular relatedness of European strains to the Japanese reference isolate of
A. frigidophilus.

The taxonomy of Aphanomyces is largely based on the morphological characters of their
sexual structures. However, the main taxonomic problems when describing species of
this genus are: (i) that no reference isolates or cultures exist for several of the described
species, and (ii) that many isolates, especially those of animal parasitic species are sterile;

336

consequently, species identification is largely based on their ability to parasitize their
host, and a number of physiological properties.

The recent application of molecular tools to the genus Aphanomyces has helped
identifying sterile isolates either in culture or clinical samples (Oidtmann et al. 2002,
2004; Phadee et al. 2004, Royo et al. 2004, Vandersea et al. 2006) and even defining
new species (Royo et al. 2004). In this article, we have studied the internal transcribed
spacer of nuclear ribosomal DNA sequences (ITS nrDNA) to identify a sterile isolate
obtained from a mass mortality of indigenous crayfish, Austropotamobius pallipes
(Lereboullet 1858) that occurred in the Central Iberian Peninsula region. Because the
isolate exhibited different physiological properties from the crayfish plague fungus,
A. astaci Schikora, it was decided to explore this isolate more carefully and obtain ITS
sequence data, the results of which are described in this contribution.

Materials and Methods

Dead crayfish, Austropotamobius pallipes, were collected in the river Tajuna, Guadalajara
(Spain). The isolation procedure was done from pieces of sub-abdominal cuticle taken
from the crayfish as described by Cerenius et al. (1988). The isolate was maintained
on PGl-agar (Unestam 1965) and stored under the strain name SAP233 in the culture
collection of the Real Jardin Botanico de Madrid. Morphological characters of asexual
structures and measurements were made microscopically on material mounted in
water. Light micrographs were captured using a QImaging Micropublisher digital
camera (QImaging, Burnaby, BC, Canada) mounted on an Olympus BX51 compound
microscope as described in Diéguez-Uribeondo et al. (2003).

Physiological properties: repeated zoospore emergence characteristic of parasitic
Aphanomyces species, and constitutive production of chitinase, characteristic of
A. astaci, were studied according to methods described by Cerenius & Séderhall (1985),
and Andersson & Cerenius (2002), respectively. Production of sexual structures was
studied by growing the isolate in corn meal agar, hemp seed or snake skin. In corn meal
agar the isolate was paired with representative strains of the four genotypes of A. astaci
(Huang et al. 1994, Diéguez-Uribeondo et al. 1995). The cultures were maintained and
regularly checked for the production of sexual structures during a one month period.

The ability to infect crayfish was tested by following the method described in Cerenius et
al. (1988). After finishing the experiment pieces of sub-abdominal cuticle were examined
under the microscope for the presence of hyphae.

For DNA extraction, mycelium was grown as drop cultures (Cerenius & Séderhill 1985),
and from them, genomic DNA was extracted using an E.Z.N.A.-Fungi DNA miniprep
kit (Omega Biotek, Doraville, USA). DNA fragments containing internal transcribed
spacers ITS1 and ITS2 including 5.88, were amplified with primer pair ITS5/ITS4
(White et al. 1990) primers as described in Martin et al. (2004). Nucleotide BLASTN
searches with option Standard nucleotide BLAST of BLASTN 2.6 were used to compare
the sequence obtained against the sequences in the National Center of Biotechnology
Information (NCBI) nucleotide databases. The new consensus sequence has been
deposited in the EMLB database with the accession Number 281399.

337

Results

The isolate obtained exhibited thin hyphae with rounded hyphal tips, and with a hyphal
- diameter that ranged from 5 to 7 um (Fig. la). The isolate produced sporangia with a
single row of primary spores. The primary spores were eventually released and encysted
at the hyphal tip forming spore-balls characteristic for the genus Aphanomyces (Fig. 1b).
No oogonia or antheridia were seen in either individual cultures or in co-culture with
the other isolates or with representive strains of four genetic groups of A. astaci. Thus
the strains appeared to be sterile and lack sexual reproduction.

The encysted zoospores did not undergo repeated zoospore emergence and instead
germinated. No chitinase activity was detected in the culture filtrates of the new isolate,
while reference A. astaci strains produced high level of extracellular chitinase (Fig. 1
c, d, e). Crayfish challenged with zoospores of the Aphanomyces sp. isolate did not die
under the experimental conditions. However, addition of zoospores of the reference
isolates of A. astaci always caused 100% mortality of crayfish.

The blast search of the sequence of the isolate showed 99% similarity (the sequence
differed in one base for ITS1 and four bases in ITS2 out of the 673 bases compared)
to Genbank sequence AY647192 corresponding to strain NJM9500 of A. frigidophilus
directly submitted by Phadee et al. (2004), and 95% (the sequence differed in 22 bases
for ITS1 and 10 bases in ITS2 out of the 614 bases compared to Genbank sequences of
A. astaci.

Discussion

Previous studies have shown that analyses of the ITS nrDNA represents a useful tool
for differentiating individual saprolegniaceous species (Molina et al. 1995, Leclerc 2000,
Oidtmann et al. 2004, Phadee et al. 2004). Due to the lack of sexual structures of the
studied isolate, we carried out Genbank sequence comparisons of the two ITS nrDNA
for species identification. The results indicated the sequence of our isolate corresponded
to the species, Aphanomyces frigidophilus. Thus, this study represents the first isolation of
A. frigidophilus in Europe and the first description of this species growing in a different
substrate from salmonid eggs.

Interestingly, this isolate was growing in crayfish cuticle and associated to a mass
mortality of indigenous European species of freshwater crayfish. These episodes are
generally caused by the “crayfish plague” parasite Aphanomyces astaci. This parasite is
considered among the 100 worst invasive species (Global Invasive Species Database
2005) and is responsible for the dramatic decline of the indigenous European freshwater
crayfish species, which are currently endangered in Europe and at risk of extinction
in the Iberian Peninsula (Diéguez-Uribeondo et al. 1997a, b, Séderhall & Cerenius
1999). Current attempts to develop and improve techniques for rapid and accurate
identification of this economically important parasitic species need to take into account
the existence of closely related species, such as A. frigidophilus, in Europe.

Regarding the possible parasitic abilities of A. frigidophilus, our results indicate that
its physiological properties are characteristic of a saprobiotic and/or opportunistic
pathogen. Thus, the isolate exhibited a low percentage of secondary cysts undergoing
repeated zoospore emergence, and, therefore, it lacks a character that appears to be

338

O39

related to parasitism in Aphanomyces species (Cerenius & Séderhill, 1985). The failure
to kill crayfish challenged with zoospores and to produce chitinase constitutively, are also
characters of the specialized crayfish parasite, A. astaci (Cerenius et al. 1988; Sdderhall
& Cerenius 1999, Andersson & Cerenius 2004).

Aphanomyces frigidophilus and A. astaci seem to be closely related species which
may occur in the same host with different abilities to colonize it. Further studies on
phylogenetic relationships among Aphanomyces species need to be carried out in order
to more accurately establish species limits. Finally, the results of this work emphasized
the need to carry out isolations for a correct identification and characterization of
saprolegniaceous species.

Acknowledgements

We thank Dr. Fernando Alonso (Centro de Investigaciones Agrarias de Albadalejito, Cuenca, Junta
Castilla-La Mancha, Spain) for providing us with crayfish, and Dr. Stuart Gelder (Department of
Science, University of Maine at Presque Isle, Maine, USA) for revising the English text. This study
was supported by the Project Flora Micolégica Ibérica (REN2002-04068-C02-01GLO), which also
supported Dr. Isabel Ballesteros with a postdoctoral fellowship. We also acknowledge referees Dr.
Lage Cerenius (Department of Comparative Physiology, University of Uppsala, Sweden) and Dr.
Gordon Beakes (Department of University of Newcastle) for revising this article.

Literature Cited

Andersson MG, Cerenius L. 2002. Analysis of chitinase expression in the crayfish plague fungus
Aphanomyces astaci. Diseases of Aquatic Organisms 51: 139-147.

Cerenius L, Sdderhill K, 1985. Repeated zoospore emergence as a possible adaptation to parasitism
in Aphanomyces. Experimental Mycology 9: 259-263.

Cerenius L, Sdderhall K, Persson M, Ajaxon R. 1988. The crayfish plague fungus, Aphanomyces
astaci — diagnosis, isolation, and pathobiology. Freshwater Crayfish 7: 131-144.

Czeczuga B, Kiziewicz B, Muszynska E. 2004a. Presence of zoospore fungus species on the eggs of
whitefish from Lake Goldopiwo, Mazury Region. Medycyna Weterynaryjna 60: 379-383.

Czeczuga B, Kiziewicz B, Godlewska A. 2004b. Zoosporic fungi growing on eggs of Coregonus
lavaretus holsatus Thienemann, 1916 from Lake Wdzydze in Kaszuby. Polish Journal
of Environmental Studies 13: 355-359 2.

Czeczuga B, Bartel R, Kiziewicz B, Godlewska A, Muszynska E. 2005. Zoosporic fungi growing on
the eggs of sea trout (Salmo trutta m. trutta L.) in river water of varied trophicity. Polish Journal
of Environmental Studies 14: 295-303.

Diéguez-Uribeondo J, Huang TS, Cerenius L, Sdderhall K. 1995. Physiological adaptation
of an Aphanomyces astaci strain isolated from the freshwater crayfish Procambarus clarkii.
Mycological Research 99: 574-578.

Diéguez-Uribeondo J, Rueda-Diez A, Castién E, Bascones JC. 1997a. A plan of restoration for the
native freshwater crayfish species, Austropotamobius pallipes, in Navarra. Bulletin Francais de
la Peche et de la Pisciculture 347: 625-637.

Fig. 1 Aphanomyces frigidophilus. a) Hypha with a rounded tip growing within the cuticle of
the freshwater crayfish Austropotamobius pallipes. b) “Spore balls” characteristic of the genus
Aphanomyces (Bars 10 um). c-e) Chitinase assay for production of chitinase constitutively during
growth: c) negative control, without fungus; d) A. frigidophilus (negative); e) A. astaci (positive).

340

Diéguez-Uribeondo J, Temifio C, Muzquiz JL. 1997b. The crayfish plague fungus, Aphanomyces
astaci in Spain. Bulletin Francais de la Peche et de la Pisciculture 347: 753-763.

Diéguez-Uribeondo J, Forster H, Adaskaveg JE. 2003. Digital image analysis of internal light spots
of appressoria of Colletotrichum acutatum. Phytopathology 93: 923-930.

Global Invasive Species Database. 2005. Information Infrastructure (NBII) and Invasive Species
Specialist Group (ISSG). Aphanomyces astaci. Available at: <http://www.issg.org/database/
species/ecology.asp?si=107 &fr=1 &sts=sss>

Huang TS, Cerenius L, Séderhall K. 1994. Analysis of the genetic diversity in crayfish plague
fungus, Aphanomyces astaci, by random amplification of polymorphic DNA assay. Aquaculture
26:1-10.

Kitancharoen N, Hatai K. 1997. Aphanomyces frigidophilus sp. nov. from eggs of Japanese char,
Salvelinus leuacomaenis. Mycoscience 38: 135-140.

Kitancharoen N, Hatai K. 1998. Some biochemical characteristics of fungi isolated from salmonid
eggs. Mycoscience 39: 249-255.

Leclerc MC., Guillot J, Deville M. 2000. Taxonomic and phylogenetic analysis of Saprolegniaceae
(Oomycetes) inferred from LSU rDNA and ITS sequence comparisons. Antonie van
Leeuwenhoek 77: 369-377.

Martin MP, Raidl S, Telleria MT. 2004. Molecular analysis confirm the relationship between
Stephanospora caroticolor and Lidtneria trachyspora. Mycotaxon 90: 133-140.

Molina FI., Jong SC., MA, G. 1995. Molecular characterization and identification of Saprolegnia by
restriction analysis of genes coding for ribosomal RNA. Antonie van Leeuwenhoek 68: 65-74.

Oidtmann B, Bausewein S, Hélzle L, Hoffmann R, Wittenbrink M. 2002. Identification of the
crayfish plague fungus Aphanomyces astaci by polymerase chain reaction and restriction
enzyme analysis. Veterinary Microbiology 85: 183-194.

Oidtmann B, Schaefer N, Cerenius L, Sdderhall K, Hoffmann RW. 2004. Detection of genomic
DNA of the crayfish plague fungus Aphanomyces astaci (Oomycete) in clinical samples by PCR.
Veterinary Microbiology 100: 269-282.

Papavizas GC, Ayers A. 1974. Aphanomyces species and their root diseases in pea and sugar beet.
US. Department of Agriculture Technical Bulletin no 1485.

Phadee P, Kurata O, Hatai K, Irono I, Aoki T. 2004. Detection and identification of the fish-
pathogenic Aphanomyces piscicida using polymerase chain reaction (PCR) with species-specific
primers. Journal of Aquatic Animal Helath 16: 220-230.

Royo F, Andersson MG, Bangyeekhun E, Muzquiz JL, Soderhall K, Cerenius L. 2004. EHyoloaiCal
and genetic characterisation of some new Aphanomyces strains isolated from freshwater
crayfish. Veterinary Microbiology 104: 103-112.

Séderhill K, Cerenius L. 1999. The crayfish plague fungus: history and recent advances. Freshwater
Crayfish 12: 11-35.

Vandersea MW, Litaker RW, Yonnish B, Sosa E, Landsberg JH, Pullinger C, Moon-Butzin P., Green
J., Morris JA, Kator H, Noga EJ, Tester PA. 2006. Molecular assays for detecting Aphanomyces
invadans in ulcerative mycotic fish lesions Applied and Environmental Microbiology 72:
1551-1557.

Unestam T. 1965. Studies on the crayfish plague fungus, Aphanomyces astaci I. Some factors
affecting growth in vitro. Physiologia Plantarum 18: 483-505.

White TJ, Bruns T, Lee S, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. In PCR Protocols. A guide to methods and applications (eds.
Innis MA, Gelfand DH, Sninsky JJ, White TJ.), pp. 315-322. Academic Press Inc., San Diego,
GA

Nomenclatural novelties proposed in Mycotaxon 95

Arthrobotrys multisecundaria W.F. Hu & K.Q. Zhang, p. 182
Brachydesmiella brasiliensis R.F. Castafieda, Gusmao & Heredia, p. 262
Brachydesmiella obclavata R.F. Castafieda, Gusmao & Saikawa, p. 265
Calostoma zanchianum Baseia & Calonge, p. 114

Coccomyces taiwanensis C. L. Hou, R. Kirschner & Chee J. Chen, p. 73
Cookeina colensoiopsis Iturriaga & Pfister, p. 151

Doassansiopsis tomasii Vanky, p. 46

Embellisia oxytropis Q. Wang, Nagao & Kakish., p. 25

Geastrum hirsutum Baseia & Calonge, p. 302

Heterodoassansia hygrophilae (Thirum.) Vanky, p. 56

Hyphodontia tubuliformis Sheng H. Wu, p. 185

Kalmusia amphiloga O.E. Erikss. p. 67

Lycoperdon ovalicaudatum D. Bisht, J.R. Sharma & Kreisel, p. 92
Marasmius dimorphus C. Puccin. & Capelari, p. 298

Marasmius pseudosetosus C. Puccin. & Capelari, p. 295

Meliola thalliformis var. major D.J. Soares & R.W. Barreto, p. 202
Microbotryum afromontanum Vanky, p. 50

Morchella deqinensis Shu H. Li, Y.C. Zhao, H.M. Chai & M.H. Zhong, p. 319
Morchella meiliensis Y.C. Zhao, Shu H. Li, H.M. Chai & M.H. Zhong, p. 321
Paecilomyces verticillatus Z.Q. Liang. Z. Li & Y.F. Han et al, p. 134
Parmotrema sorediosulphuratum Eliasaro & Donha, p. 242

Parmotrema superaguiense Donha & Elisaro, p. 243

Pilocintractia adrianae Vanky, p. 54

Repetophragma fasciata (R.F. Castafieda) Castafieda, Gusmao & Saikawa, p. 269
Repetophragma filifera (Piroz.) R.E. Castafieda, Gusmao & Heredia, p. 269
Russula appendiculata K. Das, S.L. Mill. & J.R. Sharma, p. 210

Russula dhakuriana K. Das, J.R. Sharma & S.L. Mill., p. 208

Russula mayawatiana K. Das, S.L. Mill. & J.R. Sharma, p. 206

Russula natarajanii K. Das, J.R. Sharma & Atri, p. 272

Russula puellaris var. atrii K. Das, S.L. Mill. & J.R. Sharma, p. 211

Russula siamensis Yomyart, Piapukiew, Watling, Whalley & Sihan., p. 249
Sporisorium andropogonis-chinensis Vanky, p. 5

Sporisorium andropogonis-eucomi Vanky, p. 5

Sporisorium andropogonis-gabonensis Vanky, p. 7

Sporisorium andropogonis-pumili Vanky, p. 7

Sporisorium andropteri (Zambett.) Vanky, p. 59

Sporisorium clintonianum Vanky, p. 30

Sporisorium distachyum Vanky, p. 12

Sporisorium ingoldii Vanky, p. 50

341

342

Sporisorium livingstoneanum Vanky, p. 17

Sporisorium sanctae-catharinae (Zundel) Vanky, p. 21
Sporisorium scholzii Vanky, p. 22

Sporisorium semisagittatum (Thirum. & Pavgi) Vanky, p. 60
Sporisorium sorghastri (Zundel) Vanky, p. 30

Sporisorium zilligii (Zundel) Vanky, p. 25

Tricholoma borgsjoeénse Jacobsson & Muskos, p. 197
Tricholoma lavendulophyllum E.Q. Yu, p. 306

Tuber quercicola J.L. Frank, Southworth & Trappe, p. 232
Tuber whetstonense J.L. Frank, Southworth & Trappe, p. 235
Ustanciosporium virginianum Vanky, p. 48

Ustilago gabonensis Vanky, p. 39

Ustilago jardineae (Zambett.) Vanky, p. 39

Ustilago penniseti-purpurei Vanky, p. 44

Ustilago pentaschistidis Vanky, p. 42

Ustilago trichogena Vanky, p. 54

343

Author Index—Volume 95

Abarca, Gabriela Heredia, see Castafieda-Ruiz & al.

Adler, Monica T., Susana Calvelo & John A. Elix. The distinction between Menegazzia
cincinnata and M. valdiviensis (Parmeliaceae). 95: 217-228. 2006.

Afyon, Ahmet, see Yagiz & al.

Andreev, M.P., see Upreti & al.

Aslan, Alu, see Yazici & Aslan

Atri, N.S., see Das & al.

Ballesteros, Isabel, Maria P. Martin & Javier Diéguez-Uribeondo. First isolation of
Aphanomyces frigidophilus (Saprolegniales) in Europe. 95: 335-340. 2006.

Barreto, Robert Weingart, see Soares & al.

Baseia, [uri G., Vagner G. Cortez & Francisco D. Calonge. Rick’s species revision:
Mitremyces zanchianus versus Calostoma zanchianum. 95: 113-116. 2006.

Bisht, Dipika, J.R. Sharma, Hanns Kreisel & Kanad Das. A new species and a new
record of Lycoperdaceae from India. 95: 91-96. 2006.

Calonge, E.D., see Baseia & Calonge

Calonge, Francisco D., see Baseia & al.

Calvelo, Susana, see Adler & al.

Capelari, see Puccinelli & Capelari

Caretta, Giuseppe, Solveig Tosi, Eduardo Piontelli & G.S. de Hoog. Phialophora sessilis,
a lithobiont fungus. 95: 281-284. 2006.

Castaneda-Ruiz, Rafael F., Luis Fernando Pascholati Gusmao, Gabriela Heredia
Abarca & Masatoshi Saikawa. Some hyphomycetes from Brazil. Two new species
of Brachydesmiella, two new combinations for Repetophragma, and new records.
95: 261-270. 2006.

Chai, Hong-Mei, see Li & al.

Chen, Chee-Jen, see Hou & al.

Coronado, Martha, see Esqueda & al.

Cortez, Vagner G., see Baseia & al.

Cunnington, James H., see Hamilton & Cunnington

Das, Kanad, J.R. Sharma & N.S. Atri. Russula in Himalaya 3: A new species of subgenus
Ingratula. 95: 271-275. 2006.

Das, Kanad, S.L. Miller & J.R. Sharma. Russula in Himalaya 2: Four new taxa. 95: 205-
Zisa2006:

Das, Kanad, see Bisht & al.

de Hoog, G.S., see Caretta & al.

Diéguez-Uribeondo, Javier, see Ballesteros & al.

Donha, Cristine G. & Sionara Eliasaro. Two new species of Parmotrema (Parmeliaceae,
Lichenized Ascomycota) from Brazil. 95: 241-245. 2006.

Eliasaro, Sionara, see Donha & Eliasaro

Elix, John A., see Adler & al.

344

Eriksson, Ove E. Kalmusia amphiloga comb. nov. on Bambusa. 95: 67-69. 2006.

Frank, Jonathan L., Darlene Southworth & James M. Trappe. NATS truffle and truffle-
like fungi 13: Tuber quercicola and T. whetstonense, new species from Oregon, and
T. candidum redescribed. 95: 229-240. 2006.

Gleason, Mark L., see Sun & al.

Goes-Neto, Aristételes, see Lamrood & Gées-Neto

Gusmao, Luis Fernando Pascholati, see Castahleda-Ruiz & al.

Hamilton, Andrew J. & James H. Cunnington. Calculating minimum sample sizes for
taxonomic measurements: examples using Gaumann’s Peronospora spore data. 95:
189-194, 2006.

Han, Yanfeng, see Li & al.

Helfer, Stephan, see Yagiz & al.

Herrera, Tedfilo, see Esqueda & al.

Hou, Cheng-Lin, Roland Kirschner & Chee-Jen Chen. A new species and new records
of Rhytismatales from Taiwan. 95: 71-79. 2006.

Hu, Weifeng, Yan Li, Minghe Mo & Keqin Zhang. A new nematode-trapping
hyphomycete of Arthrobotrys. 95: 181-184. 2006.

I.G. Baseia & ED. Calonge. Geastrum hirsutum: a new earthstar fungus with a hairy
exoperidium. 95: 301-304. 2006.

Iturriaga, Teresa & Donald H. Pfister. A monograph of the genus Cookeina (Ascomycota,
Pezizales, Sarcoscyphaceae). 95: 137-180. 2006.

Jacobsson, S., S. Muskos & E. Larsson. Tricholoma borgsjoeénse, a new species from
boreal coniferous forest in Fennoscandia. 95: 195-200. 2006.

Kakishima, Makoto, see Wang & al.

Kirschner, Roland, see Hou & al.

Knudsen, Kerry & James C. Lendemer. Changes and additions to the North American
lichen mycota — V. Mycotaxon 95: 309-313. 2006.

Konuk, Muhsin, see Yagiz & al.

Kreisel, Hanns, see Bisht & al.

Lamrood, Prasad & Aristételes Gdes-Neto. Taxonomic studies on Indian Phellinus s.l.
species: parsimony analysis using morphological characters. 95: 117-131. 2006.

Larsson, E., see Jacobsson & al.

Lendemer, James C., see Knudsen & Lendemer

Li, Shu-Hong, Yong-Chang Zhao, Hong-Mei Chai & Ming-Hui Zhong. Two new
species in the genus Morchella (Pezizales, Morchellaceae) from China. 95: 319-
322.2006,

Li, Yan, see Hu & al.

Li, Yu-ling, see Wang & al.

Li, Zhu, Yanfeng Han & Zongqi Liang. Paecilomyces verticillatus, a new species isolated
from soil in China. 95: 133-136. 2006.

Liang, Zongqi, see Li & al.

Liu, Pei-Gui, see Yu & al.

345

Ma, Huining, see Sun & al.

Martin, Maria P., see Ballesteros & al.

Miller, S.L., see Das & al.

Mo, Minghe, see Hu & al.

Muskos, S., see Jacobsson & al.

Nagao, Hideyuki, see Wang & al.

Nayaka, S., see Upreti & al.

Parreira, Douglas Ferreira, see Soares & al.

Pérez-Silva, Evangelina, see Esqueda & al.

Pfister, Donald H., see Iturriaga & Pfister

Piapukiew, J., see Yomyart & al.

Piontelli, Eduardo, see Caretta & al.

Puccinelli, Carla & Marina Capelari. Two new species of Marasmius (Basidiomycota,
Marasmiaceae) from Brazil. 95: 295-300. 2006.

Ryley, Malcolm J. Notes on the type, synonyms, and other specimens of the balansioid
fungus, Nigrocornus scleroticus. 95: 97-112. 2006.

Saikawa, Masatoshi, see Castaneda-Ruiz & al.

Sanchez, Alfonso, see Esqueda & al.

Sharma, J.R., see Bisht & al.

Sharma, J.R., see Das & al.

Sihanonth, P., see Yomyart & al.

Soares, Dartanha J., Douglas Ferreira Parreira & Robert Weingart Barreto. A new
variety of Meliola thalliformis from Brazil. 95: 201-204. 2006.

Southworth, Darlene, see Frank & al.

Sun, Guangyu, Miao Zhang, Rong Zhang, Huining Ma & Mark L. Gleason. Wallemia,
a genus newly recorded from China. 95: 277-280. 2006.

Tang, B.-H., T.-Z. Wei & Y.-J. Yao. Revision of Termitomyces species originally described
from China. 95: 285-293. 2006.

Teofilo Herrera. Macromycetes of Pinacate and Great Altar Desert biosphere reserve,
Sonora, Mexico. 95: 81-90. 2006.

Tosi, Solveig, see Caretta & al.

Trappe, James M., see Frank & al.

Upreti, D.K., S. Nayaka & M.P. Andreev. Notes on some species of the lichen genus
Lecidea from India. 95: 323-330. 2006.

Vanky, Kalman. Taxonomic studies on Ustilaginomycetes—26. 95: 1-65. 2006.

Wang, Hong-sheng, see Wang & al.

Wang, Qi, Hideyuki Nagao, Yu-ling Li, Hong-sheng Wang & Makoto Kakishima.
Embellisia oxytropis, a new species isolated from Oxytropis kansuensis in China.
95: 255-260. 2006.

Wang, Yun, see Yu & al.

Watling, R., see Yomyart & al.

346

Wei, T.-Z., see Tang & al.

Whalley, A.J.S., see Yomyart & al.

Wu, Sheng-Hua. Hyphodontia tubuliformis, a new species from Taiwan. 95: 185-188.
2006.

Yagiz, Dursun, Ahmet Afyon, Muhsin Konuk, Stephan Helfer. Contributions to the
macrofungi of Bolu and Diizce Provinces, Turkey. 95: 331-334 2006.

Yao, Y.-J., see Tang & al.

Yazici, Kenan & Ali Aslan. Four new lichens from Turkey. 95: 315-318. 2006.

Yomyart, S., J. Piapukiew, R. Watling, A.J.S. Whalley & P. Sihanonth. Russula siamensis:
a new species of annulate Russula from Thailand. 95: 247-254. 2006.

Yu, Fu-Qiang, Yun Wang & Pei-Gui Liu. Tricholoma lavendulophyllum, a new species
from Yunnan, China. 95: 305-308. 2006.

Zhang, Keqin, see Hu & al.

Zhang, Miao, see Sun & al.

Zhang, Rong, see Sun & al.

Zhao, Yong-Chang, see Li & al.

Zhong, Ming-Hui, see Li & al.

347

Reviewers, Volume Ninety-four

The Editors express their appreciation to the following individuals who have, prior
to acceptance for publication, reviewed one or more of the papers appearing in this

volume.

Teuvo Ahti
Vladimir Antonin
André Aptroot
Narinder S. Atri
Gordon W. Beakes
Reinhard Berndt
Gregory Bonita
Irwin Brodo
Francisco D. Calonge
Susana Calvelo
Sharon A. Cantrell
Lori Carris

Lage Cerenius
Pedro Crous
Dennis E. Desjardin
Sionara Eliasaro
John A. Elix

Javier Etayo

Harry C. Evans
Alan M. Fryday
James H. Ginns
Gro Gulden

Ying-Lan Guo
Nils Hallenberg
Karen Hansen
Lennart Holm
V.G. Hosagoudar
Mustafa Isiloglu
Peter Johnston
Jichuan Kang
Ken Katumoto
Henning Knudsen
Hanns Kreisel
Teresa Lebel
ShiDong Li
XingZhong Liu
Zuoyi Liu

Nils Lundqvist
Xin-Chang Luo
E-H:C; McKenzie
Steven Miller
David W. Minter
Gabriel Moreno

Eiji Nagasawa

Lorelei L. Norvell
Silvano Onofri
Breuss Othmar
Clark Ovrebo

Ian Pasco

David Pegler
Shaun Pennycook
Michael Priest
Christian Printzen
Gerhard Rambold
Peter Roberts
Wayne Robinson
Jack D. Rogers
Roger Shivas

Bin Song

Turner Sutton
Chris Triggs
Clara Urzi

Jukka Vauras

Roy Watling

Zhu L. Yang
Wen-ying Zhuang

348

p. 181, line 2
p. 214, line 15
p. 243, Intro.line 10
p. 244, line 9
p. 264, line 5
p. 302, 6th line from bot
p. 303; line 17
p. 304 & 305, legends
Pp. 309; ined!
p. 384, 7th linn from bot
p. 410, line 8
p. 443, Abstr. line 8
—, ibid.
p. 448, line 8
p. 452, 5th line of tree
p. 456, line 19
p. 497, line 8
—, lines 9 & 10
—, lline 19
—, lline 33
p. 498, line 4 from bot

p. 379, line 4,

Front cover, last entry

p. ii, in Editorial Board

p. iii, 7" line from bottom
p. 15, abstract, line 5

p. 393, 5" from bottom

p. 400, Volume 93,

ERRATA

Volume 92

for: abnormis

for: M.

for: macrosporus
for: yungiensis

for: [illegible overprint]
for: brogniartii

for: A. ferrugineus
for: gamundii

for: chlamyfosporum
for: Acroditys

for: Psecocercospora
for: hydrocotyles, P.
for: achyrantis

for: achyrantis

for: spinulosus

for: achyrantis

for: p. 385

Jor; ps zal

for: p, 224
Oleg

for: p. 410

Volume 93

for: aurelio@castillo@uah.es

Volume 94

for: Vamsaprija indica
for: Sean Ross Pennycook
for: Vamsaprija indica
for: C luteolus

for: Thyrostoma

for: aurelio.castillo.uah.es

read: abnorme

read: Metarhizzium

read: macrospora

read: yungensis

read: var. robustum MUCL
read: brongniartii

read: Ascobolus ferrugineus
read: gamundiae

read: chlamydospora

read: Acrodictys

read: Pseudocercospora
read: hydrocotyles, P. spinulosa, P.
read: achyranthis
read: achyranthis
read: spinulosa
read: achyranthis
read: p. 384
read: p. 252
yeaa pa225
read: p. 92

read: p. 401

read: aurelio.castillo@uah.es

read: Vamsaprija indica
read: Shaun Ross Pennycook
read: Vamsaprija indica
read: C. luteolus

read: Thyrostroma

read: aurelio.castillo@uah.es

349

FROM THE EDITOR-IN-CHIEF

Color returns to MYCOTAXON

Volume 95 brings with it a welcome surprise: color. Over two decades have passed since
color has graced the pages of two previous MycoTaxoNn volumes, primarily due to the
high printing cost. Fortunately, Iturriaga & Pfister and Frank, Southworth & Trappe were
able to find sufficient funds to print their plates in full color in the current volume.

The results are stunning. You will find the photographs of Cookeina on page 141
and of Tuber on pages 233 & 237. MycoTaxon thanks the authors for allowing us to
demonstrate mycology’s more beautiful nature.

Publication schedule for 2006

Due to a combination of unanticipated problems, MycoTaxon is running behind
schedule. Volume 95 was delayed by a series of computer and health set-backs, and
Volume 96 is thinner than planned, primarily due to the number of manuscripts still in
revision. We fully intend to bring you four volumes in 2006 and hope that we receive
enough manuscripts to bring you the full number of pages promised in Volume 94. The
good news is that the Editors are now completely caught up with their backlogs so that
manuscript turn-around time is much quicker than usual. Volumes 96-98 will be sent as
they fill, and the journal should be back on its normal quarterly schedule by year's end.

To our Authors

Authors are asked to download instructions and forms from our INSTRUCTIONS TO
AUTHORS webpage on <www.mycotaxon.com> before preparing a paper for submission
to our journal. An abbreviated set of instructions was also published in MycoTaxon
94: 401-411 (2005/2006). All files are also available as Email attachments from the
Editor-in-Chief <editor@mycotaxon.com> on request.

MycoTaxon submission and publication preparation involves four steps:

Step 1—peer review: Authors send their formatted text document, illustration files,
and Reviewer Guidelines + checklist to two experts for peer review. Peer reviewers
must (a) return edited manuscripts and detailed comments to the authors and (b)
Email completed checklist forms and brief comments to the Editor-in-Chief before
authors submit their manuscripts for nomenclatural review.

Step 2—nomenclatural & French language review: After revising their manuscript following
peer review recommendations, authors Email a revised master clone (containing
footnotes, tables and captions but no illustrations) to the Nomenclature Editor at
<PennycookS@LandcareResearch.co.nz>. The Email message must include the
word ‘Mycotaxon on the subject line and list names and Email addresses of all peer
reviewers. Manuscripts written in French should also be submitted to the French
Language Editor <hennebertg@mbla.ucl.ac.be> at this time. Each Editor will return
annotated files with a list of needed corrections to the authors and Editor-in-Chief.

350

Step 3—final submission: Authors Email/post the following to the Editor-in-Chief: a
completed MycoTaxon submission form; one manuscript ppF/MSWord file or
printed copy showing all text, legends, tables, footnotes & graphics in place; a body
text clone (and table/legend text clones when tables, footnotes, and legends are
present), and artwork files. All materials must be correct so that the manuscript
can be prepared for immediate publication if necessary. The Editor-in-Chief usually
acknowledges receipt within two weeks, but acknowledgments of new submissions
may slow near press deadlines or when the editorial office is closed for research.

Step 4—press preparation: The Editor-in-Chief combines all files together to produce a
press-quality PDF. Entries for the Nomenclatural novelties and Author index pages
are sent with the PDF to all coauthors for approval after conversion. Editorial errors
are always corrected free of charge. Authors who request correction of errors present
in original author-prepared files, however, must pay at least $10 per correction
(minimum charge of $40) to cover editorial time and the production/delivery of an
invoice. Payment arrangements of all fees should be made by writing the Business
Manager <info@mycotaxon.com>

To our Readers

MycotTaxon frequently updates its webpages and regularly posts abstracts, table of
contents, indices, distributional checklists, and revised instructions and forms on its
website. We invite all of you to browse our website frequently for updated journal and
other interesting mycological news.

www.mycotaxon.com

MYCOTAXON is published quarterly during the periods of January-March, April-June, July-
September, and October-December by MycoTaxon, LTD., 316 Richard Pl. Ithaca, NY 14850-
0264. USPS Publication # 16-121, ISSN # 0093-4666. Periodical postage paid at Ithaca, NY, and
at additional mailing offices. Subscription rates for 2006: In U.S. and possessions, one year, $330;
reduced rate for personal subscribers, one year, $150. Foreign subscriptions, add $40 for IMEX air
mail. .

POSTMASTER!
Send address changes to MycoTaxon, LTp.
P.O. Box 264, Ithaca, NY 14851-0264 USA

RECENT BOOKS FROM MY COTA XON

Prices include surface mail shipment (for more books see www.mycotaxon.com/books.html)

Mycotaxon, Ltd., P. O. Box 264, Ithaca, NY 14851-0264, U.S.A.

Fungi of China, by S. C. Teng.
Mycotaxon, Ltd. 1996. Hardbound, xiv + 586 pp., 426 illustrations, map, portrait, index, 8-1/2x11 inches. $79.00.
Airmail price varies by country: enquire. ISBN 0-930845-05-6.
Edited by Richard P. Korf, with a foreword by Teng’s daughter, Rosaline Z. Deng.
Proceeds from sales go to the Teng family.

Special for Mycotaxon subscribers: deduct $20 from regular price!
What reviewers say about Teng’s Fungi of China:

“.. one of the most valuable books on the fungi of China ever published in English” —Mycologia 90: 1091-1092, 1998.

“.. a great big blue uncompromising brick of a book ... an instant classic. Anyone interested in identification of fungi, particularly in
Asia, should get this book immediately. Mycology owes another debt to Dick Korf for his sympathetic and intelligent editing of
this superb work.” —Bibliography of Systematic Mycology 10(6): xlviii-xlix. 1998.

“The book is important for any researcher interested in the systematic relationships, diversity, and distribution of fungi on a global
scale.” - New Zealand Journal of Botany 35: 265-266. 1977.

Some 3887 named species belonging to 759 genera of fungi (slime molds, plasmodiophoromycetes, chytrid, oomycetes, zygomycetes,
lichens, non-lichenized ascomycetes, anamorphic fungi, rusts, smuts, and the basidiomycetous macrofungi) hitherto known from Gansu,
Ningxia, Qinghai, Shaanxi and Xinjiang, China are listed. Useful references, detailed tropical distribution, and hosts or substrates are
: provided for each species. Contributing authors: Shuang-Lin Chen, Lin Guo, Shou-Yu Guo, Ying-Lan Guo, Shu-Xiao Sun, Shu-Xia Wei,
_ Hua-An Wen, Xiao-Qing Zhang, Jian-Yun Zhuang, and Wen-Ying Zhuang.

Higher Fungi of Tropical China, edited by Wen- Ying Zhuang.
Mycotaxon, Ltd. 2001. Cloth bound, 485 pp., 26 x 18.5 cm. US$50.00 plus postage. ISBN 0-930845-13-7.
(Please order direct from Wen-Ying Zhuang, PO Box 2714, Beijing 100080, China; zhuangwy@sun.im.ac.cn).

Some 5056 named species belonging to 1192 genera of higher fungi hitherto known from tropical China are listed. Useful references,
detailed tropical distribution, and hosts or substrates are provided for each species. Contributing authors: Lin Gou, Shou-Yu Guo, Ying-
Lan Guo, Xiao-Lan Mao, Shu-Xiao Sun, Shu-Xia Wei, Hua-An Wen, Zhi-He Yu, Xiao-Qing Zhang, Jian-Yun Zhuang, and Wen-Ying
Zhuang.

Karen D. Gettelman, Richard P. Korf, Susan C. Gruff & Ian F. Korf
Mycotaxon, Ltd. 1998. Softbound, 296 pp., 6x9 inches. $35.00. Airmail, $55.00. ISBN 0-930845-07-2.

Mycotaxon Cumulative Index for Volumes XXI-XL (1984-1991)

Richard P. Korf & Susan C. Gruff
Mycotaxon, Ltd. 1991. Softbound, 352 pp., 6x9 inches. $30.00. Airmail, $50.00. ISBN 0-930845-01-3.

Mycotaxon Cumulative Index for Volumes I-XX (1974-1984)

Richard P. Korf & Susan C. Gruff
Mycotaxon, Ltd. 1984. Softbound, 232 pp., 6x9 inches. $17.50. Airmail, $37.50.
ISBN 0-930845-00-5.

FUNGAL DIVERSITY RESEARCH SERIES (published in Hong Kong): Mycotaxon, Ltd. now ships rapidly from
the U.S. to North American customers. All prices are postpaid. Titles include: Marine Mycology—A Practical
Approach, Kevin D Hyde & Stephen B. Pointing (eds.), $100, 2000. Genera of Ascomycetes from Palms, by
Kevin D. Hyde, Joanne E. Taylor & Jane Frohlich, $100, 2000. Palm Microfungi, by Jane Frolich & Kevin D. Hyde,
$100, 2000. A World Monograph of Anthostomellaa, by Binsheng Lu & Kevin D. Hyde, $100, 2000. Checklist of
Hong Kong Fungi, by B.S. Lu, K.D. Hyde, W.H. Ho, H.M. Tsui, M.K.M. Wong, Yanna & D.Q. Zhou, $20, 2000.
Bio-Exploitation of Filamentous Fungi, Stephen B. Pointing & Kevin D. Hyde (eds.), $100, 2001. Fungi in Marine
Environments, Kevin D. Hyde (ed.), $80, 2002. Smut fungi from New Zealand—Fungi of New Zealand volume
2, by Kalman Vanky & Eric H.C. McKenzie, $50, 2002. The Genus Mycena in South-Eastern Australia, by Cheryl
A. Grgurinovic, $80, 2002. Freshwater Mycology, by C.K.M. Tsui & K.D. Hyde, $80, 2003. Myxomycetes of New
Zealand—Fungi of New Zealand volume 3, by Stephen L. Stephenson, $50, 2003. Microfungi of Tropical and
Temperate Palms, by Joanne E. Taylor & Kevin D. Hyde, $80, 2003. Revision of the genus Amphisphaeria, by Y.Z.
Wang, André Aptroot & Kevin D. Hyde, $60, 2004. For details see the Hong Kong University website:
www.hku.hk/ecology/mycology/FDRS/index.htm

EDITORS OF MYCOTAXON

. Lorelei L. Norvell, Eprror-IN-CHIEF Shaun R. Pennycook, NOMENCLATURE EDITOR —
Pacific Northwest Mycology Service _ PennycookS@LandcareResearch.co.nz rie
6720 NW Skyline Boulevard Manaaki Whenua Landcare Research
Portland, OR 97229, U.S.A Auckland, New Zealand
David L. Hawksworth Karen D. Gettelman Grégoire L. Hennebert
Book REVIEW EDITOR INDEX EDITOR FRENCH LANGUAGE EDITOR
MycoNova, Calle Aguila 12 510 Lake Blvd., Apt. 166 32 Rue del’Elevage
Colonia La Maliciosa, Mataelpino Davis, CA 95616 B-1340 Ottignies - LLN
ES-28411 Madrid, Spain U.S.A. | Belgium

MYCOTAXON is a quarterly, peer-reviewed journal devoted to mycological taxonomy and nomenclature.
All articles are reviewed by specialists prior to submission. Publication is open to everyone. Papers may be in
English or in French. Summaries in those or any additional languages desired by the authors are given for longer
articles. Printing is on high quality, acid-free book paper. Authors prepare their own text-ready files after having
received critical comments from pre-submission reviewers and nomenclatural review by the Nomenclature.
Editor. Instructions to Authors (Mycotaxon 94: 401-411, 2005) and Guidelines for Reviewers are updated and can
be downloaded from our website at <www.mycotaxon.com>. Ckeg

SUBSCRIPTION INFORMATION

All subscriptions are on an annual basis, with four quarterly volumes each year. Persone subscriptions al ar
available at a substantially reduced rate for those who agree not to deposit their copies in a library other than
their personal one within 3 years of receipt. Address all orders to the MYCOTAXON ORDER DEPARTME
P.O. Box 264, Ithaca, NY 14851-0264 USA, or your agent. Prices and availability of back volumes are posted on-
line at <www.mycotaxon.com> or can be provided on request by Email from <info@mycotaxon.com>. Mycotaxon |

may be obtained on a journal-exchange basis. Proposals for such exchanges from journals, institutions, 0
individuals with difficulty in obtaining foreign currency should be addressed to the Order Department. 4

The annual subscription rates for 2006 (four volumes annually) are

USA Foreign (IMEX air assist) ,

REGULAR (multi-user) $330 $370
PERSONAL (individual) $150 $190

All back volumes [except volumes 22, 24, 34(2), 35, 41, 54, and 64, currently out of print] are available at $35 coe
by surface mail, $55 each by air mail. Volumes 1, 38, 39, 43 and 46 were reprinted in 2001; the original ro a
volume 1, part 1 is provided, with parts 2 and 3 reprinted.

CUMULATIVE INDICES Rs
Printed versions of the Mycotaxon Cumulative Indices for Volumes 1-20 (ISBN 0-930845-00-5), Volumes 21-40 i
(ISBN 0-930845-01-03), and Volumes 41-60 (ISBN 0-930845-07-02) are available (see descriptions at <www. —
mycotaxon.com> and order there or through your local bookstore’s listings under “Books in Print”). An online —
Cumulative Index to Taxa in Volumes 61-ff. and the Cumulative Author Index to Volumes 61-ff. are posted at
<www.inycotaxon.com>.

AVAILABILITY IN MICROFILM, PHOTOCOPY, & ELECTRONIC VERSIONS
MYCOTAXON is also partially available in microfilm from National Archive Publishing Company <www.
napubco.com>. Tear sheets or photocopies of individual articles may be obtained from ISI Document Solution
<www.isidoc.com>. Many back volumes are available as free downloads through Cyberliber <www.cybertruffle. —
org.uk/cyberliber/index.htm> under ‘Catalogues & Journals:

CONTACTING MYCOTAXON’S EDITOR-IN-CHIEF BY E-MAIL OR FAX
To reach the Editor-in-Chief regarding manuscripts, E-mail to <editor@mycotaxon.com> or Fax to Lorelei L.
Norvell at +503.297.3296.

CONTACTING MYCOTAXON’S ORDER DEPARTMENT BY E-MAIL OR FAX
To reach the Order Department for information or placing orders, you may E-mail to <info@mycotaxon.
com> or you may Fax to Orders, Mycoiaxon, Ltd., May-October at +607.273.4357, and November-—April at
+727.321,1460.

VISIT MYCOTAXON ON THE WORLD WIDE WEB AT <www.mycotaxon.com>

Internet Archive Audio

Featured

Top

Images

Featured

Top

Software

Featured

Top

Texts

Featured

Top

Video

Featured

Top

Mobile Apps

Browser Extensions

Archive-It Subscription

Save Page Now

Full text of "Mycotaxon"

See other formats